1. Introduction
In healthy cells, the redox balance is maintained through a complex network of
adaptive responses that include the continuous generation and elimination of
reactive oxygen/nitrogen species (ROS/RNS). The fine-tune regulation of redox
signaling events is activated by incoming insults (physical, chemical, or
biological) to restore the physiological equilibrium [1, 2, 3, 4, 5].
Mitochondria are one of the main endogenous sources of ROS due to the formation
of superoxide ion (O) at the level of the electron transport chain
[6]. In addition, nitric oxide (NO·) production is achieved
through the specific activity of NO synthase (NOS) isozymes, i.e., neuronal NOS
(nNOS), endothelial NOS (eNOS), and inducible NOS (iNOS) [7, 8]. The nNOS and eNOS
enzymes catalyze the production of NO needed for signaling [9, 10]. By contrast,
iNOS activation, characterized by a strong increase in NO concentration
(M), is associated with host defense mechanisms and immune
responses [11], but is also responsible for deleterious effects such as the
persistent inhibition of oxidative phosphorylation (OXPHOS), redox imbalance, and
onset of inflammatory pathways [12, 13, 14, 15].
The short-lived, highly reactive peroxynitrite (ONOO) is generated by
the reaction of NO with O under conditions of increased
bioavailability of these substrates. ONOO is responsible for the direct or
indirect oxidation of biological molecules [16] and for protein modifications
occurring at the level of sensitive amino acids, such as the nitrosylation of
cysteine and nitration of tyrosine residues [17, 18].
A number of xenobiotics and related chemicals (e.g., atmospheric pollutants and
industrial contaminants) are involved in the production of intracellular ROS/RNS,
and the persistence of a given prooxidant stimulus may specifically affect redox
homeostasis leading to chronic oxidative stress (OS) [4, 15].
Diffuse OS is a common alteration in several pathological conditions including
hypertension, diabetes, neurodegeneration and cancer [1, 6, 19, 20]. Among the
exogenous sources of nitro-OS, there has been growing interest in the chemical
derivatives of synthetic compounds utilized in industrial manufacture. These
chemicals, widely utilized as plasticizer and waterproof materials for packaging,
utensils and pharmaceuticals, are now classified as emerging contaminants (ECs)
as they are dispersed in the environment at alarming concentrations [21, 22].
Bisphenol A (BPA) and perfluoro-octanoic acid (PFOA) are ideal representatives
of this class of pollutants. Due to their intrinsic high stability, resistance to
environmental conditions and long half-life, both have been widely used as
components of utensils and personal care tools to confer durability, plasticity
and impermeabilization [23, 24, 25].
The documented migration of BPA and PFOA from products to soil, water and food,
and the consequent bioaccumulation of these ECs have established a condition of
human chronic exposure to these pollutants through ingestion, inhalation and
dermal absorption [26, 27, 28, 29]. Great efforts are being made to clarify the adverse
effects that both BPA and PFOA may have on living organisms, and to better
understand the mechanisms underlying their toxic effects [27, 28, 30, 31, 32, 33, 34].
BPA and PFOA are endocrine disruptors (EDs), i.e., molecules able to interfere
with hormone-driven processes [35]. Several studies have shown correlations
between exposure to EDs and decreased fertility, as well as an increased
incidence of cancers such as breast, ovarian, thyroid, lung, and testis
[33, 35, 36, 37, 38].
Both BPA and PFOA are thought to target the mitochondria of exposed cells, thus
inducing mitochondrial dysfunction and promoting an increase of both ROS and RNS
with consequent onset of OS [39, 40, 41, 42, 43]. Glutamatergic neurons have increased
expression of both iNOS and nNOS, resulting in the elevation of ROS and RNS and
3-nitrotyrosine (3-NT) production induced by chronic exposure to BPA [44],
whereas 24 h PFOA exposure results in increased ROS and antioxidant enzyme
expression in the HepG2 human hepatoma cell line [45]. The proposed mechanisms of
BPA and PFOA toxicities are linked to their structural and chemical properties,
which favor cell permeability and point to the interactions with hormone
receptors (i.e., estrogen receptor and peroxisome proliferator activated receptor
alpha, respectively) in exposed cells [46, 47, 48]. Recent studies showed
that PFOA was able to interact with superoxide dismutase (SOD) directly, inducing
OS and apoptosis [49], and may lead to the production of proinflammatory
cytokines, ROS/RNS increase and mitochondrial dysfunction in rat cell model [40].
In this work, the mechanisms of toxicity of the EDs BPA and PFOA were
investigated, focusing on their ability to interfere with the NO signaling. To
this end, two human cell models were chosen to assess the effects of BPA and PFOA
treatments: the HepG2 hepatocellular cancer-derived cell line, which is the gold
standard model for xenobiotic metabolism and cytotoxicity studies; and the HaCaT
immortalized keratinocyte cell line, which is a model system to study the skin as
the outer barrier to environmental cytotoxic and genotoxic agents [50, 51, 52].
The expression of regulators involved in NO metabolism such as the NOS isoforms
(eNOS in HepG2, nNOS in HaCaT and iNOS in both cell lines) was assessed at both
the mRNA and protein levels, in association with evaluation of the expression of
the mitochondrial proteins manganese SOD (MnSOD) and cytochrome c (cyt c). As a
relevant parameter for the analyses of oxidative and nitrosative stress (NS), the
level of ROS production in cells treated with BPA and PFOA was determined, as
well as the accumulation of nitrites/nitrates (NOx), reflecting the increased
production of NO compared to untreated cells. Furthermore, as a downstream effect
of altered ROS/RNS homeostasis, we evaluated the level of 3-NT modification in
proteins and alterations of the mitochondrial membrane potential (MMP).
Upon cell treatment with low M concentrations of these substances (50
M BPA and 10 M PFOA) the physiologic cell redox homeostasis is
affected, with mitochondrial alterations compatible with the onset of a
persistent nitro-OS condition.
As members of a wide class of synthetic pollutants (ECs, EDs), both BPA and PFOA
have analogues for which a comparable level of toxicity has been reported
[27, 28, 38, 39, 49]. Further work is needed to clarify the effective EC pressure to
which living organisms are exposed and related redox dysregulation is generated.
We postulate that a comprehensive understanding of the specific contribution of
abundant ECs (e.g., BPA or PFOA) to alterations in NO signaling and the promotion
of OS and NS will provide a concrete basis by which to define the harmful effects
of these pollutants. Of relevance, the major involvement of NO signaling in the
toxicity exerted by the ECs BPA and PFOA and a novel remarkable effect of PFOA on
the regulation of NOS isoforms were observed in this study. Within the limitation
of the model system (cell lines) and application of selective incubation
conditions, which do not represent the complexity of the whole organism, we found
this cell line approach as an opportunity to evaluate the parameters related to
altered ROS and RNS bioavailability.
The results of this study may provide insight into the effects derived from an
impaired antioxidant cell response, which leads to an ROS/RNS increase,
bioenergetic dysfunction and inflammation at the tissue level, a condition
favoring the onset of pathological states [1, 20, 53].
2. Materials and Methods
2.1 Cell Culture
The HepG2 human hepatocellular cancer-derived cell line (HB-8065TM; ATCC,
Manassas, VA, USA) was maintained in Dulbecco’s Modified Eagle Medium (DMEM)
supplemented with 2 mM L-glutamine (Aurogene SRL, Rome, Italy), 10%
heat-inactivated fetal bovine serum (FBS) and 1% antibiotics of 50 U/mL
penicillin and 50 g/mL streptomycin (both from Aurogene SRL) in a 37
°C, 5% CO, 95% air cell culture incubator. The HaCaT human
keratinocyte cell line was a kind gift from Professor L. Mosca (Sapienza
University of Rome, Rome, Italy); cells were grown at 37 °C, 5%
CO, 95% air in DMEM containing 4.5 g/L glucose, supplemented with 10%
heat inactivated FBS, 2 mM L-glutamine and 50 g/mL gentamicin (Aurogene
SRL) in 25-cm flasks, 75-cm flasks or multiwell plates. The day
before the experiments, cells were serum starved in DMEM containing 1 g/L glucose
and 2 mM L-glutamine (without FBS, phenol red, or antibiotics).
Cells were incubated in the presence or absence of BPA and PFOA at different
concentrations and times. When necessary, cells were harvested by trypsinization
and centrifugation (1000 g) and carefully suspended in working medium
at a density of ~2.8 10 cells/cm (HepG2)
and ~1.2 10 cells/cm (HaCaT). Cells were
lysed with Cell Lysis Reagent (CelLytic M; Merck Life Science, Darmstadt,
Germany) containing protease inhibitor cocktail (Roche, Basel, Switzerland). The
BCA assay was used to determine the protein content.
2.2 Chemicals
DMEM and FBS were from Invitrogen Life Technologies (Gibco, Paisley, UK) and PAA
Laboratories (Linz, Austria). BPA, perfluorooctanoic acid, JC-1, MTT, and trypan
blue solution were from Merck Life Science. PFOA was dissolved in sterile dimethyl
sulfoxide (DMSO; Merck Life Science) and further diluted in water; the
administration of 10 M PFOA led to residual DMSO 0.01%. BPA was
dissolved in 10% ethanol; the administration of 50 M BPA led to
residual ethanol 0.01%. In the dose-response experiments (Fig. 1) vehicle
(0.1% DMSO and 0.02% ethanol) was assayed corresponding to the highest volume
of PFOA and BPA administered. Lipopolisaccaride (LPS) from Escherichia
coli and interferon- (IFN-) were purchased from Merck Life Science.
Nigericin and valinomycin utilized in the MMP determinations were from Abcam
(Cambridge, UK).
Fig. 1.
Viability of HepG2 and HaCaT cells after exposure to BPA and
PFOA. The percentage of living cells undergoing treatments with BPA or PFOA was
assayed by the trypan blue exclusion test in a concentration range of 0–250
M (A): BPA; (B) PFOA; # and * indicate the significance of data from HepG2 and HaCaT, respectively. The capacity of cells to reduce MTT was
utilized to evaluate cell viability specifically related to mitochondrial
integrity and activity (C–H). Dose-response cell viability assays (MTT) were
carried out after a 24 h incubation with increasing concentrations of (C) BPA or
(D) PFOA; ethanol (0.02%) and DMSO (0.1%) were used as vehicles for BPA and
PFOA, respectively. Trends in cell viability decrease from dose-response MTT
assays were observed for (E) BPA and (F) PFOA; # and * indicate the significance of data from HepG2 and HaCaT, respectively. Time-course viability of cells
(HepG2 and HaCaT) after exposure to (G) 50 M BPA or (H) 10
M PFOA as measured by the MTT assay. Data are presented as the
percentage of values obtained from untreated cells (100%). Data standard
deviation (SD); n 3. Significance (p values) was assessed by unpaired
t-test; *p 0.05 vs control. **p 0.01 vs control. ***p 0.001 vs control.
2.3 Cell Viability Assays
The viability of HepG2 and HaCaT cells was assessed by the trypan blue exclusion
test and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide]
reduction assay as previously described [54]. Briefly, cells seeded on 35 mm dish
or 6-well plates were incubated for 24 h with BPA or PFOA (from 1 to 250
M). After treatment, cells were detached with trypsin, pelleted at
800 g, resuspended in phosphate-buffered saline (PBS) and mixed with
equal volume of trypan blue. Live (bright clear) and dead (blue) cells were
counted in the Thoma cell counting chamber. For the MTT assay, cells (2
10/mL) were seeded in a 96-well plate in a final volume of 100
L/well and incubated for 6 to 72 h at 37 °C in the
presence or absence of increasing BPA and PFOA concentrations (from 0.1
M to 1 mM). Then 10 L MTT solution (5
mg/mL) was added to each well, followed by a 4 h incubation at 37 °C. To
dissolve the dark-colored formazan crystals produced by reduction of the MTT
tetrazolium salt, cells were incubated for 30 min at 37 °C in the dark
with 100 L DMSO. The optical density of reduced MTT was measured at
570 nm with a reference wavelength at 690 nm using the Appliskan Microplate
Reader (Thermo Fisher Scientific, Waltham, MA, USA).
2.4 Quantitative PCR
Quantitative PCR (qPCR) was carried out in HepG2 and HaCaT cells. Briefly, cells
were incubated for 24 h with BPA (50 M) or PFOA (10 M). After
incubation, cells were harvested by trypsinization and centrifugation (1000
g for 5 min at 20 °C), washed twice with Hank’s buffer and
counted. Cells (1 10) were lysed in 350 L RA1
Buffer containing 10 mM DTT, and RNA was isolated and purified using the Nucleo
Spin® RNA Kit (Macherey-Nagel, Düren, Germany) according to
the manufacturer’s instructions. Then, 1 g total RNA was used for
reverse transcription reaction with the RT2 First Strand Kit (Qiagen, Venlo,
Netherlands) and qPCR was performed using primers designed by Bio-Rad
Laboratories (Hercules, CA, USA) (Software Beacon Designer) and purchased by
PrimmBiotech, Cambridge, USA. SYBR Green qPCR (Brilliant_SYBR_Green QPCR Master
Mix) was performed using the Stratagene Mx3005p System (both from Agilent
Technologies, Santa Clara, CA, USA). The cDNAs were amplified using 45 cycles
consisting of a denaturation step (95 °C for 5 min) and amplification
step (95 °C for 10 s, 55 °C for 30 s). Melting curve analysis
was performed at the end of every run to ensure the presence of a single
amplified product for each reaction. The -actin gene (PrimmBiotech) was
used for normalization. The primers used were as follows. nNOS (NOS1) forward:
5 GCGGTTCTCTATAGCTTCCAGA 3 reverse: 5 CCATGTGCTTAATGAAGGACTCG
3; iNOS (NOS2) forward: 5 CCGAGTCAGAGTCACCATCC 3 reverse: 5
CAGCAGCCGTTCCTCCTC 3; eNOS (NOS3); forward: 5 GCCGTGCTGCACAGTTACC 3’
reverse: 5 GCTCATTCTCCAGGTGCTTCAT 3; MnSOD forward: 5
TGGCCAAGGGAGATGTTACA 3 reverse: 5 TGATATGACCACCACCATTGAAC 3; cyt c
forward: 5 TTTGGATCCAATGGGTGATGTTGAG 3 reverse: 5
TTTGAATTCCTCATTAGTAGCTTTTTTGAG 3; and -actin forward: 5
GCGAGAAGATGACCCAGATC 3 reverse: 5 GGATAGCACAGCCTGGATAG 3.
2.5 Western Blot Analysis
HepG2 and HaCaT cells (3 10 cells) were incubated for 24 h with
BPA (50 M), PFOA (10 M) or untreated, followed by
lysis with CellLytic M reagent in the presence of protease
inhibitors (both from Merck Life Science). Cells were also incubated for 24 h with
1 mg/mL LPS and 10 ng/mL IFN- (both from Merck Life Science) as a
positive control of iNOS induction. Protein samples (50 g) were separated
on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis gels and
electrotransferred to polyvinylidene difluoride membranes. After blocking for 1.5
h in 4% bovine serum albumin, membranes were incubated overnight at 4 °C
with the following primary antibodies: polyclonal anti-iNOS antibody (Boster
Biological Technology, Pleasanton, CA, USA), polyclonal anti-eNOS and anti-nNOS
antibodies (both from Santa Cruz Biotechnology, Dallas, TX, USA), polyclonal
anti-MnSOD antibody (Bio-Rad), monoclonal anti-cyt c antibody (Santa Cruz
Biotechnology) and monoclonal anti -actin antibody (Invitrogen, Waltham,
MA, USA). All primary antibodies were diluted 1:1000 in blocking buffer, except
anti -actin antibody that was diluted 1:5000. After washing with
PBS/Tween, the membranes were incubated for 1 h at room temperature with
horseradish peroxidase-conjugated secondary antibodies (1:5000; Merck Life
Science). Proteins were detected with ChemiDocTM MP Image Analysis Software
(Bio-Rad) after the addition of Enhanced Chemiluminescence Western Blotting
Substrate (Bio-Rad). When necessary, membranes were stripped (in
glycine/SDS/Tween 20, pH 2.2) and reprobed with anti-eNOS/nNOS antibodies.
Densitometric analysis was carried out with Image Lab 6.0.1 software (Bio-Rad, CA, USA).
2.6 Reactive Oxygen Species Quantification
Reactive oxygen species (ROS) generation was assessed in living cells using two
fluorescent probes with a slight difference in ROS specificity for independent
evaluations: red-fluorescent MAK145 (Merck Life Science) and
2,7-dichlorodihydrofluorescein diacetate
(DCFDA) (Cayman Chemical Company, Ann Arbor, MI, USA). Before the assay, HepG2
and HaCaT (~1 10 cells/mL) were incubated for 24
h in a 24-well (black) plate in the presence of BPA 50 M and PFOA 10
M or untreated; cells were also assayed in the presence of HO
(0.1 mM) as a positive control. MAK145 was added 1 h before the termination of
treatments. After 1 h of incubation, according to the manufacturer’s
instructions, the fluorescence intensity was measured at = 520 and
= 605 nm. DCFDA (10 M) was incubated for 30 min at
37 °C after treatment, and the fluorescent signal was measured at
= 485 and = 535 nm. Fluorescence was measured with the
VICTOR Multilabel Counter Plate Reader (Perkin Elmer, Waltham, MA, USA).
2.7 NOx Determination
The total NOx was evaluated as a quantitative measure of NO production. The
accumulation of NOx was assessed in the culture medium of HepG2 and HaCaT cells
(~2.5 10 cells/mL), which were grown overnight
in DMEM 1 g/L glucose (without FBS and phenol red), upon 24 h exposure to BPA 50
M and PFOA 10 M. After incubation, the cell supernatants were
centrifuged at 1000 g for 10 min at 4 °C, and the NOx content
was determined fluorometrically using the fluorescent probe 2,
3-diaminonaphthalene (DAN) (Nitrate/Nitrite Fluorometric Assay Kit; Cayman
Chemical Company). The fluorescent intensity, which is proportional to total NO
production, was measured with the Fluorescence Plate Reader VICTOR Multilabel
Counter (Perkin Elmer, Waltham, USA) using an excitation wavelength of 375 nm and
emission wavelength of 420 nm.
2.8 Detection of 3-NT Protein Modifications
The evaluation of 3-NT modified proteins was used as marker of peroxynitrite-
mediated NS in HepG2 and HaCaT cells treated with BPA 50 M and PFOA 10
M or untreated. After treatments, HepG2 cells were trypsinized,
centrifuged at 500 g for 10 min and washed twice with PBS. The cell
pellet (1 10 cells) was resuspended with extraction buffer and
incubated on ice for 20 min. After centrifugation at 12000 g 4
°C for 20 min, the 3-NT levels were assessed colorimetrically using the
competitive Nitrotyrosine ELISA Kit (Abcam) and normalized to the total protein
content determined by the BCA assay. The absorbance was measured at 450 nm using
the Appliskan Microplate Reader (Thermo Fisher Scientific).
2.9 MMP Measurements
MMP was measured by flow cytometry (Accuri C6 Flow Cytometer®;
Becton Dickinson, Franklin Lakes, NJ, USA) to detect the accumulation of the
cationic fluorescent probe JC-1 (5,5’,6,6’-tetrachloro-1,1’,3,3’
tetraethylbenzimidazolylcarbocyanine iodide) (Abcam) into the mitochondrial
negatively charged matrix according to the manufacturer’s instructions [55].
Briefly, after treatment with BPA 50 M or PFOA 10 M, HepG2 and
HaCaT cells were trypsinized, pelleted at 1000 g for 5 min at
20°C, and resuspended in PBS at a density of 510cells/mL. Cell suspensions were incubated for 20 min in the dark with JC-1 2.5
g/mL, washed twice and resuspended in 300 L PBS. When necessary,
0.6 M nigericin was added. After the addition of nigericin, the
fluorescence level peaked within approximately 20 min; thereafter, the
fluorescence signal was rapidly dissipated with the addition of 0.2 M
valinomycin. JC-1 was excited at 488 nm, green fluorescence was
quantified at 530 nm (FL1 channel), and red fluorescence was quantified at
585 nm (FL2 channel).
2.10 Statistical Analyses
Data are reported as the mean standard deviation of at least three
independent experiments and significance (p values) were determined
using the unpaired Student’s t-test. p 0.05 was
considered statistically significant.
3. Results
3.1 Cytotoxicity of BPA and PFOA in HepG2 and HaCaT cells
The cytotoxicity of BPA and PFOA in HepG2 and HaCaT cells was determined by the
trypan blue exclusion and MTT assays (Fig. 1). Dose-response analyses were
performed by incubating both cell lines with increasing amounts of BPA or PFOA.
As shown in Fig. 1A–C, 24 h exposure to BPA induced similar effects on
HaCaT and HepG2 cells, namely, a decrease in cell viability of about 20% in a
concentration range of 50–100 M, followed by an additional
decrease in viability of about 50% at a BPA concentration of 250
M. After further increasing the BPA concentration, higher toxicity
was observed, leading to residual viability of ~20% in both
HaCaT and HepG2 cell lines. Dose-response analyses after the administration of
PFOA revealed a 20% decrease in the viability of both cell lines at 10
M, followed by an additional decrease at 50 M PFOA
(~70% overall viability) (Fig. 1B,D). In a concentration range
of 100–250 M PFOA, the overall decreasing trend observed was more
pronounced for HaCaT than HepG2 cells. To better analyze the sensitivity of HaCaT
and HepG2 cells to BPA/PFOA and to identify the condition of sublethal toxicity
suitable for further investigations, the MTT assay was conducted for the
time-dependent evaluation of the effects exerted by the ECs (Fig. 1G,H). At a
concentration of 50 M for BPA or 10 M for PFOA, the
overall cell metabolic activity was within a 20% value, and a decrease in cell
viability was observed as a function of time. Extended exposure to BPA of both
cell lines (Fig. 1E) resulted in a further ~10% decrease of
metabolically active cells, reaching 70% after 72 h. A similar trend was
observed after extending the PFOA incubation time, and slightly higher
sensitivity was observed in HaCaT cells compared to HepG2 cells, with the former
displaying a marked decrease in cell viability (30% viable cells) compared to
the latter (60% viable cells) after 72 h of PFOA treatment (Fig. 1F).
The results of the viability assays allowed us to identify a suitable
concentration and incubation time for further experiments: 50 M for
BPA or 10 M PFOA, for 24 h. These conditions were indeed considered
subtoxic, accounting for the limited metabolic alteration observed (within 20%).
3.2 NOS Isoform Expression in HepG2 and HaCaT Cells Exposed to BPA
and to PFOA
The mRNA and protein levels of the different isoforms of NOS (iNOS and
tissue-specific NOS, eNOS produced in hepatocytes [HepG2], and nNOS expressed in
keratinocytes [HaCaT]) were determined after incubation with BPA or PFOA for 24
h. Compared to controls, BPA induced a two-fold increase in both iNOS (p
= 0.015 vs ctr) and eNOS (p = 0.023 vs ctr) mRNA in
HepG2 cells; the effect of PFOA on iNOS activation was higher (four-fold;
p = 6 10 vs ctr), but differently from BPA,
PFOA weakly decreased eNOS mRNA (less than 10%) (p = 0.0022 vs ctr)
(Fig. 2A). In parallel, in HaCaT cells, BPA treatment resulted in increased mRNA
expression of both NOS isoforms (Fig. 2B), but the effect was limited to a
1.5-fold increase (p = iNOS 0.054; p = nNOS 0.016 in HaCaT
cells) compared to HepG2 cells. Similar to that observed in HepG2 cells, PFOA
induced a significant decrease in nNOS mRNA in keratinocytes (~25%; p = 0.047 vs ctr), whereas iNOS was significantly
upregulated (~1.4-fold; p = 0.017 vs ctr). The
protein expression of the two NOS isoforms in HepG2 cells was consistent with the
changes in mRNA expression, with a maximum increase of 50% upon PFOA treatment (p iNOS = 0.026 vs ctr; p eNOS = 0.013 BPA vs ctr; p iNOS = 6.1 10 vs ctr); p eNOS = 0.013 BPA vs ctr)
compared to controls (Fig. 2C). A similar increase with respect to iNOS
expression was observed after 24 h cell treatment with a mixture of IFN- and LPS
(p = 0.0067 vs ctr), a positive control of iNOS induction (Fig. 2C). NOS protein detected by Western blotting in HaCaT cells showed iNOS increase
above 1.5-fold (p = 0.017 vs ctr) upon PFOA treatment, whereas
the effect of BPA on iNOS induction was only very small although significant
(~10%; p = 0.026 vs ctr) (Fig. 2E). nNOS
production was found to be comparable with the control level (Fig. 2E) after the
various treatments, except for a narrow but significant increase (20%;
p = 0.014 vs ctr) induced by BPA (Fig. 2E). The effect of PFOA
on NOS protein expression was reproducible in the cell line assayed, with iNOS
induction as a specific target.
Fig. 2.
NOS isoform expression in HepG2 cells and HaCaT cells treated
with BPA or PFOA. (A–B) qPCR analysis was carried out (A) in the presence of
iNOS/eNOS specific primers and cDNA purified from HepG2 cells treated for 24 h
with 50 M BPA (white bars) or 10 M PFOA (grey bars);
(B) in the presence of iNOS/nNOS specific primers and cDNA isolated from HaCaT
cells after treatments. Data are reported as the percentage with respect to the
expression of untreated cells. actin was used as the reference gene. (C–F) NOS
isoform protein expression detected by Western blot analysis with specific
antibodies in cell lysates after BPA (white lanes) or PFOA (grey lanes)
treatment: (C) analysis of iNOS and eNOS proteins in HepG2 and (D) corresponding
enhanced chemiluminescence (ECL) bands (E): iNOS and nNOS protein levels in HaCaT
lysates, (F) corresponding ECL bands. Data are presented as the percentage with
respect to untreated cells (black bars); 24 h IFN- (10 ng/mL) + LPS (1
mg/mL) treatment was assayed as a positive control of iNOS induction (I/L,
zebrine bars); Bands were detected by ECL after hybridization with
peroxidase-conjugated secondary antibodies; densitometric analysis was conducted
with Image Lab software with actin expression taken as reference in each sample
(see methods and Supplementary Materials for details). Data SD.;
n 3. Significance (p values) was assessed by unpaired t-test;
*p 0.05 vs control. **p 0.01
vs control. ***p 0.001 vs Control.
3.3 MnSOD and cyt c Expression in HepG2 and HaCaT Cells Exposed to
BPA and to PFOA
The mRNA expression levels of the mitochondrial proteins MnSOD and cyt c were
detected following treatment of HepG2 and HaCaT cells with BPA or PFOA under the
conditions previously described. The level of MnSOD mRNA was not significantly
altered in HepG2 after 24 h of BPA exposure, and was slightly induced by PFOA
(1.25-fold; p = 0.014 vs ctr) (Fig. 3A), although at the
protein level, the significant upregulation of MnSOD was induced by both EDs
(40% BPA increase; p = 0.02 vs ctr; 60% PFOA
increase; p = 1.7 10vs ctr), as
shown in Fig. 3B. In HaCaT cells, a ~two-fold increment in
MnSOD expression was induced by PFOA at mRNA level (p = 0.018
vs ctr) (Fig. 3C). Furthermore, the protein expression detected by anti-MnSOD
antibody was increased by both BPA (40% increment; p = 0.019
vs ctr) and PFOA (34% increment; p = 2.1 10
vs ctr) (Fig. 3D), similar to what was observed in HepG2 cells under comparable
incubation conditions.
Fig. 3.
MnSOD expression in HepG2 and HaCaT cells treated with BPA and
PFOA. (A,C) MnSOD mRNA evaluation by qPCR analysis was carried out in the
presence of MnSOD-specific primers (see methods) and cDNA purified from (A) HepG2
or (C) HaCaT cells treated for 24 h with 50 M BPA (white) or 10
M PFOA (gray) lanes; data are reported as percentage with respect
to the expression of untreated cells. actin was used as the reference gene. (B,D) MnSOD protein expression detected by Western blotting conducted with
anti-MnSOD antibody after 24 h treatments (see above); (B) HepG2, (D) HaCaT
cells; data are presented as percentage with respect to untreated cells (black
lanes); I/L: 24 h IFN- + LPS treatment (zebrine lanes); insets: MnSOD western
blot bands detected by ECL (see Supplementary Material for details).
Data SD; n 3. Significance (p values) was assessed by unpaired
t-test; *p 0.05 vs control; **p 0.01 vs control; ***p 0.001 vs
control.
The analysis of cyt c expression showed mRNA induction specifically driven by
PFOA treatment of both cell lines, with a stronger effect observed in HepG2 cells
(above two-fold, p = 0.0036; Fig. 4A) compared to HaCaT
(~1.8-fold, p = 0.045; Fig. 4C). BPA treatment led to a
small but significant decrease in cyt c mRNA (35% decrease; p = 0.036),
with the effect limited to HaCaT cells, as in HepG2 cells, there was no
significant change in cyt c mRNA expression after BPA treatment compared to the
control (Fig. 4A). As shown in Fig. 4B, cyt c protein expression detected by
Western blot analysis in HepG2 cells was ~1.4-fold higher in
response to both BPA (p = 0.0087) and PFOA (p = 0.01)
treatment, whereas the response of HaCaT cells regarding cyt c protein expression
(Fig. 4D) was reproduced only in the case of PFOA treatment
(~1.5-fold increase; p = 0.0013) but not by BPA. In
keratinocytes, indeed, BPA led to no changes in cyt c protein expression under
the condition assayed.
Fig. 4.
Cyt c expression in HaCaT cells treated with BPA and PFOA. (A,C) Cyt c mRNA evaluation by qPCR analysis carried out in the presence of cyt
c-specific primers (see methods) and cDNA purified from (A) HepG2 or (C) HaCaT
cells treated for 24 h with 50 M BPA (white) or 10 M
PFOA (gray) lanes; data are reported as the percentage with respect to the
expression of untreated cells. actin was used as the reference gene. (B,D) Cyt
c protein expression detected by Western blotting carried out with anti-cyt c
antibody after 24 h treatments (see above); (B) HepG2 and (F) HaCaT cells; data
are presented as the percentage with respect to untreated cells (black lanes);
I/L: 24 h IFN- + LPS treatment (zebrine lanes); inset: cyt c western blot bands
detected by ECL (see Supplementary Material for details). Data
SD; n 3. Significance (p values) was assessed by unpaired
t-test; *p 0.05 vs control; **p 0.01 vs control.
Overall, in HaCaT cells, 24 h treatment with BPA showed a lower sensitivity in
terms of cyt c and MnSOD expression with respect to HepG2 and compared with the
effects exerted by PFOA.
3.4 ROS, NOx, and 3-NT Induction by BPA and PFOA
The production of ROS, the accumulation of NOx and the amount of NT
modifications in proteins (3-NT) were measured to assess the OS and NS levels in
HepG2 and HaCaT cells after 24 h treatment with BPA or PFOA. ROS determination
was carried out taking advantage of two different ROS-targeting probes, for
independent evaluations: DCFDA (Fig. 5A), mainly targeting hydrogen peroxide
(HO) but with broad sensitivity towards other ROS and RNS, such as
peroxynitrite; and the MAK-145 red-fluorescent probe (Fig. 5B) with selectivity
for superoxide and hydroxyl radicals. Under the conditions assayed (24 h
incubation with 50 M BPA or 10 M PFOA), ROS levels
were specifically increased to ~50% with respect to control
values as revealed by the DCFDA assay (Fig. 5A). Specifically, BPA induced a
~40% ROS increase in HaCaT (p = 0.006 vs ctr)
but not HepG2 cells, whereas PFOA treatment induced a similar increase in both
HepG2 (45% increase; p = 0.0117 vs ctr) and HaCaT (50%
increase; p = 0.045 vs ctr) cells. IFN- + LPS and
HO were used as positive controls. A much lower ROS level was
detected by the MAK-145 probe, with significance in the case of BPA treatment of
HepG2 cells (20%; p = 0.043 vs ctr) but not in HaCaT cells
(p = 0.55 vs ctr). A small but significant ROS induction was
also observed upon PFOA treatment of HepG2 (27%; p = 0.025) and HaCaT
(32%; p = 0.041) cells compared to controls (Fig. 5B).
Fig. 5.
OS and NS induced by BPA and PFOA. Assays were carried out
following 24 h incubation of both HaCaT and HepG2 cells with BPA 50
M or PFOA 10 M. (A,B) Intracellular ROS levels
measured in HepG2 and HaCaT cells in the presence of (A) DCFDA and (B) red
fluorescent MAK145 ROS-targeting probes (see methods). Data are presented as the
percentage of values obtained from untreated cells and normalized for protein
content. Data are the mean SD; n = 3. * p 0.05
vs control; **p 0.01 vs control;
***p 0.001 vs control. (C) NOx accumulation (24 h)
quantified from cell supernatant by DAN as described in the Methods section. Data
SD; n = 3. * p 0.05 vs control;
**p 0.01 vs control. (D) 3-NT determination. Protein
3-NT modifications detected by NT competitive ELISA (see methods) in BPA- or
PFOA-treated and untreated cells (lysate). Data are the mean SD; n = 3.
Significance (p values) was assessed by unpaired t-test; *p 0.05 vs control; **p 0.01 vs
control; ***p 0.001 vs control. Exact p
values are in the main text.
The levels of NO end products, NOx, were found to be increased by treatment with
both BPA and PFOA in the two cell lines tested (Fig. 5C). The effect was more
evident in PFOA-treated cells, resulting in the increased accumulation of NOx by
about two-fold and 1.5-fold for HepG2 (p = 0.0012) and HaCaT (p
= 0.05) cells, respectively. A smaller but clearly significant induction of NOx
was also achieved by BPA, by about 1.5-fold in both cell lines (p HepG2
= 0.009 and p HaCaT = 0.045 vs controls). It is worth noting
that the result of increased NOx accumulation was in good agreement with the
observation of increased NOS expression (especially iNOS) observed upon ED
treatments.
As shown in Fig. 5D, the amount of NT modification in proteins was increased
of about 25% in HepG2 cells following treatment of both BPA (p = 0.029
vs ctr) and PFOA (p = 0.018 vs ctr). Similar changes
were seen in HaCaT cells exposed to PFOA (p = 0.021 vs ctr),
whereas only a small irrelevant increase was observed for BPA (lower than 20%)
under the assayed conditions. It is worth mentioning that a 24 h incubation of
IFN-/LPS was able to specifically raise NO concentration in cells by iNOS
activation, leading to the highest NT level, whereas the iNOS inhibitor 1400W
showed the lowest level of NT, comparable in average to the control.
3.5 MMP of BPA- and PFOA-Treated HepG2 and HaCaT Cells
The overall mitochondrial functional state was investigated by measuring the MMP
of BPA- or PFOA-treated cells, by evaluating the mitochondrial import of the
fluorescent probe JC-1 and the formation of the red J-aggregates. As shown in
Fig. 6A, after 24 h incubation with BPA, the MMP was significantly lowered in
HepG2 (~20% decrease; p = 0.0115) and HaCaT
(~40% decrease; p = 0.023), whereas no significant
difference was induced by PFOA. Surprisingly, the response of the MMP to the
two-step addition of the ionophores nigericin and valinomycin, indicated a
condition of hyperpolarization determined by the incubation of cells with PFOA.
The hyperpolarization was significant in HepG2 (~30% decrease;
p = 0.032) with respect to the polarization level of the untreated
cells, whereas a small non-significant depolarization was observed for BPA
treatment (Fig. 6B). The MMP alterations described, specifically induced by BPA
or PFOA, were observed in the two cell lines assayed.
Fig. 6.
MMP in cells incubated with BPA and PFOA. (A) The percentage of
intensity ratio between red and green fluorescence of JC-1 was measured by flow
cytometry in HepG2 and HaCaT cells after 24 h incubation with BPA 50
M or PFOA 10 M. (B) MMP of cells incubated for 24 h
with BPA 50 M or PFOA 10 M. F value (% of control)
calculated as the difference between the maximal fluorescence of JC-1 reached
after the addition of 0.6 M nigericin (Nig) and the fluorescence measured
after the addition of 0.2 M valinomycin (Val). Val was added (at plateau)
to collapse the membrane potential. Data SD, n = 3. Significance
(p values) was assessed by unpaired t-test; * p 0.05
versus control. Exact p values are reported in the main text.
4. Discussion
Environmental diffusion of the ECs BPA and PFOA, compounds widely utilized in
industrial manufacturing processes [21, 22], has resulted in alarming
concentrations detected in water and soil as well as bioaccumulation, as
demonstrated by the detection of both BPA and PFOA in human body fluids with
documented mother to fetus transfer [56, 57]. The adverse effects exerted by
chronic exposure of BPA and PFOA have been described over the last several years
[27, 32, 35]. Of relevance, the ED action shown for both compounds [33, 35, 36], and
related alterations of the physiological hormonal signals are strictly connected
to the perturbation of cellular pathways related to redox homeostasis. The
involvement of BPA in OS induction has been previously suggested based on its
interaction with estrogen receptors, although the mechanisms of this process need
to be elucidated [27, 31, 41, 44, 58].
This paper reports a detailed characterization of the biochemical parameters
related to OS and NS induced by BPA, showing a correlation between alterations of
ROS and RNS signaling and establishment of a cell redox imbalance with
consequences at the mitochondrial level. Furthermore, the novelty of the specific
involvement of PFOA in the perturbation of the NO signaling axis is proposed
here, with activation of iNOS and production of peroxinitrite, suggesting a
specific effect exerted by PFOA toward NS induction, under the condition assayed.
The limitations of the study with respect to the biomedical relevance of the
findings must be taken into account, with particular reference to the cell models
and the concentration of ECs assayed. As transformed/immortalized cells, the
HepG2 and HaCaT cell lines utilized in this study may display altered metabolism
and viability respect to normal cells. However, it must be considered that the
cell lines utilized represent a model system for toxicological studies and that
the experimental condition utilized (low glucose adaptation, FBS and phenol red
starvation) were adopted to minimize eventual deviations in the results. The
screening of dose-response and time dependency of the ECs carried out by the
trypan blue exclusion test and MTT assay (Fig. 1) was conducted to establish a
suitable concentration and time window for further investigations regarding OS
and NS in cell models of interest.
At the concentrations of 50 M BPA or 10 M PFOA, only
minor effects were observed on cell viability (20%; Fig. 1A–F), whereas
the same doses led to specific induction of mRNA encoding for the iNOS enzyme,
with stronger effects exerted by PFOA (four-fold iNOS induction in HepG2 cells)
with respect to BPA (two-fold iNOS induction in HepG2 cells). BPA was able to
induce a significant effect in terms of a “physiological” NOS (eNOS/nNOS)
modulation, whereas PFOA failed to evoke this specific cell response (Fig. 2A,B).
These considerations can be extended to the protein level (Fig. 2C–F), as the
increase in iNOS and e/nNOS showed a trend consistent with the mRNA data,
although a smaller amplitude of the effect (1.6-fold average increase) was
observed, and with a relevant exception given by the absence of iNOS induction in
HaCaT cells by BPA. These observations strongly suggest that both BPA and PFOA
have the ability to specifically affect the NO signaling axis, although through
different mechanisms.
The increased expression of the “physiological” tissue-specific NOS isoform
(eNOS in HepG2 and nNOS in HaCaT) induced by BPA may indicate the activation of
adaptation pathways that possibly stimulated a specific cell stress response
counteracting the detrimental activity of iNOS to limit the increase of highly
reactive molecules to an acceptable range in terms of OS/NS. Under the condition
assayed (50 M, 24 h), in agreement with a previous observation, BPA
incubation was associated with increases in MnSOD protein expression (Fig. 3). A
parallel induction of cyt c expression was observed in HepG2 BPA-treated cells
(Fig. 4), whereas HaCaT was insensitive to BPA with respect to cyt c stimulation.
The variation in ROS level observed was generally small in amplitude (Fig. 5A,B),
in accordance with an increase in MnSOD activity. In the case of BPA treatment,
ROS were almost comparable with untreated cells, except for a 1.5-fold increase
in HaCaT detected by DCFDA, which may possibly be associated with less evident
MnSOD activation in that cell line (Fig. 3D). The increase in NO end products
induced by BPA in both cell lines was in agreement with activation of the NO
signaling axis (Fig. 5C). These results were in line with an increase in 3-NT
protein modifications observed in BPA-treated HepG2 cells, although the results
were not significant in HaCaT cells (Fig. 5D). In keratinocytes, the analysis of
data arising from BPA treatments would seem indicative of their lower
sensitization to this toxic compound; however, these results are possibly related
to a cell response compatible with a different time window with respect to the
condition assayed, as suggested by the increase in ROS production observed after
1–4 h treatment with BPA (not shown).
At the mitochondrial level, BPA administration led to a decrease in MMP in both
cell lines (Fig. 6A). In HaCaT cells, this result was associated with the low
involvement of cyt c with respect to BPA-induced modulatory events (Fig. 4C,D),
revealing a depressed mitochondrial function. In view of the endocrine disruptive
activity of BPA, under the conditions herein explored, we clearly showed that
alteration of the NO axis [43, 44] and dysregulation of the mitochondrial
parameters [41], which have been previously proposed, are indeed strictly
correlated and may be associated with the induction of nitro-OS [31, 33].
The results observed upon PFOA treatment (10 M, 24 h) showed the
activation of iNOS at both the mRNA (four-fold increase in HepG2 cells) and
protein (60% increase) levels. Differently from BPA, this effect was not
associated to a parallel increase of the physiological NOS isoform, but iNOS
induction was accompanied by a small but significant decrease in eNOS and nNOS
mRNA in HepG2 and HaCaT cells, respectively (Fig. 2A,B). The observation of the
specific effect of PFOA on NO signaling is novel, and is related to the
documented inverse “crosstalk” occurring among the NOS isoforms under specific
cell conditions approaching the onset of NS [15]. The increase of iNOS expression
induced by PFOA led the inducible isoform to prevail over eNOS, suggesting the
onset of a more severe level of oxidative and nitrosative damage induced by PFOA
with respect to BPA, especially in hepatocytes, where the effects of long-lasting
NO increase derived by iNOS activity might trigger the initiation of
inflammation. The modulatory trend among NOS isoforms observed at the mRNA level
and confirmed at the protein expression level was associated with the increment
in OS and NS markers, such as ROS production, NOx accumulation, and 3-NT protein
modification (Fig. 5A–D). The results discussed above with respect to HepG2
cells exposed to PFOA were only partially reproduced in HaCaT cells, where the
same treatment was able to only induce a more confined but still significant iNOS
activation (Fig. 2B) confirmed by NOx accumulation, which was not associated with
a substantial increase in 3-NT-specific damage. In both cell lines, PFOA
treatment was able to induce a small but significant increase in MnSOD expression
under the conditions assayed (Fig. 3), a result that, as mentioned above, may
possibly explain the general finding of a limited increase in ROS levels compared
to controls (Fig. 5A,B). However, the evidence of a consistent increment in
DCFDA-targeted ROS detected in HepG2 cells might be due to the sensitivity of
DCFDA for RNS and associated with an NS-specific induction driven by PFOA in
HepG2 cells. Focusing on mitochondrial functional parameters, PFOA was able to
induce a significant increase in mitochondrial potential, as indicated by the
increased component of the MMP observed in the presence of
ionophores (Fig. 6B). It is worth noting that the observed mitochondrial
hyperpolarization specifically induced by PFOA was associated with increased cyt
c expression (Fig. 4A,B) suggesting a degree of inhibition at the OXPHOS level.
The results presented point to an association between alteration of mitochondrial
function and OS, and highlight the role of the NS component generated through
activation of the NO-axis to the overall degree of cell dysfunction induced by
both EDs, particularly PFOA.
5. Conclusions
BPA and PFOA are both able to influence and alter the NO signaling pathway and
promote the alteration of mitochondrial function. In hepatocytes, PFOA determines
a proinflammatory condition, characterized by the high level of iNOS expression,
increased ROS, significant alteration of proteins at the nitro-tyrosine level,
and mitochondrial hyperpolarization. In the same cells, BPA was active in
deregulating physiologic eNOS/iNOS crosstalk at the expression level, leading to
elevation of NT modification with consequences at the mitochondrial level, as
suggested by the decreased MMP. The keratinocyte response to insult arising from
contaminant administration in the case of PFOA resulted in lower involvement of
NO signaling compared to HepG2, but still with indications of an altered MMP and
MnSOD activation at the mitochondrial level. The observed (mild) induction of
iNOS mRNA driven by BPA was not accompanied by increased iNOS protein in
keratinocytes, with the overall effect of a minor involvement of the NO axis
under the tested conditions. However, BPA was able to induce persistent
mitochondrial depolarization in keratinocytes, in accordance with the
endocrine-disruption physiological alterations induced by this compound.
The experimental work herein presented shows that BPA and PFOA may target
different components of the NO signaling pathway, with downstream effects mostly
related to alteration of cell redox homeostasis. Further investigations are
needed to fully understand the bioenergetic alterations and cell response linked
to the nitro-OS induced by these pollutants. The findings reported will help
clarify the mechanisms of action of BPA and PFOA, which will aid in the
management of pathological relapses linked to chronic exposure to these
environmental contaminants.
Abbreviations
3-NT, 3-nitrotyrosine; BCA, Bicinchoninic acid; BPA, Bisphenol A; Cyt c,
Cytochrome c; DAN, 1,1’,3,3’-tetraethyl-5,5’,6,6’-tetrachloroimidacarbocyanine
iodide; DCFDA, dichlorodihydrofluorescein diacetate; DMSO, Dimethyl sulfoxide;
DTT, Dithiothreitol; ECs, Emerging contaminants; EDs, Endocrine Disruptors; eNOS,
Endothelial nitric oxide synthase; ER, Estrogen receptor; iNOS, Inducible nitric
oxide synthase; JC-1, 1,1’,3,3’-tetraethyl-5,5’,6,6’-tetrachloroimidacarbocyanine
iodide; MMP, Mitochondrial membrane potential; MnSOD, Manganese superoxide
dismutase; MTT, 3(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide;
nNOS, Neuronal nitric oxide synthase; NO, Nitric oxide; NOx, Nitrogen oxides; OS, Oxidative stress; OXPHOS, Oxidative
phosphorylation; PFOA, Perfluoro-octanoic acid; qPCR, Quantitative PCR Reaction;
RNS, Reactive nitrogen species; ROS, Reactive oxygen species; SOD, Superoxide
dismutase.
Author Contributions
MCM and MA designed the research study. MX, BS, GA and FD performed the
research. MCM and BS analyzed the data. MA, MCM and BB wrote the manuscript. EP
and LS provided advice on data finalization and supervised manuscript
preparation. All authors contributed to editorial changes in the manuscript. All
authors read and approved the final manuscript.
Ethics Approval and Consent to Participate
Not applicable.
Acknowledgment
We warmly acknowledge Prof. Paolo Sarti (Department of Biochemical Science “A.
Rossi Fanelli”, Sapienza University of Rome) for promoting and supporting this
project. Dr. Mario Carere (Department of Environment and Health, Istituto
Superiore di Sanità, Rome, Italy) is acknowledged for fruitful discussion and
methodological advices on environmental pollutants. Prof. Luciana Mosca
(Department of Biochemical Science “A. Rossi Fanelli”, Sapienza University of
Rome) is gratefully acknowledged for providing us the HaCaT cell line.
Funding
Work supported by Regione Lazio of Italy (FILAS-RU-2014-1020 to prof. Paolo
Sarti). Sapienza Progetti di Ateneo to M.A. RP11715C819AF6BA. Ph.D. fellowship of
M.Xh. was funded by the Enrico and Enrica Sovena Foundation (Italy).
Conflict of Interest
Luciano Saso is serving as one of the Guest Editors of the special issue
“Modulation of oxidative stress: Biochemcal and pharmacological aspects”, in
this journal. We declare that Luciano Saso had no involvement in the peer review
of this article and has no access to information regarding its peer review. Full
responsibility for the editorial process of this article was delegated to Josef Jampílek.
Apart from what is mentioned above, all the authors declare that there is no
conflict of interest.