The HepG2 human hepatocellular cancer-derived cell line (HB-8065TM; ATCC, Manassas, VA, USA) was maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2 mM L-glutamine (Aurogene SRL, Rome, Italy), 10% heat-inactivated fetal bovine serum (FBS) and 1% antibiotics of 50 U/mL penicillin and 50 $\mu$g/mL streptomycin (both from Aurogene SRL) in a 37 °C, 5% CO${}_2$, 95% air cell culture incubator. The HaCaT human keratinocyte cell line was a kind gift from Professor L. Mosca (Sapienza University of Rome, Rome, Italy); cells were grown at 37 °C, 5% CO${}_2$, 95% air in DMEM containing 4.5 g/L glucose, supplemented with 10% heat inactivated FBS, 2 mM L-glutamine and 50 $\mu$g/mL gentamicin (Aurogene SRL) in 25-cm${}^2$ flasks, 75-cm${}^2$ flasks or multiwell plates. The day before the experiments, cells were serum starved in DMEM containing 1 g/L glucose and 2 mM L-glutamine (without FBS, phenol red, or antibiotics).

Cells were incubated in the presence or absence of BPA and PFOA at different concentrations and times. When necessary, cells were harvested by trypsinization and centrifugation (1000 $\times$ g) and carefully suspended in working medium at a density of ~2.8 $\times$ 10${}^4$ cells/cm${}^2$ (HepG2) and ~1.2 $\times$ 10${}^4$ cells/cm${}^2$ (HaCaT). Cells were lysed with Cell Lysis Reagent (CelLytic${}^{\text{TM}}$ M; Merck Life Science, Darmstadt, Germany) containing protease inhibitor cocktail (Roche, Basel, Switzerland). The BCA assay was used to determine the protein content.

DMEM and FBS were from Invitrogen Life Technologies (Gibco, Paisley, UK) and PAA Laboratories (Linz, Austria). BPA, perfluorooctanoic acid, JC-1, MTT, and trypan blue solution were from Merck Life Science. PFOA was dissolved in sterile dimethyl sulfoxide (DMSO; Merck Life Science) and further diluted in water; the administration of 10 $\mu$M PFOA led to residual DMSO 0.01%. BPA was dissolved in 10% ethanol; the administration of 50 $\mu$M BPA led to residual ethanol 0.01%. In the dose-response experiments (Fig. 1) vehicle (0.1% DMSO and 0.02% ethanol) was assayed corresponding to the highest volume of PFOA and BPA administered. Lipopolisaccaride (LPS) from Escherichia coli and interferon-$\gamma$ (IFN-$\gamma$) were purchased from Merck Life Science. Nigericin and valinomycin utilized in the MMP determinations were from Abcam (Cambridge, UK).

Fig. 1.

Viability of HepG2 and HaCaT cells after exposure to BPA and PFOA. The percentage of living cells undergoing treatments with BPA or PFOA was assayed by the trypan blue exclusion test in a concentration range of 0–250 $\mu$M (A): BPA; (B) PFOA; # and * indicate the significance of data from HepG2 and HaCaT, respectively. The capacity of cells to reduce MTT was utilized to evaluate cell viability specifically related to mitochondrial integrity and activity (C–H). Dose-response cell viability assays (MTT) were carried out after a 24 h incubation with increasing concentrations of (C) BPA or (D) PFOA; ethanol (0.02%) and DMSO (0.1%) were used as vehicles for BPA and PFOA, respectively. Trends in cell viability decrease from dose-response MTT assays were observed for (E) BPA and (F) PFOA; # and * indicate the significance of data from HepG2 and HaCaT, respectively. Time-course viability of cells (HepG2 and HaCaT) after exposure to (G) 50 $\mu$M BPA or (H) 10 $\mu$M PFOA as measured by the MTT assay. Data are presented as the percentage of values obtained from untreated cells (100%). Data $\pm$ standard deviation (SD); n $\ge$3. Significance (p values) was assessed by unpaired t-test; ${}^{\mathrm{\#},}$*p $\le$ 0.05 vs control. ${}^{\mathrm{\#}\mathrm{\#},}$**p $\le$ 0.01 vs control. ${}^{\mathrm{\#}\mathrm{\#}\mathrm{\#},}$***p $\le$ 0.001 vs control.

The viability of HepG2 and HaCaT cells was assessed by the trypan blue exclusion test and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide] reduction assay as previously described [54]. Briefly, cells seeded on 35 mm dish or 6-well plates were incubated for 24 h with BPA or PFOA (from 1 to 250 $\mu$M). After treatment, cells were detached with trypsin, pelleted at 800 $\times$ g, resuspended in phosphate-buffered saline (PBS) and mixed with equal volume of trypan blue. Live (bright clear) and dead (blue) cells were counted in the Thoma cell counting chamber. For the MTT assay, cells (2 $\times$ 10${}^5$/mL) were seeded in a 96-well plate in a final volume of 100 $\mu$L/well and incubated for 6 to 72 h at 37 °C in the presence or absence of increasing BPA and PFOA concentrations (from 0.1 $\mu$M to 1 mM). Then 10 $\mu$L MTT solution (5 mg/mL) was added to each well, followed by a 4 h incubation at 37 °C. To dissolve the dark-colored formazan crystals produced by reduction of the MTT tetrazolium salt, cells were incubated for 30 min at 37 °C in the dark with 100 $\mu$L DMSO. The optical density of reduced MTT was measured at 570 nm with a reference wavelength at 690 nm using the Appliskan Microplate Reader (Thermo Fisher Scientific, Waltham, MA, USA).

Quantitative PCR (qPCR) was carried out in HepG2 and HaCaT cells. Briefly, cells were incubated for 24 h with BPA (50 $\mu$M) or PFOA (10 $\mu$M). After incubation, cells were harvested by trypsinization and centrifugation (1000 $\times$ g for 5 min at 20 °C), washed twice with Hank’s buffer and counted. Cells (1 $\times$ 10${}^6$) were lysed in 350 $\mu$L RA1 Buffer containing 10 mM DTT, and RNA was isolated and purified using the Nucleo Spin® RNA Kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions. Then, 1 $\mu$g total RNA was used for reverse transcription reaction with the RT2 First Strand Kit (Qiagen, Venlo, Netherlands) and qPCR was performed using primers designed by Bio-Rad Laboratories (Hercules, CA, USA) (Software Beacon Designer) and purchased by PrimmBiotech, Cambridge, USA. SYBR Green qPCR (Brilliant_SYBR_Green QPCR Master Mix) was performed using the Stratagene Mx3005p System (both from Agilent Technologies, Santa Clara, CA, USA). The cDNAs were amplified using 45 cycles consisting of a denaturation step (95 °C for 5 min) and amplification step (95 °C for 10 s, 55 °C for 30 s). Melting curve analysis was performed at the end of every run to ensure the presence of a single amplified product for each reaction. The $\beta$-actin gene (PrimmBiotech) was used for normalization. The primers used were as follows. nNOS (NOS1) forward: 5${}^{\prime }$ GCGGTTCTCTATAGCTTCCAGA 3${}^{\prime }$ reverse: 5${}^{\prime }$ CCATGTGCTTAATGAAGGACTCG 3${}^{\prime }$; iNOS (NOS2) forward: 5${}^{\prime }$ CCGAGTCAGAGTCACCATCC 3${}^{\prime }$ reverse: 5${}^{\prime }$ CAGCAGCCGTTCCTCCTC 3${}^{\prime }$; eNOS (NOS3); forward: 5${}^{\prime }$ GCCGTGCTGCACAGTTACC 3’ reverse: 5${}^{\prime }$ GCTCATTCTCCAGGTGCTTCAT 3${}^{\prime }$; MnSOD forward: 5${}^{\prime }$ TGGCCAAGGGAGATGTTACA 3${}^{\prime }$ reverse: 5${}^{\prime }$ TGATATGACCACCACCATTGAAC 3${}^{\prime }$; cyt c forward: 5${}^{\prime }$ TTTGGATCCAATGGGTGATGTTGAG 3${}^{\prime }$ reverse: 5${}^{\prime }$ TTTGAATTCCTCATTAGTAGCTTTTTTGAG 3${}^{\prime }$; and $\beta$-actin forward: 5${}^{\prime }$ GCGAGAAGATGACCCAGATC 3${}^{\prime }$ reverse: 5${}^{\prime }$ GGATAGCACAGCCTGGATAG 3${}^{\prime }$.

HepG2 and HaCaT cells (3 $\times$ 10${}^6$ cells) were incubated for 24 h with BPA (50 $\mu$M), PFOA (10 $\mu$M) or untreated, followed by lysis with CellLytic${}^{\text{TM}}$ M reagent in the presence of protease inhibitors (both from Merck Life Science). Cells were also incubated for 24 h with 1 mg/mL LPS and 10 ng/mL IFN-$\gamma$ (both from Merck Life Science) as a positive control of iNOS induction. Protein samples (50 $\mu$g) were separated on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis gels and electrotransferred to polyvinylidene difluoride membranes. After blocking for 1.5 h in 4% bovine serum albumin, membranes were incubated overnight at 4 °C with the following primary antibodies: polyclonal anti-iNOS antibody (Boster Biological Technology, Pleasanton, CA, USA), polyclonal anti-eNOS and anti-nNOS antibodies (both from Santa Cruz Biotechnology, Dallas, TX, USA), polyclonal anti-MnSOD antibody (Bio-Rad), monoclonal anti-cyt c antibody (Santa Cruz Biotechnology) and monoclonal anti $\beta$-actin antibody (Invitrogen, Waltham, MA, USA). All primary antibodies were diluted 1:1000 in blocking buffer, except anti $\beta$-actin antibody that was diluted 1:5000. After washing with PBS/Tween, the membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibodies (1:5000; Merck Life Science). Proteins were detected with ChemiDocTM MP Image Analysis Software (Bio-Rad) after the addition of Enhanced Chemiluminescence Western Blotting Substrate (Bio-Rad). When necessary, membranes were stripped (in glycine/SDS/Tween 20, pH 2.2) and reprobed with anti-eNOS/nNOS antibodies. Densitometric analysis was carried out with Image Lab 6.0.1 software (Bio-Rad, CA, USA).

Reactive oxygen species (ROS) generation was assessed in living cells using two fluorescent probes with a slight difference in ROS specificity for independent evaluations: red-fluorescent MAK145 (Merck Life Science) and 2${}^{\prime }$,7${}^{\prime }$-dichlorodihydrofluorescein diacetate (DCFDA) (Cayman Chemical Company, Ann Arbor, MI, USA). Before the assay, HepG2 and HaCaT (~1 $\times$ 10${}^6$ cells/mL) were incubated for 24 h in a 24-well (black) plate in the presence of BPA 50 $\mu$M and PFOA 10 $\mu$M or untreated; cells were also assayed in the presence of H${}_2$O${}_2$ (0.1 mM) as a positive control. MAK145 was added 1 h before the termination of treatments. After 1 h of incubation, according to the manufacturer’s instructions, the fluorescence intensity was measured at $\lambda {}_{\text{ex}}$ = 520 and $\lambda {}_{\text{em}}$ = 605 nm. DCFDA (10 $\mu$M) was incubated for 30 min at 37 °C after treatment, and the fluorescent signal was measured at $\lambda {}_{\text{ex}}$ = 485 and $\lambda {}_{\text{em}}$ = 535 nm. Fluorescence was measured with the VICTOR${}^{\text{TM}}$ Multilabel Counter Plate Reader (Perkin Elmer, Waltham, MA, USA).

The total NOx was evaluated as a quantitative measure of NO production. The accumulation of NOx was assessed in the culture medium of HepG2 and HaCaT cells (~2.5 $\times$ 10${}^5$ cells/mL), which were grown overnight in DMEM 1 g/L glucose (without FBS and phenol red), upon 24 h exposure to BPA 50 $\mu$M and PFOA 10 $\mu$M. After incubation, the cell supernatants were centrifuged at 1000 $\times$ g for 10 min at 4 °C, and the NOx content was determined fluorometrically using the fluorescent probe 2, 3-diaminonaphthalene (DAN) (Nitrate/Nitrite Fluorometric Assay Kit; Cayman Chemical Company). The fluorescent intensity, which is proportional to total NO production, was measured with the Fluorescence Plate Reader VICTOR Multilabel Counter (Perkin Elmer, Waltham, USA) using an excitation wavelength of 375 nm and emission wavelength of 420 nm.

The evaluation of 3-NT modified proteins was used as marker of peroxynitrite- mediated NS in HepG2 and HaCaT cells treated with BPA 50 $\mu$M and PFOA 10 $\mu$M or untreated. After treatments, HepG2 cells were trypsinized, centrifuged at 500 $\times$ g for 10 min and washed twice with PBS. The cell pellet (1 $\times$ 10${}^6$ cells) was resuspended with extraction buffer and incubated on ice for 20 min. After centrifugation at 12000 $\times$ g 4 °C for 20 min, the 3-NT levels were assessed colorimetrically using the competitive Nitrotyrosine ELISA Kit (Abcam) and normalized to the total protein content determined by the BCA assay. The absorbance was measured at 450 nm using the Appliskan Microplate Reader (Thermo Fisher Scientific).

MMP was measured by flow cytometry (Accuri C6 Flow Cytometer®; Becton Dickinson, Franklin Lakes, NJ, USA) to detect the accumulation of the cationic fluorescent probe JC-1 (5,5’,6,6’-tetrachloro-1,1’,3,3’ tetraethylbenzimidazolylcarbocyanine iodide) (Abcam) into the mitochondrial negatively charged matrix according to the manufacturer’s instructions [55]. Briefly, after treatment with BPA 50 $\mu$M or PFOA 10 $\mu$M, HepG2 and HaCaT cells were trypsinized, pelleted at 1000 $\times$ g for 5 min at 20°C, and resuspended in PBS at a density of 5$\times$10${}^5$cells/mL. Cell suspensions were incubated for 20 min in the dark with JC-1 2.5 $\mu$g/mL, washed twice and resuspended in 300 $\mu$L PBS. When necessary, 0.6 $\mu$M nigericin was added. After the addition of nigericin, the fluorescence level peaked within approximately 20 min; thereafter, the fluorescence signal was rapidly dissipated with the addition of 0.2 $\mu$M valinomycin. JC-1 was excited at 488 nm, green fluorescence was quantified at 530 nm (FL1 channel), and red fluorescence was quantified at 585 nm (FL2 channel).

Data are reported as the mean $\pm$ standard deviation of at least three independent experiments and significance (p values) were determined using the unpaired Student’s t-test. p $\le$ 0.05 was considered statistically significant.

The cytotoxicity of BPA and PFOA in HepG2 and HaCaT cells was determined by the trypan blue exclusion and MTT assays (Fig. 1). Dose-response analyses were performed by incubating both cell lines with increasing amounts of BPA or PFOA. As shown in Fig. 1A–C, 24 h exposure to BPA induced similar effects on HaCaT and HepG2 cells, namely, a decrease in cell viability of about 20% in a concentration range of 50–100 $\mu$M, followed by an additional decrease in viability of about 50% at a BPA concentration of 250 $\mu$M. After further increasing the BPA concentration, higher toxicity was observed, leading to residual viability of ~20% in both HaCaT and HepG2 cell lines. Dose-response analyses after the administration of PFOA revealed a 20% decrease in the viability of both cell lines at 10 $\mu$M, followed by an additional decrease at 50 $\mu$M PFOA (~70% overall viability) (Fig. 1B,D). In a concentration range of 100–250 $\mu$M PFOA, the overall decreasing trend observed was more pronounced for HaCaT than HepG2 cells. To better analyze the sensitivity of HaCaT and HepG2 cells to BPA/PFOA and to identify the condition of sublethal toxicity suitable for further investigations, the MTT assay was conducted for the time-dependent evaluation of the effects exerted by the ECs (Fig. 1G,H). At a concentration of 50 $\mu$M for BPA or 10 $\mu$M for PFOA, the overall cell metabolic activity was within a 20% value, and a decrease in cell viability was observed as a function of time. Extended exposure to BPA of both cell lines (Fig. 1E) resulted in a further ~10% decrease of metabolically active cells, reaching 70% after 72 h. A similar trend was observed after extending the PFOA incubation time, and slightly higher sensitivity was observed in HaCaT cells compared to HepG2 cells, with the former displaying a marked decrease in cell viability (30% viable cells) compared to the latter (60% viable cells) after 72 h of PFOA treatment (Fig. 1F).

The results of the viability assays allowed us to identify a suitable concentration and incubation time for further experiments: 50 $\mu$M for BPA or 10 $\mu$M PFOA, for 24 h. These conditions were indeed considered subtoxic, accounting for the limited metabolic alteration observed (within 20%).

The mRNA and protein levels of the different isoforms of NOS (iNOS and tissue-specific NOS, eNOS produced in hepatocytes [HepG2], and nNOS expressed in keratinocytes [HaCaT]) were determined after incubation with BPA or PFOA for 24 h. Compared to controls, BPA induced a two-fold increase in both iNOS (p = 0.015 vs ctr) and eNOS (p = 0.023 vs ctr) mRNA in HepG2 cells; the effect of PFOA on iNOS activation was higher (four-fold; p = 6 $\times$ 10${}^{-4}$ vs ctr), but differently from BPA, PFOA weakly decreased eNOS mRNA (less than 10%) (p = 0.0022 vs ctr) (Fig. 2A). In parallel, in HaCaT cells, BPA treatment resulted in increased mRNA expression of both NOS isoforms (Fig. 2B), but the effect was limited to a 1.5-fold increase (p = iNOS 0.054; p = nNOS 0.016 in HaCaT cells) compared to HepG2 cells. Similar to that observed in HepG2 cells, PFOA induced a significant decrease in nNOS mRNA in keratinocytes (~25%; p = 0.047 vs ctr), whereas iNOS was significantly upregulated (~1.4-fold; p = 0.017 vs ctr). The protein expression of the two NOS isoforms in HepG2 cells was consistent with the changes in mRNA expression, with a maximum increase of 50% upon PFOA treatment (p iNOS ${}_{\text{BPA}}$ = 0.026 vs ctr; p eNOS ${}_{\text{BPA}}$ = 0.013 BPA vs ctr; p iNOS ${}_{\text{PFOA}}$ = 6.1 $\pm$ 10${}^{-5}$ vs ctr); p eNOS = 0.013 BPA vs ctr) compared to controls (Fig. 2C). A similar increase with respect to iNOS expression was observed after 24 h cell treatment with a mixture of IFN-$\gamma$ and LPS (p = 0.0067 vs ctr), a positive control of iNOS induction (Fig. 2C). NOS protein detected by Western blotting in HaCaT cells showed iNOS increase above 1.5-fold (p = 0.017 vs ctr) upon PFOA treatment, whereas the effect of BPA on iNOS induction was only very small although significant (~10%; p = 0.026 vs ctr) (Fig. 2E). nNOS production was found to be comparable with the control level (Fig. 2E) after the various treatments, except for a narrow but significant increase (20%; p = 0.014 vs ctr) induced by BPA (Fig. 2E). The effect of PFOA on NOS protein expression was reproducible in the cell line assayed, with iNOS induction as a specific target.

Fig. 2.

NOS isoform expression in HepG2 cells and HaCaT cells treated with BPA or PFOA. (A–B) qPCR analysis was carried out (A) in the presence of iNOS/eNOS specific primers and cDNA purified from HepG2 cells treated for 24 h with 50 $\mu$M BPA (white bars) or 10 $\mu$M PFOA (grey bars); (B) in the presence of iNOS/nNOS specific primers and cDNA isolated from HaCaT cells after treatments. Data are reported as the percentage with respect to the expression of untreated cells. $\beta$ actin was used as the reference gene. (C–F) NOS isoform protein expression detected by Western blot analysis with specific antibodies in cell lysates after BPA (white lanes) or PFOA (grey lanes) treatment: (C) analysis of iNOS and eNOS proteins in HepG2 and (D) corresponding enhanced chemiluminescence (ECL) bands (E): iNOS and nNOS protein levels in HaCaT lysates, (F) corresponding ECL bands. Data are presented as the percentage with respect to untreated cells (black bars); 24 h IFN-$\gamma$ (10 ng/mL) + LPS (1 mg/mL) treatment was assayed as a positive control of iNOS induction (I/L, zebrine bars); Bands were detected by ECL after hybridization with peroxidase-conjugated secondary antibodies; densitometric analysis was conducted with Image Lab software with $\beta$ actin expression taken as reference in each sample (see methods and Supplementary Materials for details). Data $\pm$ SD.; n $\ge$3. Significance (p values) was assessed by unpaired t-test; *p $\le$ 0.05 vs control. **p $\le$ 0.01 vs control. ***p $\le$ 0.001 vs Control.

The mRNA expression levels of the mitochondrial proteins MnSOD and cyt c were detected following treatment of HepG2 and HaCaT cells with BPA or PFOA under the conditions previously described. The level of MnSOD mRNA was not significantly altered in HepG2 after 24 h of BPA exposure, and was slightly induced by PFOA (1.25-fold; p = 0.014 vs ctr) (Fig. 3A), although at the protein level, the significant upregulation of MnSOD was induced by both EDs (40% BPA increase; p ${}_{\text{BPA}}$ = 0.02 vs ctr; 60% PFOA increase; p ${}_{\text{PFOA}}$ = 1.7 $\times$ 10${}^{-5}$vs ctr), as shown in Fig. 3B. In HaCaT cells, a ~two-fold increment in MnSOD expression was induced by PFOA at mRNA level (p = 0.018 vs ctr) (Fig. 3C). Furthermore, the protein expression detected by anti-MnSOD antibody was increased by both BPA (40% increment; p = 0.019 vs ctr) and PFOA (34% increment; p = 2.1 $\times$ 10${}^{-6}$ vs ctr) (Fig. 3D), similar to what was observed in HepG2 cells under comparable incubation conditions.

Fig. 3.

MnSOD expression in HepG2 and HaCaT cells treated with BPA and PFOA. (A,C) MnSOD mRNA evaluation by qPCR analysis was carried out in the presence of MnSOD-specific primers (see methods) and cDNA purified from (A) HepG2 or (C) HaCaT cells treated for 24 h with 50 $\mu$M BPA (white) or 10 $\mu$M PFOA (gray) lanes; data are reported as percentage with respect to the expression of untreated cells. $\beta$ actin was used as the reference gene. (B,D) MnSOD protein expression detected by Western blotting conducted with anti-MnSOD antibody after 24 h treatments (see above); (B) HepG2, (D) HaCaT cells; data are presented as percentage with respect to untreated cells (black lanes); I/L: 24 h IFN-$\gamma$ + LPS treatment (zebrine lanes); insets: MnSOD western blot bands detected by ECL (see Supplementary Material for details). Data $\pm$ SD; n $\ge$3. Significance (p values) was assessed by unpaired t-test; *p $\le$ 0.05 vs control; **p $\le$ 0.01 vs control; ***p $\le$ 0.001 vs control.

The analysis of cyt c expression showed mRNA induction specifically driven by PFOA treatment of both cell lines, with a stronger effect observed in HepG2 cells (above two-fold, p = 0.0036; Fig. 4A) compared to HaCaT (~1.8-fold, p = 0.045; Fig. 4C). BPA treatment led to a small but significant decrease in cyt c mRNA (35% decrease; p = 0.036), with the effect limited to HaCaT cells, as in HepG2 cells, there was no significant change in cyt c mRNA expression after BPA treatment compared to the control (Fig. 4A). As shown in Fig. 4B, cyt c protein expression detected by Western blot analysis in HepG2 cells was ~1.4-fold higher in response to both BPA (p = 0.0087) and PFOA (p = 0.01) treatment, whereas the response of HaCaT cells regarding cyt c protein expression (Fig. 4D) was reproduced only in the case of PFOA treatment (~1.5-fold increase; p = 0.0013) but not by BPA. In keratinocytes, indeed, BPA led to no changes in cyt c protein expression under the condition assayed.

Fig. 4.

Cyt c expression in HaCaT cells treated with BPA and PFOA. (A,C) Cyt c mRNA evaluation by qPCR analysis carried out in the presence of cyt c-specific primers (see methods) and cDNA purified from (A) HepG2 or (C) HaCaT cells treated for 24 h with 50 $\mu$M BPA (white) or 10 $\mu$M PFOA (gray) lanes; data are reported as the percentage with respect to the expression of untreated cells. $\beta$ actin was used as the reference gene. (B,D) Cyt c protein expression detected by Western blotting carried out with anti-cyt c antibody after 24 h treatments (see above); (B) HepG2 and (F) HaCaT cells; data are presented as the percentage with respect to untreated cells (black lanes); I/L: 24 h IFN-$\gamma$ + LPS treatment (zebrine lanes); inset: cyt c western blot bands detected by ECL (see Supplementary Material for details). Data $\pm$ SD; n $\ge$3. Significance (p values) was assessed by unpaired t-test; *p $\le$ 0.05 vs control; **p $\le$ 0.01 vs control.

Overall, in HaCaT cells, 24 h treatment with BPA showed a lower sensitivity in terms of cyt c and MnSOD expression with respect to HepG2 and compared with the effects exerted by PFOA.

The production of ROS, the accumulation of NOx and the amount of NT modifications in proteins (3-NT) were measured to assess the OS and NS levels in HepG2 and HaCaT cells after 24 h treatment with BPA or PFOA. ROS determination was carried out taking advantage of two different ROS-targeting probes, for independent evaluations: DCFDA (Fig. 5A), mainly targeting hydrogen peroxide (H${}_2$O${}_2$) but with broad sensitivity towards other ROS and RNS, such as peroxynitrite; and the MAK-145 red-fluorescent probe (Fig. 5B) with selectivity for superoxide and hydroxyl radicals. Under the conditions assayed (24 h incubation with 50 $\mu$M BPA or 10 $\mu$M PFOA), ROS levels were specifically increased to ~50% with respect to control values as revealed by the DCFDA assay (Fig. 5A). Specifically, BPA induced a ~40% ROS increase in HaCaT (p = 0.006 vs ctr) but not HepG2 cells, whereas PFOA treatment induced a similar increase in both HepG2 (45% increase; p = 0.0117 vs ctr) and HaCaT (50% increase; p = 0.045 vs ctr) cells. IFN-$\gamma$ + LPS and H${}_2$O${}_2$ were used as positive controls. A much lower ROS level was detected by the MAK-145 probe, with significance in the case of BPA treatment of HepG2 cells (20%; p = 0.043 vs ctr) but not in HaCaT cells (p = 0.55 vs ctr). A small but significant ROS induction was also observed upon PFOA treatment of HepG2 (27%; p = 0.025) and HaCaT (32%; p = 0.041) cells compared to controls (Fig. 5B).

Fig. 5.

OS and NS induced by BPA and PFOA. Assays were carried out following 24 h incubation of both HaCaT and HepG2 cells with BPA 50 $\mu$M or PFOA 10 $\mu$M. (A,B) Intracellular ROS levels measured in HepG2 and HaCaT cells in the presence of (A) DCFDA and (B) red fluorescent MAK145 ROS-targeting probes (see methods). Data are presented as the percentage of values obtained from untreated cells and normalized for protein content. Data are the mean $\pm$ SD; n = 3. * p $\le$ 0.05 vs control; **p $\le$ 0.01 vs control; ***p $\le$ 0.001 vs control. (C) NOx accumulation (24 h) quantified from cell supernatant by DAN as described in the Methods section. Data $\pm$ SD; n = 3. * p $\le$ 0.05 vs control; **p $\le$ 0.01 vs control. (D) 3-NT determination. Protein 3-NT modifications detected by NT competitive ELISA (see methods) in BPA- or PFOA-treated and untreated cells (lysate). Data are the mean $\pm$ SD; n = 3. Significance (p values) was assessed by unpaired t-test; *p $\le$ 0.05 vs control; **p $\le$ 0.01 vs control; ***p $\le$ 0.001 vs control. Exact p values are in the main text.

The levels of NO end products, NOx, were found to be increased by treatment with both BPA and PFOA in the two cell lines tested (Fig. 5C). The effect was more evident in PFOA-treated cells, resulting in the increased accumulation of NOx by about two-fold and 1.5-fold for HepG2 (p = 0.0012) and HaCaT (p = 0.05) cells, respectively. A smaller but clearly significant induction of NOx was also achieved by BPA, by about 1.5-fold in both cell lines (p HepG2 = 0.009 and p HaCaT = 0.045 vs controls). It is worth noting that the result of increased NOx accumulation was in good agreement with the observation of increased NOS expression (especially iNOS) observed upon ED treatments.

As shown in Fig. 5D, the amount of NT modification in proteins was increased of about 25% in HepG2 cells following treatment of both BPA (p = 0.029 vs ctr) and PFOA (p = 0.018 vs ctr). Similar changes were seen in HaCaT cells exposed to PFOA (p = 0.021 vs ctr), whereas only a small irrelevant increase was observed for BPA (lower than 20%) under the assayed conditions. It is worth mentioning that a 24 h incubation of IFN-$\gamma$/LPS was able to specifically raise NO concentration in cells by iNOS activation, leading to the highest NT level, whereas the iNOS inhibitor 1400W showed the lowest level of NT, comparable in average to the control.

The overall mitochondrial functional state was investigated by measuring the MMP of BPA- or PFOA-treated cells, by evaluating the mitochondrial import of the fluorescent probe JC-1 and the formation of the red J-aggregates. As shown in Fig. 6A, after 24 h incubation with BPA, the MMP was significantly lowered in HepG2 (~20% decrease; p = 0.0115) and HaCaT (~40% decrease; p = 0.023), whereas no significant difference was induced by PFOA. Surprisingly, the response of the MMP to the two-step addition of the ionophores nigericin and valinomycin, indicated a condition of hyperpolarization determined by the incubation of cells with PFOA. The hyperpolarization was significant in HepG2 (~30% decrease; p = 0.032) with respect to the polarization level of the untreated cells, whereas a small non-significant depolarization was observed for BPA treatment (Fig. 6B). The MMP alterations described, specifically induced by BPA or PFOA, were observed in the two cell lines assayed.

Fig. 6.

MMP in cells incubated with BPA and PFOA. (A) The percentage of intensity ratio between red and green fluorescence of JC-1 was measured by flow cytometry in HepG2 and HaCaT cells after 24 h incubation with BPA 50 $\mu$M or PFOA 10 $\mu$M. (B) MMP of cells incubated for 24 h with BPA 50 $\mu$M or PFOA 10 $\mu$M. $△$F value (% of control) calculated as the difference between the maximal fluorescence of JC-1 reached after the addition of 0.6 $\mu$M nigericin (Nig) and the fluorescence measured after the addition of 0.2 $\mu$M valinomycin (Val). Val was added (at plateau) to collapse the membrane potential. Data $\pm$ SD, n = 3. Significance (p values) was assessed by unpaired t-test; * p $\le$ 0.05 versus control. Exact p values are reported in the main text.