1. Introduction
Rheumatoid arthritis (RA) is an autoimmune disease characterized by destruction
of synovial joints [1], abnormal immune responses [2] and inflammatory
manifestations [3]. In southern countries, RA should be properly controlled [4]
since its expected prevalence is ranged from 0.2 to 0.3%. Promotion of
microvessels formation in joints by inflammation may cause joint damage. With
regards to pathological mechanism of RA, rheumatoid factors [5] and several
inflammatory processes [6] have been implicated. Through fibroblast-like
synoviocytes (FLS), scientists have observed the promotion of
vascular-endothelial growth factor (VEGF) release by proinflammatory mediators
like monocyte chemo-attractant protein-1 (MCP-1), tumor necrosis factor-alpha
(TNF-), nitric-oxide, prostaglandins, interleukin (IL)-1, IL-6, IL-17
and IL-18 [7, 8]. Thus, main invasive proliferative cell involved in RA
pathogenesis is FLS, which plays a crucial role in inflammation of RA [9, 10].
During RA onset, FLS and macrophages release increased the levels of factors like
IL-6, IL-1, matrix metalloproteinase (MMP-1/3) and other inflammatory
mediators by migrating and invading bone and joint tissues, thus inducing
excessive intra-articular synovial tissue proliferation which further aggravated
intra-articular inflammatory response of RA patients [11].
The silent information regulator (SIRT) family is third type of human histone
deacetylase dependent on nicotinamide adenine dinucleotide (NAD+) [12] with seven
members [13]. SIRT6 is expressed as ADP ribosyltransferase in nucleus [14].
Relevant works have found that SIRT6 associates with the regulation of body
modifications for environmental adaptation. Particularly, SIRT6 regulates genome
stability, DNA repair and inflammatory response through deacetylation of histones
and various transcription factors, especially in immune inflammation [15, 16, 17].
SIRT6 knockout in endothelial cells of human umbilical vein could lead to
increased levels of IL-1, IL-6, IL-8, MMP-2 and -9. Contrarily,
overexpressed SIRT6 inhibited expression of these factors [18]. Thus, SIRT6
expression inhibition especially in macrophages could aggravate inflammation [19, 20]. Contrastingly, ectopically overexpressed SIRT6 in knockout cells decreased
inflammation. The SIRT6 plays a crucial role in inflammation suppression by
inhibiting nuclear-factor kappa-B (NF-B) pathway activation via removal
of histone-3 lysine-9 (H3K9) acetylation levels of downstream target genes of
NF-B [21]. Thus, SIRT6 has an anti-inflammatory function, which can
inhibit inflammatory responses and progress of RA [22]. Available literature has
described the potential of SIRT6 to control a smoke induced signaling in synovial
fibroblasts of RA [23]. Likewise, another study affirmed that SIRT6 could
decrease inflammation and release of proinflammatory factors in collagen induced
RA mouse model [24]. Besides, a lower SIRT6 expression in PBMC and
monocytes/macrophages of RA patients was observed compared to osteoarthritic
patients. Thus, SIRT6 may be explored as a treatment target of RA. Nevertheless,
actual mechanism of SIRT6 in RA treatment has not been clarified. Bioinformatics
prediction has shown multiple sites binding of SIRT6 promoter to transcription
factors, including Ahr, SPIB, Pdx1, and Prrx2.
Chronic immune inflammatory diseases such as RA [25] have devastating effect on
the well-being of patients. As proteins that are associated with immune system,
toll-like receptors (TLRs) widely exist in various innate immune cells, namely
neutrophils, monocyte macrophages, dendritic cells and natural killer (NK) cells
[26, 27]. They (except TLR3) activate myeloid differentiation factor-88 (MyD88),
which is most important adaptor protein in TLRs signal transduction pathway [28].
Literature has confirmed that defective MyD88 gene in TLR signal
transduction pathway resulted in substantially reduced joint synovitis and bone
tissue damage [29]. An extracellular signal-regulated kinase (ERK) pathway is a
vital MAPKs family member. A close linkage of abnormal activation of ERK with
pathological process of RA joint destruction has been observed. The ERK is
significantly activated in T lymphocytes, FLS and macrophages in RA synovium,
thus suggesting its involvement in transduction of pathological signals [30]. It
has been shown that ERK and its inhibitors could alleviate RA symptoms and even
block disease progress [31].
Herein, we found that MyD88-ERK is an important signal pathway that promotes
inflammation in RA pathogenesis. Increased expressions of MyD88-ERK and
IL-1, IL-21, IL-22, IL-6, IL-17, tumor necrosis factor-alpha
(TNF-) and monocyte chemo-attractant protein-1 (MCP-1) and concomitant
decreased expression of Sirt6 were observed in RA patients. Sirt6 treatment
inhibited MyD88-ERK signal pathway which decrease inflammatory response via
reduced expression and levels of the above-mentioned inflammatory mediators
(especially IL-1, IL-6 and TNF-) in RA patients, thus improving
treatment of RA. Hence, this study sought to clarify SIRT6 role in RA
inflammatory response, and explore its molecular mechanism in reducing RA
inflammatory injury through inhibition of MyD88-ERK signaling pathway in RA
patient serum, rat synovial cell RA model and rat arthritic model as well as
appropriate techniques.
2. Methods
2.1 Materials
Fetal bovine serum (FBS) and RPMI 1640 culture medium were bought from Hyclone
(Logan, UT, USA), while TRIzol reagent was obtained from Invitrogen (Carlsbad,
CA, USA). The BCA kit was bought by Nanjing Jiancheng Bioengineering Research
Institute (Nanjing, China). Sigma Co., (St. Louis, MO, USA) supplied Freund’s
complete adjuvant, Bovine type II collagen (BIIC) and RIPA lysate. Mitogen
extracellular kinase (MEK), phosphorylated mitogen extracellular kinase (p-MEK),
ERK, phosphorylated extracellular signal-regulated protein kinase (p-ERK), SIRT6
and MyD88 antibody were provided by Abcam corporation (Cambridge, MA, USA).
Lentivirus expression vector was bought from Thermo Fisher Scientific (Waltham,
MA, USA). Recombinant rat IL-1 was purchased from peprotech (Rocky, NJ,
USA). The IL-1, IL-6, IL-17, IL-21, IL-22, MCP-1, lactate dehydrogenase
(LDH), glutathione (GSH), superoxide dismutase (SOD) malondialdehyde (MDA) and
TNF- enzyme linked immunoassay (ELISA) kits were bought from Abcam
(Cambridge, MA, USA).
2.2 Study Population Recruitment
Between January 2020 and October 2021, we recruited 22 RA patients (10 females
and 12 males of 25–65 years) and 22 healthy controls (HC, 22 females and 10
males of 24–63 years) from Jiangsu University affiliated Wujin Hospital. Those
with American College of Rheumatology European League against Rheumatism
(ACR_EULAR) classified RA [32] were used for this study, wherein they did not
receive any treatment. All the subjects that were included in this study did not
have autoimmune diseases, blood system, cardiovascular and cerebrovascular system
and other systemic diseases.
2.3 Cells and Animals
Rat FLS cell line 364 (RSC-364) was obtained from the Wujin Hospital Affiliated
with Jiangsu University and cultured in RPMI-1640 complete medium at 37
°C and 5% CO humidification. Mycoplasma contamination of the cell
line was detected by phase contrast microscopy. The cells were inoculated on a
cover slide placed in the culture bottle, and removed 24 hours later, before we
observed with phase contrast microscope. Mycoplasma is a dark microscopic
particle located on the cell surface and between the cells. The results showed
that no dark microscopic particles were observed, thus indicating that the
mycoplasma contamination test of the cell line was negative. In addition,
immunofluorescence staining was used to identify the cell lines. The cells were
inoculated on a 24-well plate with a cover slide. After the cell growth
confluence was about 60%, the cells were washed twice with PBS (pH 7.4). Later,
we fixed them with 4% paraformaldehyde at room temperature for 15 min, and
rinsed 3 times with PBS for 5 min each time. Afterwards, 5% goat serum sealing
solution (containing 0.3% Triton X-100) was used for sealing at room temperature
for 60 min. Vimentin antibody (1:200) and Fibronectin (1:200) were added
overnight at 4 °C and rinsed 3 times with PBS for 5 min each time. Alexa Flour 647
(1:500) was incubated at room temperature away from light for 1 h and rinsed 3
times with PBS for 5 min each time. The tablets were sealed with DAPI, while
fluorescence staining was observed via fluorescence microscope. The expression of
Vimentin and fibronectin was observed to be positive after immunofluorescence
identification, which could be used for subsequent experiments.
Sprague-Dawley (SD) rats (female, 6–7 weeks, 200 20 g) were supplied by
Jiangsu University laboratory center (Zhenjiang, China). The rats were exposed to
24 1 °C temperature and 50 10% humidity for a light-dark cycle of
12 h. Food and water were available AD libitum. All procedures were conducted
under protocols approved by the Institutional Animal Care and Use Committee of
Jiangsu University. A total of 30 healthy mice were selected for this experiment.
They were randomly divided into 5 groups with 6 animals in each group.
2.5 Study on Serum of clinical RA Patients
2.5.1 Serum Samples Collection
In the morning after overnight fasting, we withdrew whole venous blood
(7~8 mL) from 22 RA patients and 22 healthy volunteers (as normal
control). Then, the blood samples were anti-coagulated with heparin, and
centrifuged at 3700 rpm for 10 min. After that, serum was collected into a 2 mL
EP tube and stored in a refrigerator at –80 °C for subsequent use.
2.5.2 Detection of Related Protein Expression by Western Blot
The protein of the sample to be tested was extracted by protein extraction
lysate. The protein concentration was determined via BCA protein quantitative
kit. Later on, 50 µg protein solution was transferred to the PVDF membrane
after 12% SDS- polyacrylamide gel electrophoresis. The membrane was sealed with
5% skimmed milk at room temperature for 1.5 h. The corresponding primary
antibody was added and incubated at 4 °C overnight. The PVDF membrane was taken
out and washed with PBS solution (3 times) for 5 min each time. Fluorescent
labeled secondary antibodies were added to the PVDF membrane and incubated at
room temperature for 2 h. Then, ECL solution (Thermo Fisher Scientific, Waltham,
MA, USA) was added for full reaction to take place. Excess liquid was removed
with filter paper and the samples were covered with the film. The gray value of
the protein strip was analyzed with the gel image processing system. The relative
expression of protein was expressed by the ratio of gray value of target protein
to internal reference protein (GAPDH).
2.6 In Vitro Cell Experiments
2.6.1 Cells Culture
RSC-364 cells were selected to establish rat RA cell model in vitro.
The cells were cultured in RPMI 1640 medium (containing 10% FBS) under
humidified CO (5%) and 37 °C. Then, the cells were digested with 0.25%
trypsin (containing 0.02% EDTA) and press 5 10/L was inoculated
in a 25 cm culture flask. The culture medium was discarded when the cells
were fused to 90% and in the logarithmic growth phase. The cells were
resuspended with RPMI 1640 medium, in which the cells (1 10)
were inoculated in 96 well plates with a medium volume of 200 µL (in
each well). Later, 96 well plates were cultured at 37 °C, CO (5%) incubator
and saturated humidity for 24 h.
2.6.2 Adenovirus Construction
SIRT6 adenovirus construction method was as follows: after the whole coding
sequence (CDS) of rat SIRT6 gene was synthesized, the multiple cloning
sites (MCS) of pAdeasy-EF1-MCS-CMV-mcherry were constructed and packaged as
adenovirus. The vector map is shown in Fig. 1A, in which the SIRT6 promoter was
EF1a, and the virus had red fluorescence.
Fig. 1.
Adenovirus map. (A) Silent information regulator 6 (SIRT6)
adenovirus map. (B) Myeloid differentiation factor-88 (MyD88) adenovirus map.
MyD88 adenovirus construction method was similar as the SIRT6, after which the
whole CDS of rat MyD88 gene was synthesized, while the multiple cloning
sites (MCS) of pAdeasy-EF1-MCS-CMV-EGFP were constructed and packaged as
adenovirus. The vector map is shown in Fig. 1B, wherein the MyD88 promoter was
EF1a, and the virus had green fluorescence.
2.6.3 Construction of RA Cell Model
Later, the cells were divided into 7 groups: ① Control group: Normal
RSC-364 cells without any treatment. ② Adenovirus loaded SIRT6 control
group (Ad-SIRT6-Control): In this batch, RSC-364 cells were treated with SIRT6
adenovirus to construct FLS cells with high SIRT6 expression. ③ Empty
adenovirus control group (Ad-Control). The RSC-364 cells were treated with empty
adenovirus. ④ Experimental group (Model): The normal RSC-364 cells were
treated with recombinant rat IL-1 (10 ng/mL). ⑤ Adenovirus
loaded SIRT6 experimental group (Ad-SIRT6-Model) was treated with SIRT6
adenovirus to construct RSC-364 cells with high SIRT6 expression, and then
recombinant rat IL-1 was used (10 ng/mL) for treatment. ⑥ Empty
adenovirus experimental group (Ad-Model): The RSC-364 cells were treated with
empty adenovirus, and then treated with recombinant rat IL-1 (10 ng/mL).
⑦ Adenovirus loaded SIRT6 experimental group treated with MyD88
adenovirus (Ad-SIRT6-Model-MyD88): The RSC-364 cells with high SIRT6 expression
were constructed by SIRT6 adenovirus treatment, before treatment with recombinant
rat IL-1 (10 ng/mL), and subsequent treatment with MyD88 adenovirus.
2.6.4 Elisa Detection
The inflammatory factors (IL-1, IL-6, IL-17, IL-21, IL-22, MCP-1, SOD,
LDH, MDA and TNF-) expression levels were detected in accordance with
ELISA kit instructions. The absorbance of each well was measured at 450/550 nm
wavelength using an enzyme labeling instrument, and the content of each factor
was determined according to the standard curve.
2.6.5 Real-Time PCR
Real time polymerase chain reaction (RT-PCR) method was used to determine the
RSC-364 cells expression of messenger ribonucleic acid (mRNA) from genes
including SIRT6, MyD88, IL-6, TNF-,
IL-1, IL-17, IL-21, IL-22 and
MCP-1. Total RNA was extracted from sampled cells with Trizol reagent.
The selected primer sequences used in this study are shown in Table 1. The
amplification conditions were as follows: Pre-denaturation at 95 °C for
2 min, annealing at 94 °C for 20 s and 68 °C for 20 s for 40
cycles. The experimental results are expressed according to the relative
quantitative analysis of 2 equation.
Table 1.The sequences of the primers employed in the RT-PCR.
| Genes |
|
Sequences of primer (5′ to 3′) |
| SIRT6 |
Forward |
CTTTATTGTTCCCGTGCGGC |
| Reverse |
ACCTTGCATTCCAGCTCCTC |
| MyD88 |
Forward |
CTACAGAGCAAGGAATGTGACT |
| Reverse |
ACCTGATGCCATTTGCTGTCC |
| IL-6 |
Forward |
AGAGACTTCCAGCCAGTTGC |
| Reverse |
AGTCTCCTCTCCGGACTTGT |
| TNF- |
Forward |
GGCTTTCGGAACTCACTGGA |
| Reverse |
GGGAACAGTCTGGGAAGCTC |
| IL-1 |
Forward |
TTGAGTCTGCACAGTTCCCC |
| Reverse |
TCCTGGGGAAGGCATTAGGA |
| IL-17 |
Forward |
GTTCAGTGTGTCCAAACGCC |
| Reverse |
AGGGTGAAGTGGAACGGTTG |
| IL-21 |
Forward |
CTAAAGCGGGAAGGACGTGT |
| Reverse |
CTGGAGGTGAGCGCTACAAA |
| IL-22 |
Forward |
TCAGCGGTGATGACCAGAAC |
| Reverse |
TCAGACGCAAGCGTTTCTCA |
| MCP-1 |
Forward |
AGCCAACTCTCACTGAAGCC |
| Reverse |
AACTGTGAACAACAGGCCCA |
RT-PCR, real time polymerase chain reaction.
2.6.6 Western Blot
The protein expressions of SIRT6, MyD88, p-ERK, ERK and GAPDH were detected with
Western blot. Supernatant of cells culture medium of each group was collected,
and the cells were scraped off with a cell scraper after PBS cleaning.
Centrifugation at 1000 rpm for 5 min was carried out, while cell precipitation
was washed with PBS. Then, the cells were transferred to clean EP tubes. Later,
0.25 mL of RIPA lysate were added to each tube of the cells. The cells were
vortexed for 30 s until the protein precipitated, before allowing them to stand
on the ice for half an hour. Centrifugation of 14,000 rpm was carried out at 4 °C
for 15 min and the sediment was discarded. Later on, we collected the supernatant
and whole cell protein extract prior to storing at –20 °C for subsequent
experiments. After that, the protein content was determined through BCA method
with the specific operation method of Western blot being the same as “2.5.2
Detection of related protein expression by Western Blot”.
2.7 In Vivo Rats’ Experiments
2.7.1 Establishment of RA Rat’s Model
According to previous studies [33, 34], BIIC (10 mg) and complete Freund’s
adjuvant (5 mL) were mixed into emulsifier. Then, 0.1 mL mixed emulsifier (100 mg
collagen/rat) was injected into rat tail vein for 21 days to construct the RA
rats model.
2.7.2 Animal Grouping and Administration
Healthy SD rats were randomly divided into 5 groups: ① Blank control
group (Control) without any treatment. ② Model group (Model): The RA rat
model was established by the above modeling method. ③ Adenovirus loaded
SIRT6 + model group (Ad-SIRT6-Model): The rats with high SIRT6 expression were
treated with SIRT6 adenovirus, before treatment with the above modeling method.
④ Blank adenovirus + model group (Ad-Model): After treating the rats
with empty adenovirus, we also treated them with the above modeling method.
⑤ Rats in the adenovirus loaded SIRT6 experimental group
(Ad-SIRT6-Model-MyD88) treated with MyD88 adenovirus, after which we treated them
with SIRT6 adenovirus, followed by treatment with the above modeling method and
MyD88 adenovirus.
2.7.3 Ultrasonic Examination
Two-dimensional ultrasound was used to observe the synovial hyperplasia of rat
limb joints. The blood flow in proliferative synovium was observed via the superb
microvascular imaging (SMI) technique. The grade of synovial hyperplasia and
blood flow were evaluated using ultrasonic grade 4 semi quantitative scoring
method, and the disease activity of limb arthritis was evaluated at the imaging
level. The specific inspection steps are as follows: Toshiba aplio500 ultrasonic
diagnostic instrument and linear array probe (dynamic range 60 dB, frequency
7–18 mhz) were used. The joints of rats’ limbs were examined horizontally and
longitudinally. The synovial hyperplasia was observed by two-dimensional
ultrasound and evaluated with semi quantitative scoring method. The section with
thick synovium at the focus was taken to fix the probe position. Later, the SMI
mode was started, before we adjusted the appropriate color gain and blood flow
sampling frame. The blood flow of synovium was observed under SMI mode and could
be evaluated through semi quantitative scoring method.
2.7.4 Sample Collection
After the experiment, blood (0.4 mL) samples were collected via retro-orbital
route into EP tubes containing heparin. Then, the rats were sacrificed before the
synovium, liver and kidney were collected, wherein blood on the tissue surface
was washed with PBS. Briefly, blood samples were centrifuged at 3700 rpm for 10
min. Then, serum was collected at –80 °C for standby. A part of rats’ liver and
kidney were homogenated and centrifuged at 10,000 rpm for 10 min. After that, the
supernatant was taken and stored in the refrigerator at –80 °C. Synovium, extra
part of the rats’ liver and kidney were fixed in 10% para-formaldehyde solution
for 4 h, before embedment in paraffin and sliced (about 4 µm) for
subsequent experiments.
2.7.5 Histopathological Examination
Paraffin sections of synovium, liver and kidney tissues were routinely dewaxed,
hydrated and stained with hematoxylin eosin (HE). Finally, the pathological
changes in the prepared samples were observed under the microscope (Nikon, Tokyo,
Japan).
2.7.6 Molecular Biological Detection
The levels of IL-6, IL-17, IL-21, IL-22, MCP-1, TNF-, GSH,
IL-1 and MDA as well as SOD in serum of the rats were detected strictly
according to the standard operating procedures of the ELISA kits.
2.7.7 Real-Time PCR
SIRT6, MyD88, IL-1, IL-6, IL-17, IL-21, IL-22, MCP-1 and TNF-
mRNA expressions were detected with Real-time PCR. Specific operation method of
Real-time PCR was the same as described in section “2.6.5 Real-time PCR”.
2.7.8 Western Blot
The protein expressions of SIRT6, MyD88, p-ERK, ERK, MEK and p-MEK were detected
with Western blot. The specific operation method of Western blot was the same as
depicted in section “2.5.2 Detection of related protein expression by Western
Blot”.
2.8 Statistical Analysis
Data were presented in the form of mean standard deviation (SD). We
performed student’s t-test or analysis of variance (ANOVA) to determine
the significant difference between two groups. Analysis of experimental results
was accomplished with GraphPad prism (version 8, GraphPad Software Inc., San
Diego, CA, USA). Statistically, we accepted p ˂ 0.05 as significant
differences between groups.
3. Results
3.1 Analysis of SIRT6 Gene Expression in RA Patients
We analyzed the sera of RA patients to ascertain their level of SIRT6
expression. Of note, red color indicates reduced gene expression (Z score), while
green color shows increased gene expression with color depth suggesting
difference in distinct expression levels. We observed from the analysis that
SIRT6 gene expression decreased significantly in RA patients (Fig. 2),
which may be due to the increased expressions of inflammatory factors such as
IL-1, IL-6, TNF- and MCP-1 or high expression of LncRNA
plasmacytoma variant translocation 1 (PVT1), which lowers Sirt6 expression via
methylation of the deacetylase protein in RA fibroblast-like synoviocytes
(RA-FLS) and synovial tissues of RA patients [35, 36].
Fig. 2.
Analysis of 36 gene expressions in rheumatoid arthritis (RA)
patients (relative to healthy subjects).
3.2 Detection of SIRT6 and MyD88-ERK Protein Expression in RA
Patients’ Sera
Expression of MyD88, ERK and p-ERK proteins in RA patients was investigated with
western blot technique. It was discovered that the aforementioned proteins
increased significantly (Mean SD for each protein in RA group: MyD88:
0.96 0.37; ERK: 1.18 0.18; p-ERK: 1.24 0.08, p
0.05 or p 0.01) compared to normal group (Mean SD for
each protein in normal control group: MyD88: 0.06 0.02; ERK: 0.43
0.01; p-ERK: 0.53 0.19) (Fig. 3). In comparison with normal group, level
of SIRT6 protein expression in RA patients decreased substantially (Mean
SD for SIRT6 protein in RA group: 1.10 0.03; in normal control group:
1.60 0.12, p 0.01), which may be ascribed to increased
expression of MyD88, ERK and p-ERK proteins in RA patients. Collectively, we
observed increased of MyD88, ERK and p-ERK proteins expressions with concomitant
decreased Sirt6 protein expression in RA patients.
Fig. 3.
Expressional levels of SIRT6, MyD88, extracellular
signal-regulated kinase (ERK) and phosphorylated extracellular signal-regulated
protein kinase (p-ERK) protein of normal control and RA patient groups. (A)
Western blot analysis of SIRT6, MyD88, ERK and p-ERK levels. Gray value of target
protein to internal reference protein (GAPDH) was used as a loading control.
Quantitative densitometry of SIRT6 (B), MyD88 (C), ERK (D) and p-ERK (E) levels
relative to GAPDH. p 0.05, p 0.01,
compared to Model control group. Experimental results are expressed as mean
SD, n = 3. SD, standard deviation.
3.3 Effect of SIRT6 on Inflammatory Markers and MyD88-ERK Pathway in
RA-RSC Cells in Vitro
ELISA testing was employed to measure levels of IL-1, SOD,
IL-21, LDH, IL-6, MDA,
IL-22, TNF-, IL-17 and MCP-1 in
RA-FLS cells. It was observed that Model group cells increased significantly with
decreased SOD (Mean SD for each inflammatory markers in model group:
IL-1: 417.16 25.63; SOD: 19.83 1.41; IL-21: 17.05
1.27; LDH: 33.05 2.15; IL-6: 107.1 5.68; MDA: 9.80
0.62; IL-22: 41.24 2.93; TNF-: 762.9 58.32;
IL-17: 81.07 6.40; MCP-1: 2.41 0.17; p 0.01)
compared with control group (Mean SD for each inflammatory markers in
control group: IL-1: 71.22 2.57; SOD: 44.96 3.01; IL-21:
5.07 0.37; LDH: 8.08 0.51; IL-6: 18.33 0.97; MDA: 1.17
0.08; IL-22: 11.78 0.77; TNF-: 381.6 25.5;
IL-17: 15.84 1.04; MCP-1: 0.79 0.05; p 0.01) (Fig. 4). Adenovirus SIRT6 and blank adenovirus vectors exhibited no effect on normal
FLS cells because Ad-SIRT6-Control and Ad-Control were unchanged or changed
slightly. Compared with Model cells, levels of aforesaid inflammatory mediators
and SOD in Ad-Model batch were unchanged, which suggests that blank adenovirus
vector demonstrated no effect on inflammation. Compared with group Model, the
contents of IL-1, IL-21, IL-22, IL-6, IL-17, LDH, MDA, TNF-,
MCP-1 and SOD in group Ad-Model were basically unchanged, which indicates that
the blank adenovirus vector had no effect on inflammation. In comparison with
group Model, the levels of IL-1, IL-21, IL-22, IL-6, IL-17, LDH, MDA,
TNF- and MCP-1 in group Ad-SIRT6-Model decreased significantly (Mean
SD for each inflammatory markers in Ad-SIRT6-Model group: IL-1:
171.14 8.46; IL-21: 7.14 0.46; LDH: 15.25 1.04; IL-6:
25.8 3.34; MDA: 2.84 0.21; IL-22: 20.16 1.36;
TNF-: 478.75 34.21; IL-17: 30.77 2.03; MCP-1: 1.18
0.07; p 0.01), while the level of SOD in group
Ad-SIRT6-Model increased significantly (Mean SD of SOD in Ad-SIRT6-Model
group: 31.05 1.98; p 0.01). In addition, compared with group
Model, the levels of IL-1, IL-21, IL-22, IL-6, IL-17, LDH, MDA,
TNF- and MCP-1 in group Ad-SIRT6-Model-MyD88 decreased significantly
(Mean SD for each inflammatory markers in Ad-SIRT6-Model-MyD88 group:
IL-1: 365.21 44.77; IL-21: 15.11 1.49; LDH: 29.82
2.01; IL-6: 98.99 4.36; MDA: 8.55 1.44; IL-22: 36.65
4.64; TNF-: 640.95 73.43; IL-17: 72.12 8.75;
MCP-1: 2.03 0.47; p 0.05 or p 0.01), while the
level of SOD increased significantly (Mean SD of SOD in
Ad-SIRT6-Model-MyD88 group: 25.03 3.60, p 0.05). The results
suggest that the RA cells treated with SIRT6 adenovirus could significantly
inhibit inflammation. On this basis, SIRT6 could regulate the activities of
IL-1, IL-21, IL-22, IL-6, IL-17, LDH, MDA, TNF-, MCP-1 and SOD
induced by MyD88 to a certain extent.
Fig. 4.
ELISA results of RSC-364 cells after different treatments. (A)
IL-1. (B) Superoxide dismutase (SOD). (C) IL-21. (D) Lactate
dehydrogenase (LDH). (E) IL-6. (F) Malondialdehyde (MDA). (G) IL-22. (H)
TNF-. (I) IL-17. (J) Monocyte chemo-attractant protein-1 (MCP-1).
Experimental results were expressed as mean SD, n = 6. p
0.05, p 0.01 compared to control group;
p 0.05, p 0.01 compared to Model group.
①: Control group; ②: Ad-SIRT6-Control; ③: Ad-Control;
④: Model group; ⑤: Ad-SIRT6-Model; ⑥: Ad-Model;
⑦: Ad-SIRT6-Model-MyD88.
3.4 Detection of SIRT6 Expression at mRNA Level
The RT-PCR technique was explored to detect the expression of SIRT6 at mRNA
level. It can be discovered (Fig. 5) that compared with control group, while the
Ad-SIRT6-Control showed increased relative SIRT6 expression at mRNA (Mean
SD for SIRT6 in Ad-SIRT6-Control group: 3.10 0.34; control group: 1.00
0.18, model group: 0.89 0.10, p 0.01), but
demonstrated relatively decreased expression of nuclear protein in Model batch
(Mean SD for SIRT6 in model group: 0.89 0.10, p
0.05). In a similar fashion, comparative analysis of the Model with
Ad-SIRT6-Model and Ad-SIRT6-Model-MyD88 groups demonstrated increased (Mean
SD for SIRT6 in Ad-SIRT6-Model group: 2.62 0.34;
Ad-SIRT6-Model-MyD88 group: 2.47 0.44, p 0.01) relative
expression of SIRT6 mRNA in the latter than former. This implies that
SIRT6 gene loaded by adenovirus vectors in Ad-SIRT6-Control,
Ad-SIRT6-Model and Ad-SIRT6-Model-MyD88 groups can be carried into cells with
high expression. In model group, we observed disturbed and decreased relative
expression of SIRT6 mRNA in normal FLS cells that were treated with recombinant
rat IL-1 (10 ng/mL). In addition, compared with control group, the
relative expression of IL-1, IL-21, IL-22, IL-6, IL-17, TNF-
and MCP-1 mRNA in model group increased significantly (p 0.01) with
that of Ad-SIRT6-Control and Ad-Control groups remaining basically unchanged.
Also, compared with Model batch, the relative expression of IL-1, IL-21,
IL-22, IL-6, IL-17, TNF- and MCP-1 mRNA in Ad-SIRT6-Model and
Ad-SIRT6-Model-MyD88 groups decreased significantly (p 0.01 and
p 0.05, respectively), while the relative expressions of above genes
(at mRNA level) in Ad-Model group remained basically unchanged. The results
showed that the expression of IL-1, IL-21, IL-22, IL-6, IL-17,
TNF- and MCP-1 mRNA in normal FLS cells that were treated with
recombinant rat IL-1 (10 ng/mL) increased significantly, but their
expressions could be reduced substantially after treatment with SIRT6
gene. Of note, the expression of IL-1, IL-21, IL-22, IL-6, IL-17,
TNF- and MCP-1 mRNA was markedly reduced after administration of MyD88
adenovirus (p 0.05), which verified that MyD88 could regulate
inflammation related process of RA. Meanwhile, compared with Control, the
relative expression of MyD88 mRNA in Model group increased significantly
(p 0.01), while the relative expression of MyD88 mRNA in
Ad-SIRT6-Control and Ad-Control groups remained basically unchanged. In
comparison with Model group, the relative expression of MyD88 mRNA in
Ad-SIRT6-Model and Ad-SIRT6-Model-MyD88 groups decreased significantly (p
0.01 and p 0.05, respectively) decreased, but the relative
expression of the same gene in Ad-Model group did not basically change. The
results showed that the expression of MyD88 mRNA in normal recombinant rat
IL-1 (10 ng/mL) treated FLS cells increased significantly, wherein the
expression of the same gene was decreased substantially after treatment with
SIRT6 gene. This finding affirms that the importance of MyD88 pathway as
target for SIRT6 gene in RA regulation.
Fig. 5.
Relative expression of related mRNA in RSC-364 cells after
different treatments. RT-PCR analysis of relative expression of (A) SIRT6, (B)
MyD88, (C) IL-6, (D) TNF-, (E) IL-1, (F) IL-17, (G) IL-21, (H)
IL-22, (I) MCP-1. In all experiments, GAPDH was used as an internal control.
Experimental results were expressed as mean SD, n = 6. p
0.05, p 0.01 compared to control group;
p 0.05, p 0.01 compared to Model group.
①: Control group; ②: Ad-SIRT6-Control; ③: Ad-Control;
④: Model group; ⑤: Ad-SIRT6-Model; ⑥: Ad-Model;
⑦: Ad-SIRT6-Model-MyD88.
3.5 Detection of SIRT6 Protein Expression Levels
The expression of SIRT6 at protein level was measured with western blot
technique. In comparison with control, relative expression of SIRT6 protein in
Ad-SIRT6-Control group increased substantially (Mean SD of SIRT6 protein
expression in control group: 0.42 0.02; in Ad-SIRT6-Control group: 0.90
0.01; p 0.01), whilst those expressions in Ad-Control, Model
and Ad-Model groups (Fig. 6) remained relatively unchanged (Mean SD of
SIRT6 protein expression in Ad-Control group: 0.48 0.01; in Model group:
0.46 0.02; in Ad-Model group: 0.42 0.01). Also, we observed
similar expression of SIRT6 protein in Ad-SIRT6-Control, Ad-SIRT6-Model and
Ad-SIRT6-Model-MyD88 groups (Mean SD of SIRT6 protein expression in
Ad-SIRT6-Control: 0.90 0.01; in Ad-SIRT6-Model: 1.01 0.02; in
Ad-SIRT6-Model-MyD88: 0.83 0.02). Inferably, SIRT6 gene that was
loaded with adenovirus vectors in Ad-SIRT6-Control, Ad-SIRT6-Model and
Ad-SIRT6-Model-MyD88 could be introduced into cells with high protein expression.
Compared with Control group, the relative expression of MyD88, ERK and p-ERK
proteins in Model group increased significantly (Mean SD of MyD88 protein
expression in control group: 0.41 0.01; in model group: 0.73
0.03; Mean SD of ERK protein expression in control group: 0.63
0.02; in model group: 1.07 0.06; Mean SD of p-ERK protein
expression in control group: 0.45 0.02; in model group: 0.90
0.04; p 0.01), while the relative expression of the same proteins in
Ad-SIRT6-Control and Ad-Control groups remained basically unchanged. In
comparison to Model group, the relative MyD88, ERK and p-ERK protein expressions
decreased significantly in Ad-SIRT6-Model (Mean SD of MyD88 protein
expression in Ad-SIRT6-Model group: 0.54 0.01; Mean SD of ERK
protein expression in Ad-SIRT6-Model group: 0.70 0.03; Mean SD of
p-ERK protein expression in Ad-SIRT6-Model group: 0.63 0.02; p
0.01) and Ad-SIRT6-Model-MyD88 groups (Mean SD of MyD88 protein
expression in Ad-SIRT6-Model-MyD88 group: 0.68 0.05; Mean SD of
ERK protein expression in Ad-SIRT6-Model-MyD88 group: 0.95 0.06; Mean
SD of p-ERK protein expression in Ad-SIRT6-Model-MyD88 group: 0.75
0.01; p 0.05), but remained basically unchanged in
Ad-SIRT6-Model group. These results demonstrate a significantly increased
expression of MyD88, ERK and p-ERK protein in normal FLS cells that were treated
with recombinant rat IL-1 (10 ng/mL), which was reduced markedly after
treatment with SIRT6 gene. On this account, expression of MyD88, ERK and
p-ERK protein increased significantly after treatment with MyD88 adenovirus,
which confirms the significance of MyD88-ERK pathway as target for regulating RA
by SIRT6 gene.
Fig. 6.
Relative expression of related protein in RSC-364 cells after
different treatments. (A) Western blot analysis of SIRT6, MyD88, ERK and p-ERK
levels. GAPDH was used as a loading control. Quantitative densitometry of SIRT6
(B), MyD88 (C), ERK (D) and p-ERK (E) levels relative to GAPDH.
p 0.01 compared to control group; p
0.05, p 0.01 compared to Model group. Experimental results
were expressed as mean SD, n = 3. ①: Control group; ②:
Ad-SIRT6-Control; ③: Ad-Control; ④: Model group; ⑤:
Ad-SIRT6-Model; ⑥: Ad-Model; ⑦: Ad-SIRT6-Model-MyD88.
3.6 Effect of SIRT6 on MyD88-ERK Pathway in RA Rat Model in Vivo
3.6.1 Ultrasonic Test Results
To understand the effect of SIRT6 on MyD88-ERK signaling pathway, we performed
ultrasonic test with the results displayed in Fig. 7A. Ultrasound examination of
rats’ ankle joint in control showed no obvious hyperplasia of synovium and no
blood flow signal. Proliferative synovium and punctate blood flow signals were
seen in the ankle of Model rats, thus indicating successful construct of RA
model. In overexpressed SIRT6 group (Ad-SIRT6 Model), the proliferative synovium
of ankle joint was not significant when compared with RA group, amid no obvious
blood flow signal, which therefore indicates that SIRT6 gene
overexpression showed a good effect on RA. After the RA rats in group Ad-model
were given blank carrier, the proliferative synovium and short linear blood flow
signals could be seen in their ankles. In Ad-SIRT6-Model-MyD88 rats, we observed
no obvious hyperplasia of synovium and no blood flow signal, which suggests the
symptoms of RA were significantly relieved, and hence SIRT6 could potentially
inhibit MyD88 pathway and inflammation with concomitant treatment of RA.
Fig. 7.
Ultrasonic Test Results. (A) Ultrasonic test results of each
group. (B) Thickness measurement results of the thickest joint synovium of rats
in different groups. Scale bars = 0.25 cm. p 0.01 compared
to control group; p 0.05, p 0.01 compared
to Model group. Experimental results were expressed as mean SD, n = 3.
①: Control group; ②: Model group; ③: Ad-SIRT6-Model;
④: Ad-Model group; ⑤: Ad-SIRT6-Model-MyD88.
3.6.2 Thickness Test Results at the Thickest Part of Synovium
Thickness test was also performed, wherein the result is presented in Fig. 7B.
Thickness of joint synovium of Model rats increased substantially (Mean SD of Thickness at the thickest part of synovium in control group: 1.33
0.58; in model group: 6.80 1.20; p 0.01) compared to
control, which indicates successive replication of RA rat model with obvious
inflammatory reaction. Remission of synovial thickness of rats in Ad-SIRT6-Model
group markedly decreased (Mean SD of Thickness at the thickest part of
synovium in Ad-SIRT6-Model group: 3.77 0.92; p 0.01) compared
to model batch, which indicates improvement in the inflammation of RA rats after
they have received SIRT6 gene overexpression treatment. This finding
demonstrates that SIRT6 could play an anti RA role. At the same time, compared
with the Model group, the synovial thickness of rats in Ad-Model group did no
change, which implies that blank adenovirus had no therapeutic effect on RA. In
comparison with the Model group, we observed substantial decrease (Mean
SD of Thickness at the thickest part of synovium in Ad-SIRT6-Model-MyD88 group:
4.50 0.56; p 0.05) in the synovial thickness of rats in
Ad-SIRT6-Model-MyD88 group, which suggests that the inflammatory symptoms of RA
in rats were obviously alleviated, wherein SIRT6 could regulate MyD88 pathway to
inhibit RA inflammation.
3.6.3 HE Staining
Through HE staining, we observed that the synovial morphology of rats in control
was normal with cells arranged orderly, amid no synovial thickening and
angiogenesis (Fig. 8A). Model group rats displayed severe hyperplasia of
synovium, obvious cell infiltration of inflammation, visible defect and formation
of pannus. The morphology of synovium in SIRT6 overexpression group
(Ad-SIRT6-Model) tended to be normal, whereas the cells were arranged orderly
with thickened synovium but no obvious angiogenesis. Obviously, these results
imply that SIRT6 overexpression had a clear therapeutic effect on RA. Synovial
morphology of rats in group Ad-Model was consistent with the Model group. In
Ad-SIRT6-Model-MyD88 group, it could also be found that the synovial tissue of
rats was significantly better than that of the Model group.
Fig. 8.
HE staining results of rats’ tissues in different groups. Scale
bars = 10 µm. (A) Synovial tissues. (B) Kidney tissues. (C) Liver tissues.
①: Control group; ②: Model group; ③: Ad-SIRT6-Model;
④: Ad-Model group; ⑤: Ad-SIRT6-Model-MyD88.
Pathological examination suggested that renal tissues of rats in Control group
showed no obvious pathological changes with normal nuclear morphology and no
inflammatory infiltration (Fig. 8B). However, renal tubular epithelial cells of
those in Model group displayed some vacuolar degeneration, cell edema, damaged
cell membranes and nuclei in varying degrees, coupled with obvious inflammatory
cell infiltration. Cell morphology of rat kidney in overexpressed SIRT6 can be
observed in Fig. 8B. Likewise, we observed similar trend when liver tissue of
rats in all the groups were stained with HE after treatments (Fig. 8C).
3.6.4 Effect of SIRT6 on Levels of Biomarkers in Sera of RA Rats
Levels of biomarkers in sera of RA rats was studied with ELISA testing. It was
discovered that the levels of serum IL-1, IL-6, IL-17, IL-21, IL-22,
GSH, MDA, TNF- and MCP-1 in Model rats increased substantially (Mean
SD for each inflammatory markers in Model group: IL-1: 409.48
21.72; SOD: 39.72 3.00; IL-21: 12.13 0.80; IL-6: 236.53
18.86; MDA:29.73 2.25; IL-22: 212.09 15.38; GSH: 78.95
5.89; TNF-: 302.74 22.79; IL-17: 21.09 1.44;
MCP-1: 5.06 0.34; Mean SD for each inflammatory markers in
control group: IL-1: 71.14 3.72; SOD: 151.41 11.66;
IL-21: 4.08 0.31; IL-6: 38.76 2.52; MDA:7.86 0.51; IL-22:
121.35 7.91; GSH: 19.45 1.59; TNF-: 116.83
8.14; IL-17: 5.83 0.38; MCP-1: 2.03 0.14; p 0.01)
compared to Control (Fig. 9), whilst SOD level decreased in serum of Model rats.
This showed that the constructed model method could successfully establish RA
model. In comparison with Model group, serum levels of the above-mentioned
inflammatory mediators and SOD in Ad-Model remained basically unchanged, thus
indicating blank adenovirus vector had no effect on RA inflammation. Compared
with Model group, we found that the levels of serum IL-1, IL-21, IL-22,
IL-6, IL-17, GSH, MDA, TNF- and MCP-1 in group Ad-SIRT6-Model decreased
substantially (Mean SD for each inflammatory markers in Ad-SIRT6-Model
group: IL-1: 182.45 9.75; IL-21: 6.63 0.41; IL-6: 82.06
6.75; MDA:11.64 0.83; IL-22: 151.37 11.31; GSH: 31.48
2.56; TNF-: 178.08 12.43; IL-17: 7.83 0.56;
MCP-1: 3.88 0.28; p 0.01), while the level of serum SOD in
Ad-SIRT6-Model group increased markedly (Mean SD of SOD in Ad-SIRT6-Model
group: 118.9 8.94, p 0.01). In addition, serum levels of
IL-1, IL-21, IL-22, IL-6, IL-17, GSH, MDA, TNF- and MCP-1 in
Ad-SIRT6-Model-MyD88 group decreased significantly (Mean SD for each
inflammatory markers in Ad-SIRT6-Model-MyD88 group: IL-1: 293.61
60.05; IL-21: 10.75 0.96; IL-6: 207.50 22.45; MDA:25.13
4.50; IL-22: 188.13 12.27; GSH: 70.70 4.79; TNF-:
243.52 27.47; IL-17: 18.96 1.35; MCP-1: 4.46 0.46; p
0.05 or p 0.01) compared to Model, while SOD level in
Ad-SIRT6-Model-MyD88 rat serum increased significantly (Mean SD of SOD in
Ad-SIRT6-Model-MyD88 group: 79.18 8.93, p 0.01). The results
collectively affirm that treatment of RA rats with SIRT6 adenovirus could
significantly inhibit inflammation. Consequently, SIRT6 could still regulate
MyD88 induced activities of serum IL-1, IL-21, IL-22, IL-6, IL-17, GSH,
MDA, TNF-, MCP-1 and SOD to a certain extent.
Fig. 9.
ELISA results of serum from different groups of rats. (A)
IL-1. (B) SOD. (C) IL-21. (D) LDH. (E) IL-6. (F) MDA. (G) IL-22. (H)
TNF-. (I) IL-17. (J) MCP-1. Experimental results were expressed as mean
SD, n = 6. p 0.01 compared to control group;
*p 0.05, **p 0.01 compared to Model group. ①:
Control group; ②: Model group; ③: Ad-SIRT6-Model; ④:
Ad-Model group; ⑤: Ad-SIRT6-Model-MyD88. ELISA, enzyme linked immunoassay.
3.6.5 Detection of SIRT6 and MyD88 mRNA Expressions in RA Rats
Relative expression of SIRT6 mRNA in the sera of rats in Model group decreased
(Mean SD of SIRT6 in control group: 1.00 0.24; in Model group:
0.69 0.10; p 0.01) compared to control (Fig. 10), which
suggests disturbed and decreased relative expression of SIRT6 mRNA in serum of RA
rats. Through comparison with Model rats, we observed substantially (Mean
SD of SIRT6 in Ad-SIRT6-Model group: 3.33 0.23; in Ad-SIRT6-Model-MyD88
group: 3.07 1.32; p 0.01) increased relative expression of
SIRT6 mRNA in Ad-SIRT6-Model and Ad-SIRT6-Model-MyD88 groups. It was showed that
SIRT6 gene loaded by adenovirus vectors in Ad-SIRT6-Model and
Ad-SIRT6-Model-MyD88 groups can be carried into rats with high expression. In
addition, compared to Control, the relative expression of serum IL-1,
IL-21, IL-22, IL-6, IL-17, TNF- and MCP-1 mRNA in Model group increased
significantly (Mean SD of related genes in Control group: IL-6: 1.00
0.13; TNF-: 1.00 0.32; IL-1: 1.00
0.24; IL-17: 1.00 0.24; IL-21: 1.00 0.31; IL-22: 1.00
0.30; MCP-1: 1.00 0.18; in model group: IL-6: 1.62 0.19;
TNF-: 3.00 0.23; IL-1: 2.04 0.29; IL-17: 3.14
0.48; IL-21: 1.61 0.22; IL-22: 2.19 0.22; MCP-1: 1.30
0.14; p 0.01). Also, we observed substantial decreased
relative expression of serum IL-1, IL-21, IL-22, IL-6, IL-17,
TNF- and MCP-1 mRNA in Ad-SIRT6-Model (Mean SD of related genes
in Ad-SIRT6-Model group: IL-6: 0.89 0.11; TNF-: 1.52
0.21; IL-1: 0.91 0.11; IL-17: 1.60 0.35; IL-21: 0.71
0.10; IL-22: 1.12 0.15; MCP-1: 0.50 0.07; p
0.01) and Ad-SIRT6-Model-MyD88 groups (Mean SD of related genes in
Ad-SIRT6-Model-MyD88 group: IL-6: 1.15 0.30; TNF-: 2.19
0.82; IL-1: 1.41 0.65; IL-17: 2.38 0.60; IL-21: 1.21
0.28; IL-22: 1.73 0.31; MCP-1: 0.96 0.31; Mean SD
of related genes in Ad-Model group: IL-6: 1.50 0.35; TNF-: 3.03
0.43; IL-1: 2.05 0.32; IL-17: 2.96 0.42; IL-21:
1.61 0.22; IL-22: 2.19 0.24; MCP-1: 1.22 0.19; p
0.05 or p 0.01) compared to Model group with their relative
expressions in Ad-Model group remaining basically unchanged. These findings
indicate that the expression of serum IL-1, IL-21, IL-22, IL-6, IL-17,
TNF- and MCP-1 mRNA could be reduced significantly after treatment with
SIRT6 gene. Meanwhile, the expression of the above-mentioned genes at
mRNA level was still significantly reduced after administration of MyD88
adenovirus (p 0.05), which verified that MyD88 could regulate
inflammation in RA. Meanwhile, compared with group Control, the relative
expression of serum MyD88 mRNA in Model group increased significantly (Mean
SD of MyD88 in Control group: 1.00 0.30; in Model group: 4.01
0.44; p 0.01). However, the relative expression of serum
MyD88 mRNA in Ad-SIRT6-Model (Mean SD of MyD88 in Ad-SIRT6-Model group:
1.98 0.39; p 0.01) and Ad-SIRT6-Model-MyD88 decreased
significantly (Mean SD of MyD88 in Ad-SIRT6-Model-MyD88 group: 2.72
0.92; p 0.01) compared to Model group, but remained basically
unchanged in Ad-Model group. Altogether, expression of serum MyD88 mRNA could be
substantially reduced after treatment with SIRT6, which affirm the importance of
MyD88 pathway to the regulatory role of SIRT6 gene in RA.
Fig. 10.
Levels of related SIRT6 and MyD88 mRNA expressions in different
groups of rats. RT-PCR analysis of relative expression of (A) SIRT6, (B) MyD88,
(C) IL-6, (D) TNF-, (E) IL-1, (F) IL-17, (G) IL-21, (H) IL-22,
(I) MCP-1. In all experiments, GAPDH was used as an internal control.
Experimental results were expressed as mean SD, n = 6. p
0.01 compared to control group; p 0.05, p
0.01 compared to Model group. ①: Control group; ②: Model
group; ③: Ad-SIRT6-Model; ④: Ad-Model group; ⑤:
Ad-SIRT6-Model-MyD88.
3.6.6 Detection of SIRT6 and MyD88 Proteins Expression in RA
Rats
Through comparative analysis, we observed that relative SIRT6 protein expression
in serum of rats in Ad-SIRT6-model increased significantly (Mean SD of
SIRT6 protein expression in control group: 0.330.02; in Ad-SIRT6-Model
group: 0.86 0.04; p 0.01, Fig. 11)
compared to control, but that of Ad-Model remained unchanged. Likewise, relative
expression of serum SIRT6 protein in Ad-SIRT6-Model and Ad-SIRT6-Model-MyD88
groups increased substantially (Mean SD of SIRT6 protein expression in
Ad-SIRT6-Model-MyD88 group: 0.82 0.06; p 0.01). Also, upon
comparison with Control, we discovered that MyD88, ERK, p-ERK, MEK and p-MEK
protein expressions in serum of Model rats relatively increased (Mean SD
of related proteins expression in control group: MyD88: 0.36 0.02; ERK:
0.21 0.02; p-ERK: 0.31 0.02; MEK: 0.18 0.02; p-MEK: 0.11
0.03; in Model group: MyD88: 0.93 0.02; ERK: 1.12 0.03;
p-ERK: 1.34 0.07; MEK: 0.85 0.06; p-MEK: 0.79 0.03;
p 0.01). In compared with Model group, the relative expression of
serum MyD88, ERK, p-ERK, MEK and p-MEK protein in Ad-SIRT6-Model (Mean SD
of related proteins expression in Ad-SIRT6-Model group: MyD88: 0.49 0.04;
ERK: 0.54 0.09; p-ERK: 0.41 0.03; MEK: 0.20 0.04; p-MEK:
0.25 0.03; p 0.01) and Ad-SIRT6-Model-MyD88 groups decreased
significantly (Mean SD of related proteins expression in
Ad-SIRT6-Model-MyD88 group: MyD88: 0.76 0.05; ERK: 0.81 0.03;
p-ERK: 1.18 0.03; MEK: 0.72 0.06; p-MEK: 0.73 0.05;
p 0.05), but did not basically change in Ad-SIRT6-Model group.
Hence, the expression of serum MyD88, ERK and p-ERK, MEK and p-MEK protein could
be markedly reduced after SIRT6 treatment. Overall, the expression of serum
MyD88, ERK and p-ERK, MEK and p-MEK protein increased significantly after
treatment with MyD88 adenovirus, which confirms the significance of MyD88-ERK
pathway in the regulation of RA by SIRT6.
Fig. 11.
Expression levels of related proteins in distinct groups of
rats. (A) Related expression levels of protein in different groups; Quantitative
densitometry of SIRT6 (B), MyD88 (C), ERK (D), p-ERK (E), MEK (F) and p-MEK (G)
levels relative to GAPDH. p 0.01 compared to control group;
p 0.05, p 0.01 compared to Model group.
Experimental results were expressed as mean SD, n = 3. ①:
Control group; ②: Model group; ③: Ad-SIRT6-Model; ④:
Ad-Model group; ⑤: Ad-SIRT6-Model-MyD88.
4. Discussion
As a common joint disease of chronic inflammation, RA exhibits characteristics
like synovitis and hyperplasia of synovium, cartilage degeneration and bone
destruction [37], which seriously affects patients’ well-being. Incidence rate of
RA is mainly high in the thirtieth to fiftieth years of age [38], albeit
occurring at any age. Increased production of inflammatory cytokines by synovial
cells, namely TNF- and IL-1, which play an important role in
RA pathogenesis and are centrally link to RA [39]. Currently, prevention and
alleviation of RA has been successful because of sustained disease modifying
anti-rheumatic drugs (DMARDs) development [40]. However, these DMARDS are not
effective in some RA patients and as a result there is unmet need for novel
therapeutic targets. In this regard, this work sought to explore the mechanistic
effect of SIRT6 on RA. The RA has a complex pathogenesis which involves genes
interacting with the environment, and consequently culminates in immune tolerance
collapse coupled with inflammation of the synovia [41, 42]. Notwithstanding,
intracellular signaling like MyD88 and ERK has been implicated in the
pathogenesis of RA. As an important component of downstream cascade signaling of
interactive IL-1/IL-1 receptor, Myd88 is reported to converge with
NF-B pathway (canonical) ultimately and result in promotion of
amplified production of inflammatory factor in RA [43]. On the other hand, the
involvement of ERK in RA pathogenesis is mainly through the activation of the
pathway in RA-FLS [44]. Of note, ERK activation has been described to increase in
RA patients, thereby affirming the significance of the pathway in the
pathological process of the disease [45]. Besides, existing studies have proven
that SIRT6 is a principal regulatory protein of inflammation and aging diseases,
which plays crucial roles in regulating multiple pathways of inflammation,
wherein it has the potential to inhibit inflammation development [46]. In RA,
SIRT6 has been reported to exhibit anti-inflammatory activity by blocking
NF-B pathway wherein it can reduce inflammation and tissue destruction.
In agreement to the above phenomenon, we observed a significant decrease in SIRT6
expression in RA patients compared to normal volunteers. This phenomenon can be
ascribable to the increased expressions of pro-inflammatory factors like
TNF- or high expression of long-noncoding RNAs
(IncRNA)-plasmacytoma-variant translocation-1 (PVT-1), which lowers Sirt6
expression via methylation of the deacetylase protein in RA-FLS and synovial
tissues of RA patients [35, 36]. Existing literature has posited that
TNF--activated endothelial cells (ECs) demonstrated decreased Sirt6
expression in a dose dependent fashion [35]. Besides, the activation of ECs in RA
by increased levels of pro-inflammatory mediators has also been described by
other works [47]. These observations affirm that inflammation in RA comprised of
complex cascade of pro-and anti-inflammatory factors [48]. Further, other authors
discovered that Sirt6 expression was reduced by increased IncRNA-PVT-1 expression
in synovial tissue and RA-FLS of RA rats [36]. In that work, low expression of
Sirt6 in RA rats was as a result of recruitment of DNA methyl transferases to
promoter region of Sirt6 and subsequent methylation of the protein by PVT-1.
Based on the above findings, our future studies will comprehensively investigate
the potential pathomecahnistic roles of PTV-1 and the actual mechanisms
underlying the effect of TNF- on Sirt6 expression in RA-related cells.
In support of the anti-inflammatory activity of Sirt6, other works have shown
that treatment with SIRT6 adenovirus could significantly reduce concentrations of
pro-inflammatory mediators at local and systemic levels [49]. Herein, we observed
increased level of MCP-1, IL-1, IL-21, IL-22, IL-6, IL-17, LDH, MDA and
TNF- expressions in RA model group compared to control group, albeit
decreased SOD expression. Notably, the reverse of aforementioned results was
observed when RA-FLS cells were treated with overexpressed SIRT6. It is obvious
that pro-inflammatory mediators will increase in a typical disease of chronic
inflammation like RA. Also, a decreased SOD levels in RA may be ascribed to
overproduction of superoxide anion (O) in the
inflammatory disease, wherein an attempt to physiologically defend against the
oxidative stress culminate in reduced antioxidant protein [50]. Further,
overexpression of SIRT6 reduced the above-mentioned pro-inflammatory markers,
which affirms the potential of the protein to suppress inhibition of such factors
[51]. Previous studies have shown that MyD88 dependent pathway plays a major role
in TLR4 mediated pathway [28], which has been shown to pontially promote joint
inflammation via binding of various endogenous ligands [52]. Also, existing work
has discovered the activation of ERK pathway in the RA-FLS and its subsequent
involvement in the pathological process and destruction of RA [44]. Also,
overexpressed Sirt6 increased ERK phosphorylation in Huh cells [53]. Of note, the
therapeutic role of SIRT6 in RA via MyD88-ERK pathway regulation has not been
reported yet. Hence, we decided to detect the expression of MyD88-ERK pathway at
mRNA and protein levels to predict the potential role of SIRT6 in RA. MyD88
deregulation and its downstream cascade are associated with chronic inflammation
in RA [54, 55]. Another work [54] has reported that streptococcal cell wall
(SCW)-induced arthritis mainly depended on MyD88 and TLR2 in mice that lacked
MyD88 did not develop SCW-induced arthritis, wherein local pro-inflammatory
cytokines levels in the mouse synovial tissue decreased significantly. Similar
report [55] also detected synovial cells from RA tissue, wherein overexpressed
MyD88 substantially down-regulated cytokines in RA. Aside, ERK pathway, as a
representative member of MAPK family, has also been proven to associate closely
with inflammation regulation [56]. MEK (MAPkinasekinase) is a member of map2k and
an upstream ERK1/2 signal [57]. An ERK activation by MEK phosphorylation is core
element downstream of the pathway. Thus, phosphorylated ERK (p-ERK) is one of the
active cell function biomarkers [58]. Blocking of ERK activation by administering
MEK inhibitor (PD184352) to CIA rats could improve joint lesions [59]. Another
study [60] found that overexpressed SIRT6 could inhibit the level of ERK1/2
phosphorylation. Thus, suppression of MyD88-ERK pathway in inflammation may
contribute to RA progress. Also, it seems relationship between SIRT6 and MyD88
has not been clearly established. Notwithstanding, a relationship exists between
overexpressed SIRT6 and NF-B pathway [61], wherein the latter is
activated by TLR4 via MyD88-dependent pathway [62]. Therefore, we therefore
assumed that SIRT6 may have an association with MyD88-ERK pathway. In this
regard, we observed increased of MyD88, ERK and p-ERK proteins expressions with
concomitant decreased Sirt6 protein expression in RA patients. Also, in
vitro cell study demonstrated significantly increased MyD88 mRNA expression in
RA-FLS cells. These findings may affirm the inflammatory role of MyD88-ERK
pathway in contributing to development and destructive processes of human RA
[63]. Available literature has suggested the potential of overexpressed SIRT6 to
suppress inflammation and damaged bone in mouse model of collagen-induced
arthritis [24]. Thus, SIRT6 overexpression can substantially reduce MyD88
expression, and inhibit expression and phosphorylation of ERK and MEK proteins,
which ultimately suppress MyD88-ERK pathway and alleviate inflammation in RA.
Despite the above promising findings, this study is limited to some extent. In
the first place, the actual mechanism underlying the interaction between SIRT6
and MyD88-ERK pathway is not known. Also, the downstream and upstream of the
constituents of MyD88-ERK pathway have not been established. Besides, the effect
of SIRT6 on the supposed components of MyD88-ERK pathway was also not studied.
Hence, future works will seek to compressively investigate the underlying
prospects to fully understand the beneficial role of SIRT6 in RA treatment.
5. Conclusions
In conclusion, we successfully studied the effect and mechanism of SIRT6 on RA.
We established that SIRT6 was lowly expressed in RA patients’ sera with an
increase in related inflammatory factors in RA-FLS cells and RA rats. But our
study discovered that overexpressed SIRT6 substantially decreased the above
factors. Also, we observed increased mRNA and protein expression of MyD88 in
RA-FLS cells and RA rats, which was reversed after SIRT6 was overexpressed.
Additionally, we found that SIRT6 expression could inhibit ERK pathway by
inhibiting the activities of ERK and MEK. Likewise, SIRT6 overexpression reduced
inflammatory injury in RA through inhibition of MyD88-ERK signaling pathway.
Based on the aforementioned findings, we intend to focus our not-too distant
future research works on activation and up-regulation of SIRT6 expression,
coupled with exploration of natural agonists or chemically synthesized activators
of SIRT6 for suppression of RA progression via MyD88-ERK signal pathway.
Availability of Data and Materials
Upon reasonable request, data supporting findings of this work are available
from corresponding author.
Author Contributions
XY, ZJ, FR, and JX designed the research study. XY, ZJ, PZ, and JWu performed
the research. FR and JWa provided help and advice on the experiments. MR analyzed
the data. All authors contributed to editorial changes in the manuscript. All
authors read and approved the final manuscript. All authors have participated
sufficiently in the work and agreed to be accountable for all aspects of the
work.
Ethics Approval and Consent to Participate
Human experiments were carried out in accordance with The Code of Ethics of the
World Medical Association (Declaration of Helsinki) and approved by the ethics
committee of Jiangsu University affiliated Wujin Hospital (No. 2021[25]). Animal
experiments were performed comply with the ARRIVE guidelines and carried out in
accordance with the National Research Council’s Guide for the Care and Use of
Laboratory Animals and approved by the Institutional Animal Care and Use
Committee of Jiangsu University (UJS-IACUC-2022010801). Each participant was
informed their right to have their information kept confidential. All
participants provided written consent prior to participation.
Acknowledgment
Not applicable.
Funding
This study was funded by the Young Talent Development Plan of Changzhou Health
Commission (CZQM2020120), Jiangsu Key Laboratory of Immunology and Metabolism
(XZSYSKF2020018), the Top Talent of Changzhou “The 14th Five-Year Plan”
High-Level Health Talents Training Project (2022CZBJ109), Nanjing Medical
University Science and Technology Development Fund (NMUB20220194), the Changzhou
Sci & Tech Program (No.CJ20220164) and the Clinical Technology Development
Foundation of Jiangsu University (No.JDYY2023074).
Conflict of Interest
The authors declare no conflict of interest.
