In the present investigation, we used human diploid primary fibroblasts VH10 cells which was a gift from Prof. Leon Mullenders, Department of Radiation Genetics and Chemical Mutagenesis, Leiden Medical University, the Netherlands. Different passages of VH10 cells were cultured in 12 mL of Dulbecco’s modified minimum essential medium (Sigma-Aldrich, Darmstadt, Germany) supplemented with 10% bovine serum (Sigma-Aldrich) and 1% penicillin-streptomycin (Sigma-Aldrich). The cells were validated and tested negative for mycoplasma. The cells were cultured in a humidified cell culture incubator at 37 °C and 5% CO${}_2$. Cells were re-seeded after trypsinization every week (Sigma-Aldrich) and cultured at 5 $\times$ 10${}^5$ cells in T75 cell culture flasks. The number of population doublings (PDs) for each time interval of 7 days was calculated from:

PD = ln (N${}_1$/N${}_0$)/ln2, where N${}_0$ is the number of cells seeded and N${}_1$ is the number of cells counted at the end of the time interval (day 7).

Further, the growth rate kinetics for the cells were established based on the accumulated number of population doublings each week. According to our previous results [32], we divided cells into three groups based on their senescence status: (1) “young cells” with passage number 13 or less (long telomere length (T/S ratio of 1), low SA-$\beta$-gal activity and high population doubling relative to P23); (2) “senescent cells” with passage number 20 or above (short telomere length compared with P8 (T/S ratio of 30%), a high percentage of SA-$\beta$-gal-positive cells and no population doubling); and (3) “middle-aged cells” with passage number between 13 and 19 (telomere length (T/S ratio of 60% of P8), SA-$\beta$-gal activity between P13 and P19, and few population doublings (1 or less)).

To establish the growth rate kinetics under chronic irradiation, a cell culture incubator equipped with a custom-made ${}^{137}$Cs source [9, 32, 33] was used for the exposure of the cells to 12 mGy/h. The experiment was started by seeding 5 $\times$ 10${}^5$ cells at passage 8 (P8, young cells) or passage 13 (P13, middle-aged cells). The P13 cells were exposed to chronic radiation at 12 mGy/h and we found that after 6 weeks of exposure, they stopped proliferating (PD 1). Sham-treated control cells were subjected to the same procedures as irradiated cells. The cells were counted and re-seeded at regular intervals (every 7 days). P13 cells irradiated for 6 weeks (Fig. 1) were regarded as premature senescence (PS). The PS cells were then divided into 2 parts: (1) transferred to a cell culture incubator without irradiation for 2 weeks to mimic recovery after irradiation (P19-ST) and (2) continued irradiation for an additional 2 weeks (P19-IR). In parallel, non-irradiated cell culture was used as a control for middle-aged cells (P19-C). After 2 weeks, these three groups of cells, as well as cultures of young ($>$9 passages) and senescent cells (passage 22) were prepared for telomere length quantification, SA-$\beta$-gal staining, analysis of DNA repair kinetics, and for colocalization analysis of DNA damage in telomeres. Trypan blue exclusion assay was performed to establish cell viability and cell culture medium was stored at –20 °C for determination of 8-oxo-dG.

Fig. 1.

The experimental design for establishing premature senescent cells: P19-C, non-irradiated control; P19-ST, 6 weeks chronically irradiated P13 cells with 2 weeks recovery time; and P19-IR, 6 weeks chronically irradiated P13 cells with a further 2 weeks incubation under chronic irradiation.

To establish DNA repair kinetics, young, middle-aged, and senescent cells were irradiated acutely with 1 Gy at a dose rate of 0.75 Gy/min using GammaCell$\mathrm{\circledR }$ 40 irradiator (Ottawa, ON, Canada) available at Stockholm University, Stockholm, Sweden. In a different set of experiments, P19 cells—P19-C, P19-IR (LDR exposed), and P19-ST (LDR exposed) (see above)—were also exposed to 1 Gy acute gamma irradiation at a dose rate of 0.75 Gy/min.

The DNA repair kinetics of the young, premature senescent, and senescent cells were established using $\gamma$H2AX foci formation. Briefly, one day before acute irradiation, the cells were trypsinized and 1.5 $\times$ 10${}^4$ cells were transferred to a small Petri dish (35 mm) with 3 mL complete medium and a sterile coverslip on the bottom. The cells were then kept in a cell culture incubator at 37 °C, allowing them to attach to the coverslip. Following exposure of the cells to 1 Gy, the levels of $\gamma$H2AX foci were determined at 45 min, 24 h, or 48 h post-irradiation in order to establish DNA repair kinetics. For detection of $\gamma$H2AX foci, the cells were fixed using 3% paraformaldehyde (Sigma-Aldrich) with 2% sucrose (Sigma-Aldrich, Darmstadt, Germany) for 10 min at room temperature, followed by permeabilization with 0.2% Triton X-100 (Sigma-Aldrich) for 2.5 min at room temperature. The cells were then washed with PBS three times before incubating for 1 h at 37 °C with the primary antibody anti-phospho-H2AX (Millipore, Billerica, MA, USA) in PBS supplemented with 2% Bovine Serum Fraction V albumin (BSA-V) (1:800). The cells were then washed quickly with PBS, followed by 30 min incubation at 37 °C with goat anti-mouse IgG, FITC-conjugated (Sigma-Aldrich,) secondary antibody in PBS supplemented with 2% BSA-V. Following a washing step, the cells were stained with 4${}^{\prime }$,6-diamidino-2-phenylindole, DAPI (Sigma-Aldrich) in PBS for 10 min. The coverslips were then removed from the Petri dish, mounted on a microscope slide using Vectashield$\mathrm{\circledR }$ Antifade Mounting Medium (Vector Laboratories, Peterborough, UK), and sealed. Slides were analyzed using a Nikon Eclipse E800 fluorescence microscope at 100$\times$ magnification. Images of a minimum of 50 cells were taken using a CCD camera (CoolCube1, Metasystems, Altlussheim, Germany) and ISIS software version 2.3 (Metasystems, Altlussheim, Germany). The number of total foci per nucleus was analyzed using Image-J,version 1.4u (LOCI, University of Wisconsin, Madison, WI, USA). The total number of foci per cell was counted and the mean and standard deviation for each time point and treatment were calculated.

Cells were prepared for Western blot analysis using our previously published protocol [34]. Briefly, the cells were lysed in Laemmli buffer with proteinase inhibitor (Roche Diagnostics GmbH, Mannheim, Germany). After quantification of protein in the lysates with Protein Assay Reagent (Thermo Scientific, Rockford, IL, USA), 10 µg protein per sample was loaded in a NuPAGE 4–12% Bis–Tris gel (Invitrogen, Waltham, MA, USA) for electrophoresis. The proteins were then transferred from the gel onto a Nitrocellulose membrane (Thermo Scientific) overnight at 30 V (4 °C) using XCell SureLock™ Mini-Cell System (Invitrogen, Waltham, Massachusetts, United States).

The unspecific binding sites on the membrane were then blocked by incubating the membrane in LI-COR blocking buffer (LI-COR, Cambridge, UK) for 90 min. The membrane was washed three times with Tris-buffered saline containing 0.05% Tween (TBST). Following the washing steps, the membrane was incubated with primary antibodies overnight at 4 °C followed by washing steps and secondary antibody incubation (anti-mouse conjugated with IRDye® Infrared Dyes (LI-COR)) before detection of the secondary antibody signals with Odyssey imaging system and quantification of protein bands with Image Studio version 5.2 software (LI-COR, Cambridge, Milton, Cambridge CB4 0WS, United Kingdom). The primary antibodies used were as follows: HO1 (1:1000, from rabbit, Novusbio, Centennial, CO, USA); P21 (1:1000, from mouse, Cell Signaling Technology, Inc., Danvers, MA, USA); hMTH1 (1:1000, from rabbit, Novusbio, Centennial, CO, USA ); and GAPDH (1:10,000, from mouse, Sigma, Saint Louis, MO, USA).

To investigate if $\gamma$H2AX foci were localized in the telomeres, we co-stained cells with $\gamma$H2AX (as above) and telomere probes and analyzed using confocal microscopy. For detailed information about the telomere FISH protocol, see reference [35]. Briefly, cells were fixed and permeabilized as mentioned above. To block unspecific binding sites, the coverslips with cells were incubated in ABDIL solution (please see reference [35] for details) with 5% bovine serum albumin (BSA, Sigma-Aldrich) for 2 hr at 37 °C. Following this step, the cells were incubated with primary anti-phospho-histone H2AX (ser-139) mouse monoclonal antibody (Millipore, Billerica, MA, USA) at 1:800 dilution in ABDIL solution containing 2% BSA (Sigma-Aldrich) at 37 °C for 1 h. Following incubation, the cells were washed three times with washing solution (PBS (Sigma-Aldrich) with 0.1% Tween-20 (Sigma-Aldrich)). The cells were then incubated with secondary goat anti-mouse IgG FITC conjugated (Sigma-Aldrich) in ABDIL solution and 2% BSA (Sigma-Aldrich) at 37 °C for 30 min in a dark chamber. The cells were washed three times with PBS (Sigma-Aldrich) and then treated with 2% paraformaldehyde for 10 min at room temperature and washed twice with MilliQ water.

The cells were dehydrated by incubating the slides for 3 min in 70%, followed by 90% and finally 99% ethanol (Absolut finsprit, Malmö, Sweden)/water solutions. The slides were then kept at room temperature for 20 min. The telomere probe, PNA, was prepared in a hybridization solution provided by the company (Alexa 647-OO-ccctaaccctaaccctaa, Panagene, South Korea) at a concentration of 200 nM. The solution was then heated to 90 °C for 5 min and applied on slides, which were then incubated first at 85 °C for 10 min and then overnight at 37 °C in a humidified chamber. Following overnight incubation, the slides were washed two times with a washing solution containing 70% formamide (Sigma-Aldrich) and 10 mM Tris-HCl at pH 7.5, and three times with a washing solution containing 50 mM Tris-HCL (Sigma-Aldrich) pH 7.5, 150 mM NaCl (Sigma-Aldrich), and 0.8% Tween-20.

The nuclei were stained with DAPI for 10 min. The coverslips were then quickly rinsed with MilliQ water and dehydrated by increasing concentrations of ethanol as described above. The dried coverslips were mounted with Vectashield and sealed with nail polish. The slides were stored at 4 °C until imaging with a microscope was performed. The imaging was performed using a Zeiss LSM 800 (Zeiss Group, Oberkochen, Baden-Württemberg, Germany) microscope equipped with an AiryScan detector and a laser for AlexaFluor-647 (Panagene, South Korea). The detector gain was set to 800–950 V and the digital gain to 1 in super-resolution mode. The signals of AlexaFluor-647 from the labeled telomeres were captured with 4% excitation power of a 650 nm laser, and five images (z-stacks, confocal) were captured in unidirectional frame scanning mode with 2048 $\times$ 2048 pixels. The images were saved in TIFF format and processed by Airyscan using Zen Black software (version 2.3, Zeiss Group, Jena, Germany). The signals were analyzed using the Fiji-ImageJ JACoP and Colocalization Finder plugins [36]. For quantification of $\gamma$H2AX foci repair kinetics, the single focal plane images were processed as described in the above section, while for studying colocalization of telomeres and $\gamma$H2AX foci, confocal images were processed. Using confocal images, we could visualize very small foci.

SA-$\beta$-gal staining was performed according to the protocol of Dimri et al. [5]. One day before staining, the cells were cultured in 6-well plates at 20,000 cells per well. Each sample was prepared as a duplicate and each experiment was repeated three times. The cells were washed twice in PBS (Sigma-Aldrich), and fixed at room temperature for 10 min in PBS containing 2% formaldehyde (Sigma-Aldrich), and 0.2% glutaraldehyde (Sigma-Aldrich). The cells were washed with PBS (Sigma-Aldrich), and stained with SA-$\beta$-gal staining solution assay (Sigma-Aldrich) overnight at 37 °C. Prior to scoring with the microscope, the samples were washed with PBS and then with distilled water. Around 500 cells in each sample were scored and then the percentage of SA-$\beta$-gal-positive cells (blue-green cytoplasm) was determined.

Genomic DNA was extracted from cells at different passages using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). The relative telomere length was determined based on a previously described method [37] with some minor modifications. Briefly, 40 ng DNA was mixed with 2 µL of 5$\times$ HOT FIREPol® Evagreen, qPCR Supermix (Solid Biodyne, Estonia), 800 nM telomere primers, or 400 nM 36B4 (gene accession number RPLP0) primer for single gene control. The primer sequences were: TEL-forward 5${}^{\prime }$$\to$3${}^{\prime }$ GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT and TEL-reverse 5${}^{\prime }$$\to$3${}^{\prime }$ TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA. The 36B4 gene [37] was used as a control gene using the following primer sequences; forward 5${}^{\prime }$$\to$3${}^{\prime }$ CAGCAAGTGGGAAGGTGTAATCC and reverse 5${}^{\prime }$$\to$3${}^{\prime }$ CCCATTCTATCATCAACGGGTACAA.

For the calculation of telomere length, the ratio of telomere length versus the single standard gene expression (T/S) based on the 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$ method described by Cawthon and coworkers was applied [37] and the Light Cycler® 480 SW version 1.5.1 software (Roche, Basel, Switzerland) was used to calculate C${}_{\text{t}}$ values.

For the detection of 8-oxo-dG in the medium, a modified competitive enzyme-linked immunosorbent assay (ELISA) method was applied. The method was set up and described by us previously [38, 39]. Firstly, the samples were pre-purified using a Bond Elute column to remove compounds that can cross-react with the primary antibody used in the ELISA method. The pre-purification step was performed two times. For the detection of 8-oxo-dG, 1 mL medium was used and processed following the protocol provided by the company Health Biomarkers Sweden AB, Stockholm, Sweden. All samples were analyzed in triplicate and the concentration of 8-oxo-dG was calculated based on a standard curve covering concentration ranges of 8-oxo-dG from 0.05 to 10 ng/mL. The concentration of 8-oxo-dG was expressed as ng per one million cells.

For each endpoint studied, at least three independent experiments were performed. The Student’s t-test was used to determine the p-values to compare results for irradiated and un-irradiated cells. Plotted results represent the average of experiments and bars correspond to standard error or standard deviation (indicated in the figure legends). A p-value lower than 0.05 was chosen to indicate a significant difference. The effect and interaction of the three factors—weeks in culture, exposure (to 12 mGy/h and no exposure), and the age (P8 and P13) on population doubling and 8-oxo-dG—were investigated by three-way ANOVA statistical analysis with Tukey post-hoc test. The analysis was performed on the data sets to examine which of the three factors show an effect and between which factors interaction can be observed.

The number of population doublings (PDs) of the P8 control cells (Fig. 2A) was about 2.5 $\pm$ 0.30 per week initially and then gradually decreased to 1.86 $\pm$ 0.40 after 6 weeks and to 1.15 $\pm$ 0.30 per week after 8–9 weeks (P17–P18), resulting in a total of 18.05 $\pm$ 0.25 PDs within 9 weeks. Chronically irradiated P8 cells (12 mGy/h) had a slightly lower PD during the first week (1.8 $\pm$ 0.10), which gradually decreased to 1.1 $\pm$ 0.05 after 6 weeks and reached 0.95 $\pm$ 0.10 after 9 weeks, resulting in a total of 11.52 $\pm$ 0.05 PDs within 9 weeks. For P13 cells (Fig. 2B), the corresponding number of PDs of non-irradiated control cells was initially 2.05 $\pm$ 0.25 per week, then gradually decreased to 1.3 $\pm$ 0.1 after 6 weeks and to 0.80 $\pm$ 0.20 after 9 weeks in culture, a total of 11.70 $\pm$ 0.40 PDs within 9 weeks. Meanwhile, the numbers for chronically irradiated P13 were 1.40 $\pm$ 0.05 PD initially, decreasing to 0.50 $\pm$ 0.37 PD after 6 weeks, and 0.50 $\pm$ 0.20 after 9 weeks of irradiation, resulting in a total of 6.17 $\pm$ 0.50 PDs within 9 weeks. In comparison with the corresponding controls, the time-dependent reductions of PD were significantly greater for P13 than for P8 after 8 weeks (p = 0.04) and 9 weeks (p = 0.02) of exposure, indicating that radiation affects the proliferation of P13 more than the proliferation of P8. Three-way ANOVA (Supplementary Table 1) analysis also showed a significant effect of interaction between treatment (exposure to 12 mGy/h dose) and age of the cells (treatment $\times$ age) on PD. At passage 18 (Fig. 2B), the PD of the non-irradiated P13 cells was calculated to be 1.5 times per week, while the corresponding irradiated cells had less than one doubling per week, indicating that irradiated cells entered senescence prematurely (stress-induced senescence status). In the present project, P13 cells irradiated chronically for 6 weeks were chosen as premature senescent (PS).

Fig. 2.

Pupulation doublings of P8 and P13 cells under chronic exposure to 12 mGy/h. (A) Young cells, passage 8 (P8); and (B) middle-aged cells, passage 13 (P13) with (${}^{\mathrm{•}\mathrm{•}\mathrm{•}}$⚫${}^{\mathrm{•}\mathrm{•}\mathrm{•}}$) and without (-▲-) exposure to chronic 12 mGy/h. Each data point is an average calculated from three independent experiments. Error bars indicate standard errors.

In order to compare the oxidative stress response between P8 and P13 cells, the cells were exposed to a chronic low dose rate of ionizing radiation for 8 weeks as described in the materials and methods. Then, the weekly levels of 8-oxo-dG in the cell culture media from irradiated and non-irradiated cells were analyzed. The slopes of the curves shown in Fig. 3A were calculated using linear regression as estimates of average increments of 8-oxo-dG per million cells and week. This comparison showed that the irradiated P13 cells produced significantly (p = 0.035) larger amounts of 8-oxo-dG compared to the irradiated P8 cells (on average 27 $\pm$ 7 and 45 $\pm$ 10 ng/10${}^6$ cells per week, respectively) and that the non-irradiated P13 cells produced significantly (p = 0.045) larger amounts than the non-irradiated P8 cells (on average 26 $\pm$ 5 and 16 $\pm$ 4 ng/10${}^6$ cells per week, respectively). Results from the three-way ANOVA (Supplementary Table 2) analysis were consistent with these results and showed that there was a significant effect of interaction between the treatment (exposure or no exposure) and age of the cells (treatment $\times$ age) on the 8-oxo-dG levels.

Fig. 3.

Oxidatve stress levels of the young, middle aged and senescent cells. Radiation induced extracellular 8-oxo-dG in the P8 and P13 cells (A) and the levels and the expressions of (B) HO1 and (C) hMTH1 proteins in the different passages of the cells used in the study. The solid lines in Fig. 3A are non-irradiated control cells, and the dash lines are cells exposed at 12 mGy/h. The values are presented as mean $\pm$ standard error, n = 3.

Additionally, we analyzed the expression of 2 proteins involved in oxidative stress, HO1, and hMTH1. The results are summarised in Fig. 3B,C. The results on HO1 (Fig. 3B) indicate no differences in the expression of HO1 among P19-C, P19 IR, P19 ST, and P23. However, compared with P8, a generally lower expression of HO1 was found in P19-C, P19-ST, P19-IR, and P23. The results in Fig. 3C, indicate a slightly, p = 0.09, decreased level of hMTH1 expression in non-irradiated P19-C compared to P8 cells. The expressions were increased in the exposed P19-ST and P19-IR cells as compared with P19-C. The levels of hMTH1 were similar in P8, P19-IR and P23.

The 6-week chronically irradiated P13 (P19-ST, P19-IR, and control non-irradiated P19-C cells), as well as RS (P23) and young cells (P8) were prepared for telomere length quantification, SA-$\beta$-gal staining and expression of P21. The results of telomere length quantification by Real-Time PCR are presented in Fig. 4A. The data on telomere length were expressed relative to the telomere length of young cells (here P8) and indicated that the telomere lengths of the cells were significantly shortened when the cells reached P19 and P23. Moreover, P19-ST and P19-IR had significantly shorter telomeres in comparison with P19-C, indicating that 6 weeks of chronic irradiation speeds up the process of telomere shortening and senescence in VH10 cells.

Fig. 4.

The levels of senescent cells in different passages of VH10 cells analyzed by different methods. (A) T/S ratio analysis by real-time PCR. The telomere length of P8 cells (the longest) was used as a reference to normalize the telomere lengths of the replicative and premature senescence cells, P23 and P19, respectively. (B) The percentage of SA-$\beta$-gal-positive cells in different passages of irradiated and non-irradiated VH10 cells in culture. (C) Examples of the SA-$\beta$-gal-positive cells in green were taken with light microscopy. (D) Analysis of the correlation (Pearson correlation coefficient) between the percentage of SA-$\beta$-gal-positive cells and the T/S ratio. (E) The expression of P21 protein in P8, P19-C, P19-ST, P19-IR, and P23 cells. The values in Fig. 4 (A, B, and E) are presented as mean $\pm$ standard error, n = 3. ****: p 0.0001, ***: p 0.001, **: p 0.01 *: p 0.05 and nc: no significant change.

The results of SA-$\beta$-gal staining are presented in Fig. 4B. The results showed a significantly elevated percentage of SA-$\beta$-gal-positive cells in P23 (~55%) as compared with P8 cells (~15%). The levels of SA-$\beta$-gal-positive cells were slightly (non-significantly) increased in the P19-ST, P19-IR, and P19-C as compared with P8 cells. Five representative pictures of SA-$\beta$-gal-positive cells (captured with a light microscope) in different cell passages are presented in Fig. 4C. A negative linear correlation (using Pearson correlation coefficient analysis) between SA-$\beta$-gal-positive cells and telomere lengths was found (Fig. 4D), r = –0.717. Additionally, the expression of P21 in the cells was investigated to check the growth arrest. The results are summarised in Fig. 4E and show that the expression of P21 was significantly lower in P8 cells than in the P19-C, P19-ST, P19-IR, and P23 cells indicating that the levels of the growth-arrested cells were significantly higher in P19s and P23 cells than in P8 cells.

$\gamma$H2AX foci have been considered as a surrogate marker of DNA double-strand breaks (DSBs) [40]. In the present investigation, VH10 cells at different passages (P8, P19-C, P19-ST, P19-IR, and P23) were irradiated acutely by 1 Gy gamma radiation to induce DSBs. The levels of $\gamma$H2AX foci were investigated in the cell nuclei at different time points (from 45 min up to 48 h) after acute irradiation.

The results are summarized in Fig. 5A,B. The results presented in Fig. 5A show that P8 VH10 cells have low steady-state levels of $\gamma$H2AX foci (~0.20 $\pm$ 0.05). Exposure to 1 Gy gamma radiation increased $\gamma$H2AX foci to ~17 $\pm$ 2 per cell at 45 min post-irradiation incubation, and then after 24 h of repair time, the levels of $\gamma$H2AX foci returned to steady-state levels (~0.3 $\pm$ 0.1). The P23 cells had ~3.5 $\pm$ 1.3 $\gamma$H2AX foci before irradiation, and exposure to 1 Gy gamma radiation resulted in ~22 $\pm$ 2 foci per cell at 45 min post-irradiation incubation and ~10 $\pm$ 1 foci remained after 24, as well as 48 h. The data indicate that RS cells have high steady-state levels of DSBs and that they repair the DSBs at a slower rate than the young P8 VH10 cells.

Fig. 5.

DNA repair kinetics of the young, premature senescence (PS) and replicative senescent (RS) cells exposed to 1 Gy. (A,B) DNA repair kinetics based on the $\gamma$H2AX foci assay in young P8, middle-aged P19-C, premature senescent P19-ST/P19-IR, and senescent P23 cells after exposure to 1 Gy of gamma radiation. The $\gamma$H2AX foci were visualized at 45 min, 24, and 48 h post-irradiation. Each bar represents the average of the total numbers of $\gamma$H2AX foci from three individual experiments, and the error bars represent mean $\pm$ standard error. (C,D) Representative images were taken by fluorescence microscopy: $\gamma$H2AX-staining in green and nuclei in red. ***: p 0.001, **: p 0.01 and *: p 0.05.

DNA DSB repair kinetics were also established for the PS cells, LDR-irradiated P19-ST and P19-IR, and their non-irradiated control cells, P19-C. The results are presented in Fig. 5B. Comparing the formation and repair of DSBs between the P19 cell types, no significant differences were observed. However, all the P19 cells had slightly elevated $\gamma$H2AX foci before irradiation (3.5 $\pm$ 0.5), and the remaining levels of $\gamma$H2AX foci after 24 and 48 h of exposure were ~4.5 $\pm$ 0.7 foci. The results indicate that: (a) PS cells (P19-ST and P19-IR) have almost the same DNA repair kinetics as their control cells (P19-C); (b) P19 cells may have a DNA repair kinetics that is similar to P8. Representative microscopy pictures of $\gamma$H2AX foci levels before and after irradiation by 1 Gy are presented in Fig. 5C,D.

Next, we wanted to investigate if the elevated $\gamma$H2AX foci in the premature and senescent cells before irradiation and 48 h after 1 Gy irradiation were localized in the telomeric area. We exposed all the cells to 1 Gy acute radiation and investigated the levels of $\gamma$H2AX foci which were located in the telomeres by co-staining the telomeres and the $\gamma$H2AX foci using a Zeiss LSM 800 microscope equipped with an AiryScan detector at the microscope core facility of Stockholm University. The results are presented in Fig. 6A and expressed as telomere dysfunction-induced $\gamma$H2AX foci (TIF) per cell as defined previously [41]. Based on diameter size, the foci were divided into 2 groups: more than 1 µm were considered “big foci” and less than 1 µm considered “small foci”, as previously described [42].

Fig. 6.

Telomeric DNA damage and nucleaus size of the young, PS and RS cells. (A) The levels of telomere dysfunction-induced foci (TIFs) in young, premature senescent, and replicative senescent cells, in the LDR-irradiated control cells (cell exposed to LDR but not to 1 Gy acute) and in the LDR-irradiated cells exposed to 1 Gy, 48 h after the exposure, nc indicates a p-value $>$ 0.05, no significant change, otherwise, the p-values are 0.05; (B,C) are examples of nuclei (in blue) stained for $\gamma$H2AX (green) and telomeres (red) before and after irradiation and in the Fig. 6C, examples of big and small foci, and TIF are shown; and (D) the bars show the average size of the nuclei $\pm$ standard error presented as pixel area of DNA stained by DAPI. ***: p 0.001 and nc: no significant change.

By measuring the diameter of $\gamma$H2AX foci in the telomeres, we found that the big $\gamma$H2AX foci were not localized in the telomeres, neither in the non-irradiated cells nor 48 h after 1 Gy radiation. The diameter of $\gamma$H2AX foci in the telomeres was less than 0.4 µm. These colocalized telomere/$\gamma$H2AX foci were considered telomere dysfunction-induced foci (TIFs) [41]. The results on TIF—summarized in Fig. 6A and Table 1 and some representative examples of images presented in Fig. 6B,C—indicated that the level of TIFs increased with the increasing age of the cells in most of the cells, both spontaneously (in P19-C), and by LDR irradiation (LDR-irradiated P19-ST and P19-IR controls), as well as 48 h after acute 1 Gy irradiation. The exception was the levels of TIFs in P19-ST and P19-IR which were similar. The levels of TIFs were increased significantly in the irradiated P19-C and P23 cells as compared with irradiated P8 cells. The overall results indicated that the cells accumulate TIFs as a function of age. Exposure to LDR also significantly increased the levels of TIFs in P19-ST and P19-IR cells (please see Table 1), which were exposed to LDR but not exposed to 1 Gy acute. Slightly increased levels of TIFs were observed in the 1 Gy irradiated P19-ST (p = 0.09) and P19-IR (p 0.05), as compared with irradiated P19-C cells. In summary, the results indicate that the levels of TIFs increased in the RS and PS as compared with their corresponding controls.

We also observed that the size of the nuclei was changed by the age of the cells. The data in Fig. 6D showed the average size of the nuclei in the cells. The results are presented as pixel areas of DNA stained by DAPI and indicate a significantly larger nucleus in the senescent cells than in the young P8 cells (p 0.001). However, no significant changes in the size of the nucleus were observed comparing premature senescent cells, P19-ST and P19-IR, with P19-C control cells.