Gene expression data was obtained from The Cancer Genome Atlas (TCGA) database (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga) that included 1104 tumor tissues and 113 normal breast tissues. Using the gene set enrichment analysis (GSEA) algorithm, pathways enriched between samples with low or high expression of ARHGAP6 were identified.

A total of 30 tumor and matched adjacent-normal tissue samples were collected from breast cancer patients at the Southern Medical University Affiliated Maternal & Child Health Hospital of Foshan. A signed informed consent was obtained from all patients. The medical ethics committee of Southern Medical University Affiliated Maternal & Child Health Hospital of Foshan (No. FSFY-MEC-2021-042) approved the present retrieval method of cancer tissue samples. To measure ARHGAP6 levels, a human breast cancer tissue microarray (Outdo Biotech Co., Ltd., Shanghai, China) containing 75 tumor tissues and 20 adjacent normal breast tissues were used.

Human breast cancer tissue microarray was analyzed using immunohistochemistry. Tissue slides were incubated with using anti-ARHGAP6 antibody (NBP2-49417, Novus Biologicals, LLC, Centennial, CO, USA). Using the H-score system, immunoreactivity was scored based on positively stained cells and staining intensity [22]. Breast cancer patients were classified into high-expression (H-score $\ge$4) and low-expression (H-score 4) groups.

Human breast cancer cell lines (BT-474, MCF-7, SKBR3, and ZR751) and a nontumorigenic human breast epithelial cell line (MCF-10A) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and were maintained in RPMI 1640 (11875119, Thermo Fisher Scientific, Waltham, MA, USA) media supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Life Technologies) in a humidified incubator with an atmosphere of 5% CO${}_2$/95% air at 37 °C. MCF-7 and ZR751 cells within the Luminal A subtype were estrogen receptor (ER) and progesterone receptor (PR) positive. BT-474 within the Luminal B subtype were ER negative, PR positive and human epidermal growth factor receptor type 2 (HER2) positive. SKBR3 cells within the HER2 overexpression subtype were ER and PR negative. All the cell lines were authenticated by short tandem repeat and were confirmed negative for mycoplasma contamination (Mycoalert Mycoplasma Detection Kit, Lonza, Switzerland).

RNA interference sequences targeting ARHGAP6 (siRNA#1 AGCAGAAGUCAUCAGACAAAG; siRNA#2 CAAUCAGUCUCGACUACUAGA; siRNA#3 CACCGAUCUUGAUGACAAUCA) and scramble siRNA sequence (GCCUGACCAUACACUCGCUCA) were synthesized and transfected into breast cells using Lipofectamine 2000 system according to the manufacturer’s protocol (11668500, Thermo Fisher Scientific, Waltham, MA, USA). Human ARHGAP6 coding cDNA sequence was synthesized by Sangon Biotech as well and inserted into the pLVX-Puro vector (QYV0008, Beijing qualityard biotechnology Co., Ltd., China). Transfection was performed using the Lipofectamine 2000 system. Subsequently, 48 h after transfection, recombinant vector in the cell supernatant was collected and transduced into breast cancer cells.

MCF-7 cells transduced with indicated vectors were treated with or without 25 µM apoptosis inhibitor zVAD-fmk, 20 µM necroptosis inhibitor necrostatin-1, 10 µM ferroptosis inhibitor ferrostatin-1, or 1 µg/mL RSL3 (all from Selleck, Shanghai, China). BT-474 cells transfected with siARHGAP6 or siNC were treated with or without SB203580 (10 µM; Selleck). The cells were stained according to the instructions of the BeyoClick™ EdU Cell Proliferation Kit (C0071S, Beyotime Biotechnology, Shanghai, China). Cells were then incubated with DAPI solution and were observed using fluorescence microscopy.

MCF-7 cells transduced with indicated vectors were treated with or without 1 µg/mL RSL3. BT-474 cells transfected with siARHGAP6 or siNC were treated with or without 10 µM SB203580. Cell death rate was determined using the lactate dehydrogenase (LDH) cytotoxicity assay kit (Beyotime Biotechnology, Shanghai, China) as per manufacturer’s instructions and calculated as previously described [23].

MCF-7 cells transduced with indicated vectors were treated with or without 1 µg/mL RSL3. BT-474 cells transfected with siARHGAP6 or siNC were treated with or without 10 µM SB203580. The level of lipid ROS was quantified using C11-BODIPY (581/591) assay (D3861, Thermo Fisher Scientific, Waltham, MA, USA). Briefly, the cell suspension was added with 10 µM C11-BODIPY (581/591) and incubated for 30 min at 37 °C in the dark. Fluorescence intensity was measured using an Accuri™ C6 flow cytometer (BD Biosciences, San Jose, CA, USA). To detect for Fe${}^{2+}$ ion content, the Iron Assay Kit (ab83366, Abcam, Waltham, MA, USA) was used as per manufacturer’s instructions.

Total RNA was extracted using TRIzol solution (Thermo Fisher Scientific). The first-strand cDNA was synthesized using the Hifair® II 1st Strand cDNA Synthesis SuperMix for qPCR (Yeasen Biotechnology (Shanghai) Co., Ltd., Shanghai, China) as per manufacturer’s instructions. Using the Hieff® qPCR SYBR Green Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd) on an ABI 7300 real-time PCR system (Applied Biosystems, Foster, CA, USA), quantitative RT-PCR was performed. The primers used included the following: ARHGAP6-F: 5${}^{\prime }$-TGAGGTCAGTCCCCATCC-3${}^{\prime }$; ARHGAP6-R: 5${}^{\prime }$-GCATCTTTCTGCTCGTCC-3${}^{\prime }$; GPX4-F: 5${}^{\prime }$-CTCCCAGTGAGGCAAGAC-3${}^{\prime }$; GPX4-R: 5${}^{\prime }$-GTTACTCCCTGGCTCCTG-3${}^{\prime }$; PTGS2-F: 5${}^{\prime }$-TTACAATGCTGACTATGGCTAC-3${}^{\prime }$; PTGS2-R: 5${}^{\prime }$-CTGATGCGTGAAGTGCTG-3${}^{\prime }$; CHAC1-F: 5${}^{\prime }$-ACGACGGCGACCCTCAAG-3${}^{\prime }$; CHAC1-R: 5${}^{\prime }$-GGGTTCTGCTCCCCTTGC-3${}^{\prime }$; ACSL4-F: 5${}^{\prime }$-AAAAAGGTCAAGGCCCTGCT-3${}^{\prime }$; ACSL4-R: 5${}^{\prime }$-CTGTCCCAGCACCACATGAT-3${}^{\prime }$; SLC7A11-F: 5${}^{\prime }$-CTAACTAACTGGTCCTCAACTC-3${}^{\prime }$; SLC7A11-R: 5${}^{\prime }$-CCTAAGAAACAACGCAATCC-3${}^{\prime }$; GAPDH-F: 5${}^{\prime }$-AATCCCATCACCATCTTC-3${}^{\prime }$; GAPDH-R: 5${}^{\prime }$-AGGCTGTTGTCATACTTC-3${}^{\prime }$. The relative expression level of target genes was normalized to that of GAPDH using the 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$ method.

Proteins were lysed from tumor tissues and cell lines using radioimmunoprecipitation assay buffer (50 mM Tris, pH 7.4, 150 Mm NaCl, 1% NP-40, 100 mM NaF) with protease and phosphatase inhibitor cocktail. Proteins were separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA). Then, the membranes were incubated with primary antibodies against ARHGAP6 (Invitrogen; PA5-104106), ROCK1 (ab97592, Abcam, Waltham, MA, USA), GPX4 (ab125066, Abcam), PTGS2 (ab179800, Abcam), CHAC1 (ab217808, Abcam), ACSL4 (ab155282, Abcam), SLC7A11 (ab175186, Abcam), GAPDH (5174, Cell Signaling Technology, Danvers, MA, USA), p-p38 (4511, Cell Signaling Technology), and p38 (9212, Cell Signaling Technology), followed by incubation with HRP-conjugated secondary antibodies (A0208, Beyotime Biotechnology).

MCF-7 cells were transduced with indicated vectors, and BT-474 cells transfected with siARHGAP6 or siNC were treated with or without Y-27632 (10 µM; Selleck), and the RhoA activity was measured using a Rho Activation Assay Biochem Kit (Cytoskeleton, Denver, CO, USA).

MCF-7 cells (5 $\times$ 10${}^6$) transduced with indicated vectors were subcutaneously injected into the flank regions of mice (4 to 5 weeks old; Shanghai Laboratory Animal Company, Shanghai, China). RSL3 (100 mg/kg) was injected twice a week. Tumor volume was recorded every three days. Thirty-three days after RSL3 injection, the mice were sacrificed, and tumors were collected (n = 6 per group). All animal experiments were performed according to the animal ethics guidelines of the Animal Care and Use Committee of Shanghai Rat@Mouse Biotech Co., Ltd., China [No. 202103(11)].

Tissues samples collected from the xenograft tumor were incubated using anti-Ki67 (ab245113, Abcam) and Alexa Fluor 488-labeled Goat anti-mouse IgG (H + L) (A0428, Beyotime Biotechnology) antibodies, followed by DAPI (C1002, Beyotime Biotechnology) labeling. Using a confocal laser scanning microscope (Leica Microsystems, Inc., Deerfield, IL, USA), the positively stained cells were then visualized.

Statistical analysis was performed using GraphPad Prism 8.4.2 (GraphPad Software, San Diego, CA, USA). All experiments were performed in triplicate, and quantitative data were expressed as mean $\pm$ standard deviation. The overall survival was determined using the Kaplan–Meier survival analysis and log-rank test. Comparisons between the different groups were compared using the analysis of variance test or Student’s t test. p value 0.05 was considered statistically significant.

TCGA dataset gene expression data screening showed that ARHGAP6 mRNA level was decreased in tumor samples compared with normal samples (Fig. 1A). Moreover, 30 clinical tumor samples were collected from hospitalized breast cancer patients. Quantitative RT-PCR showed that the mRNA level of ARHGAP6 was markedly decreased in tumor samples compared with adjacent-normal tissues (Fig. 1B). Immunohistological staining also demonstrated a low ARHGAP6 protein expression levels in tumor samples compared with adjacent-normal tissues from human breast cancer tissue arrays (Fig. 1C). The patients with high ARHGAP6 expression (H-score $\ge$4; n = 34) had significantly improved survival time compared with those patients with low ARHGAP6 expression (H-score 4; n = 41; Fig. 1D). ARHGAP6 expression was markedly reduced in human breast cancer cell lines (BT-474, MCF-7, SKBR3, and ZR751) compared with the nontumorigenic human breast epithelial cell line (MCF-10A), with the highest and lowest expression detected in BT-474 and MCF-7 cells, respectively (Fig. 1E,F). These two cell lines were therefore used for subsequent experiments.

Fig. 1.

Rho GTPase-activating protein 6 (ARHGAP6) expression is decreased in tumor tissues and cell lines. (A) ARHGAP6 expression in tumor tissues (T; n = 1104) and adjacent-normal tissues (N; n = 113) in the TCGA database. (B) ARHGAP6 mRNA levels in tumor tissue (T; n = 30) and corresponding adjacent-normal tissue (N; n = 30) in the hospitalized breast cancer patient cohort. (C) ARHGAP6 expression in tumor tissue arrays. (D) Survival of breast cancer patients. (E,F) ARHGAP6 expression in human breast cancer cell lines (BT-474, MCF-7, SKBR3, and ZR751) and nontumorigenic human breast epithelial cell line (MCF-10A) was determined (n = 3). GTPase, guanosine triphosphatase hydrolase enzyme. Scale bar: 100 µm. *p 0.05, **p 0.01, ***p 0.001 compared with N or MCF-10A.

To eamine the role of ARHGAP6 in breast cancer, MCF-7 cells with the lowest ARHGAP6 expression compared with other breast cancer cell lines were transduced with ARHGAP6 expression vector to overexpression ARHGAP6. Following the successful establishment of ARHGAP6 overexpression, ARHGAP6 mRNA and protein levels were significantly increased (Supplementary Fig. 1A–C). At 48 h post-transduction, cell proliferation was decreased, and cell death was increased in ARHGAP6-overexpressing MCF-7 cells (Fig. 2A–C). To determine the cause of ARHGAP6 overexpression-induced cell death, several cell death inhibitors were tested. Ferroptosis inhibitor ferrostatin-1 markedly inhibited ARHGAP6 overexpression-induced cell death; however, apoptosis inhibitor zVAD-fmk only mildly inhibited ARHGAP6 overexpression-induced cell death (Fig. 2A–C). To further examine the effects of ferroptosis on ARHGAP6 overexpression-mediated cell death, Fe${}^{2+}$ ion content and lipid ROS levels were measured. Fe${}^{2+}$ ion content (Fig. 2D) and lipid ROS levels (Fig. 2E) were dramatically increased in ARHGAP6-overexpressing MCF-7 cells.

Fig. 2.

ARHGAP6 overexpression promotes ferroptosis in MCF-7 cells. MCF-7 cells were infected with indicated lentiviral vectors and treated with 25 µM apoptosis inhibitor zVAD-fmk, 20 µM necroptosis inhibitor necrostatin-1, or 10 µM ferroptosis inhibitor ferrostatin-1, and the (A,B) cell proliferation and (C) cell death were determined (n = 3). MCF-7 cells were infected with indicated lentiviral vectors, and the (D) Fe${}^{2+}$ ion content, (E) lipid ROS, and the expression of (F) ARHGAP6, ROCK1, RhoA-GTP, total RhoA, and (H) p-p38 and p38 MAPK were determined (n = 3). (G) Pathway enrichment analysis using the GSEA algorithm revealed that p38 MAPK pathway was significantly enriched in patients with low ARHGAP6 expression. GSEA, gene set enrichment analysis. Scale bar: 50 µm. ***p 0.001 compared with the blank vector. ${}^{\mathrm{\#}}$p 0.05, ${}^{\mathrm{\#}\mathrm{\#}\mathrm{\#}}$p 0.001 compared with ARHGAP6 + Vehicle.

RhoA activates downstream Rho-related protein kinase 1 (ROCK1) and modulates the accumulation of ROS [24, 25]. To detect whether RhoA/ROCK1 signaling pathway was affected by ARHGAP6 overexpression in breast cancer cells, this study applied active small GTPase pull-down assays. As a result of ARHGAP6 overexpression, it showed that RhoA activity and ROCK1 protein levels were diminished (Fig. 2F).

Pathway enrichment analysis using the GSEA algorithm revealed that p38 MAPK pathway was significantly enriched in patients with low ARHGAP6 expression (Fig. 2G). In response to ARHGAP6 overexpression, p38 MAPK phosphorylation was dramatically reduced (Fig. 2H).

To further understand the regulatory role of ARHGAP6 in ferroptosis, BT-474 cells with the highest ARHGAP6 expression compared with other breast cancer were transfected with ARHGAP6 siRNA to knockdown ARHGAP6. BT-474 cells transfected with siARHGAP6 successfully eliminated ARHGAP6 mRNA and proteins (Supplementary Fig. 1D–F). Cell proliferation significantly increased, while the level of cell death, Fe${}^{2+}$ ion content, and lipid ROS was markedly reduced in the siARHGAP6-transfected cells compared with the siNC-transfected cells (Fig. 3A–D). However, these siARHGAP6-induced changes were reversed by the p38 MAPK inhibitor SB203580 co-treatment (Fig. 3A–D). ARHGAP6 silencing improved p38 MAPK phosphorylation and reduced the suppressive effect of SB203580 treatment (Fig. 3E). Moreover, the expression of GPX4 and SLC7A11 proteins was markedly increased, while the expression of PTGS2, ACSL4, and CHAC1 was markedly decreased in siARHGAP6-transfected BT-474 cells (Fig. 3F). SB203580 exposure further reversed the changes in protein levels of GPX4, SLC7A11, ACSL4, PTGS2, and CHAC1 that were induced by ARHGAP6 silencing (Fig. 3F).

Fig. 3.

ARHGAP6 silencing promotes cell proliferation and inhibits ferroptosis of BT-474 cells by activating the p38 MAPK signaling pathway. BT-474 cells were transfected with siARHGAP6 or siNC with or without p38 MAPK inhibitor SB203580 (10 µM) treatment, and the (A) cell proliferation, (B) cell death, (C) Fe${}^{2+}$ ion content, (D) lipid ROS, and expression of (E) p-p38, p38 MAPK, (F) GPX4, PTGS2, CHAC1, ACSL4, and SLC7A11 are determined (n = 3). Scale bar: 50 µm. **p 0.01, ***p 0.001 compared with siNC + Vehicle; ${}^{\mathrm{\#}}$p 0.05, ${}^{\mathrm{\#}\mathrm{\#}\mathrm{\#}}$p 0.001 compared with siARHGAP6 + Vehicle.

Furthermore, to determine whether RhoA/ROCK signaling mediated the effect of ARHGAP6 on p38 MAPK signaling, siARHGAP6-transfected cells were exposed to RhoA/ROCK inhibitor Y-27632. ARHGAP6 silencing evidently improved RhoA activity and the phosphorylation of p38 MAPK signaling, which were counteracted by exposure to RhoA/ROCK inhibitor Y-27632 (Supplementary Fig. 2A,B). This indicates that RhoA-ROCK1-p38 MAPK signaling mediates the effects of ARHGAP6 on ferroptosis in breast cancer.

To evaluate the effects of ARHGAP6 and RSL3 co-treatment on ferroptosis, ARHGAP6-overexpressing MCF-7 cells were stimulated by the ferroptosis-inducer RSL3. This demonstrated that in the MCF-7 cells transduced with pLVX-Puro-ARHGAP6, RSL3 stimulation further decreased cell proliferation (Fig. 4A), enhanced cell death (Fig. 4B), Fe${}^{2+}$ ion content (Fig. 4C), and lipid ROS accumulation (Fig. 4D), downregulated GPX4 and SLC7A11 expression, and upregulated PTGS2, ACSL4, and CHAC1 expression (Fig. 4E).

Fig. 4.

ARHGAP6 and RSL3 cooperatively inhibit cell proliferation and promote ferroptosis of MCF-7 cells. MCF-7 cells were infected with indicated lentiviral vectors and treated with ferroptosis inducer RSL3 (1 µg/mL), and the (A) cell proliferation, (B) cell death, (C) Fe${}^{2+}$ ion content, (D) lipid ROS, and (E) the expression of GPX4, PTGS2, CHAC1, ACSL4, and SLC7A11 were determined (n = 3). Scale bar: 50 µm. ***p 0.001 compared with Vector + Vehicle; ${}^{\mathrm{\#}\mathrm{\#}}$p 0.01, ${}^{\mathrm{\#}\mathrm{\#}\mathrm{\#}}$p 0.001 compared with ARHGAP6 + Vehicle.

To further evaluate the effects of ARHGAP6 overexpression and RSL3 on tumor growth in vivo, the mouse-xenograft models were established by subcutaneous injection of MCF-7 cells transduced with ARHGAP6 expression vector and treat with RSL3. Fig. 5A,B shows that the mice with ARHGAP6 overexpression or treated with RSL3 treatment had observably smaller tumor volumes and reduced tumor weights compared to vehicle-treated mice. The combination of two treatments further decreased the tumor volume and weight compared to either treatment alone. Tumor cell proliferation was measured using Ki67 immunofluorescence staining. Either ARHGAP6 overexpression or RSL3 treatment alone significantly suppressed tumor cell proliferation (Fig. 5C,D). Moreover, the combined treatments further suppressed tumor cell proliferation than the induced suppression of each treatment alone (Fig. 5C,D). Protein levels of GPX4, SLC7A11, ACSL4, PTGS2, and CHAC1 were detected in tumor tissue samples harvested from the mice models. A significant decrease in GPX4 and SLC7A11 protein and a significant increase in PTGS2, ACSL4, and CHAC1 expression were found in mice with ARHGAP6 overexpression or receiving RSL3 injection compared to vehicle mice (Fig. 5E,F). The combined treatments caused more significant changes in these ferroptosis biomarkers compared with each treatment alone (Fig. 5E,F). These observations revealed that ARHGAP6 and RSL3 co-treatment is a better therapeutic strategy for breast cancer than either treatment alone by promoting ferroptosis.

Fig. 5.

Cooperative effects of ARHGAP6 and RSL3 on tumor growth in vivo. Mice were injected with MCF-7 cells infected with indicated lentiviral vectors, followed by RSL3 (100 mg/kg) injection. The (A) tumor volume (n = 6), (B) tumor weight (n = 6), (C,D) Ki67 immunofluorescence staining (n = 6), and (E,F) the expression of GPX4, PTGS2, CHAC1, ACSL4, and SLC7A11 (n = 3) were measured. Scale bar: 100 µm. ***p 0.001 compared with Vector + Vehicle; ${}^{\mathrm{\#}\mathrm{\#}\mathrm{\#}}$p 0.001 compared with ARHGAP6 + Vehicle.

The correlations of GPX4, PTGS2, and CHAC1 with ARHGAP6 in breast cancer tissue and the corresponding adjacent-normal tissue were analyzed. GPX4 as well as SLC7A11 mRNA level was markedly increased, while the mRNA level of PTGS2, ACSL4, and CHAC1 was markedly decreased in cancer tissue compared with adjacent-normal tissue (Fig. 6A–E). This suggests the inhibition of ferroptosis in breast cancer. GPX4 and SLC7A11 mRNA levels were negatively correlated with the ARHGAP6 mRNA level (Fig. 6F,G). Conversely, PTGS2, ACSL4, and CHAC1 mRNA level was positively correlated with ARHGAP6 mRNA level (Fig. 6H–J). These results demonstrated that ARHGAP6 expression has a significant positive correlation with ferroptosis indicators in breast cancer. Additionally, ARHGAP6 is significantly associated with tumor stage (p = 0.034), ER status (p = 0.017), PR status (p = 0.020), and HER2 status (p = 0.011; Table 1).

Fig. 6.

Correlation analysis in tumor tissues. (A–E) Expression of GPX4, SLC7A11, PTGS2, CHAC1, and ACSL4 in breast cancer tissues (T; n = 30) and the corresponding adjacent-normal tissues (N; n = 30) in the hospitalized breast cancer patient cohort. (F–J) Pearson correlation scatter plots of tumor tissues (n = 30). ***p 0.001 compared with N.