- Academic Editor
Background: Pulmonary fibrosis (PF), the most common clinical type of irreversible interstitial lung disease with one of the worse prognoses, has a largely unknown molecular mechanisms that underlies its progression. CD5 molecule-like (CD5L) functions in an indispensable role during inflammatory responses; however, whether CD5L functions in regulating bleomycin (BLM)-induced lung fibrosis is less clear. Methods: Herein, we describe the engineering of Cd5l knockout mice using CRISPR/Cas9 gene editing technology. The BLM-induced model of acute lung injury represents the most widely used experimental rodent model for PF. Results: Taking advantage of this model, we demonstrated that both CD5L mRNA and protein were enriched in the lungs of mice following BLM-induced pulmonary fibrosis. Inhibition of CD5L prevented mice from BLM-induced lung fibrosis and injury. In particular, a lack of CD5L significantly attenuated inflammatory response and promoted M2 polarization in the lung of this pulmonary fibrosis model as well as suppressing macrophage apoptosis. Conclusions: Collectively, our data support that CD5L deficiency can suppress the development of pulmonary fibrosis, and also provides new molecular targets for the use of immunotherapy to treat lung fibrosis.
Pulmonary fibrosis (PF) has a poor prognosis and represents a severe health problem worldwide [1]. PF is a chronically progressive lung disease characterized by the disruption of the pulmonary parenchyma and lung architecture, and accumulation of extracellular matrix (ECM) that leads to respiratory failure [2, 3, 4]. Despite intensive studies, the complex pathogenesis and variable progression result in a median survival of only 3–5 years after diagnosis [5]. The bleomycin (BLM)-induced model of acute lung injury represents the most widely used experimental rodent model for this disease, and simulates inflammatory and fibrotic events similar to pulmonary fibrosis symptoms seen clinically [6, 7, 8, 9]. BLM exposure results in release of inflammatory mediators and promotes initial inflow from neutrophils and, subsequently macrophages to sites of injury, with commensurate rises in ECM modulation and cytokine production including collagen, fibronectin, and hyaluronan [10].
During damage and fibrotic progression, abundant infiltration of macrophages
occurs and portends poor prognosis for PF patients [11]. In particular,
macrophages play a crucial role in both inflammation and fibrotic phases of the
disease where they adopt diverse phenotypes and differentiation in two distinct
subsets. Classically, M1-like macrophages are activated by interferon-gamma
(IFN-
CD5 molecule-like (CD5L), also known as apoptosis inhibitor of macrophage (AIM), has been reported to function in response to inflammation and microorganisms, as well as during fat metabolism. CD5L is a broad IgM-binding secreted protein [18, 19]. CD5L is principally expressed in macrophages and alveolar epithelial cells [20, 21, 22], and has been reported to protect against pro-apoptotic stimuli in macrophages, T cells, and NKT cells [19, 23, 24]. CD5L has also been considered to be a pro-inflammatory factor in the pathogenesis of colitis [25], atherosclerosis [26], bacterial infection [27], and chronic obstructive pulmonary disease (COPD). Current evidence shows that higher circulating CD5L levels were associated with poor liver function in patients with liver cirrhosis [28, 29]. Moreover, CD5L is associated with lipid synthesis and function, for example, fatty acid synthesis, subcellular membranes [21, 30], extracellular vesicles [31], LPSs and lipoteichoic acid [32]. CD5L is potentially a pattern identification molecule [33]; however, whether it can be regarded as a potential treatment target for PF has not been explored.
In this study, we hypothesized that CD5L mediates macrophage apoptosis during
lung fibrosis. We took advantage of the BLM-induced lung fibrosis mouse model to
investigate: (1) Whether Cd5l expression would respond to the
development of PF; (2) Whether Cd5l knockout (Cd5l
C57BL/6 (wild-type-WT) mice were bred in specific pathogen-free animal conditions, and all procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of Shanghai Laboratory Animal Research Center (Authorization numbers: 202202002).
C57BL/6-Cd5l knockout (Cd5l
Fig. 1.Construction strategy of Cd5l knockout mice and Cd5l expression analysis. (a) Exons 2–4 were chosen as the region for gene knockout, and sgRNAs designed to target sites upstream and downstream of exons 2 and 4, CRISPR-Cas9 technology was used to produce a reading frame shifting mutation within the Cd5l. (b) PCR gel electrophoresis results of heterozygous and homozygous mice, HE-heterozygous mice, HO-homozygous mice, WT-wild type mice. (c) Statistics of Cd5l mRNA expression.
| gRNAs | Sequence (5 |
| gRNA1 | GGAAGGCACGAAGCCTCCAAGGG |
| gRNA2 | TGTATCGTGCAATCATACTATGG |
| Primer | Sequence (5 |
| Cd5l-Com-F | TGCCCACCAGTGACCGTTCC |
| WT-R | CAAGGCTGATGGGCTGATGTAGAC |
| KO-R | AATCCCCGTGGCTAGGTCTGTTTT |
WT and Cd5l
The lungs were prepared for lavage by cannulating the trachea with a catheter attached by a syringe, the bronchoalveolar lavage fluid (BALF) was collected by flashing the lung three times with 1 mL of sterile phosphate buffer saline (PBS) [35]. Approximately 0.6 mL of BALF was routinely harvested from each mouse. After BALF recovery, the lungs were removed and stored at –80 °C until further evaluation.
To determine fibroblast apoptosis following bleomycin, an Annexin V/propidium iodide (PI) apoptosis detection kit (Thermo Fisher Scientific, United States) was used to co-stain BALF [36] to discriminate between live cells and those in early and late apoptotic stages [37]. Briefly, BALF cells were incubated with Annexin V and PI solutions for 15 min at room temperature in the dark. Fluorescence intensity was detected using a CytoFLEX Flow Cytometer (B5R3V5, Sadina, California, United States). For this evaluation by flow cytometry, a higher FITC-AnnexinV/lower PI value (termed Q3 region) defined early apoptotic cells whereas higher FITC-Annexin-V/higher PI (termed Q2 region) defined late apoptotic cells. Live cells were defined as lower FITC-Annexin-V/lower PI (termed Q4 region). The percentage of Annexin V- or PI-positive cells quantified the extent of apoptosis.
For classification of macrophages cells, the BALF was centrifuged for 10 min at 1500 rpm and immunostained. Lung macrophages cells were stained with anti-mouse CD16/CD32 (553140, Franklin Lakes, New Jersey, United States) and Zombie (423101, BioLegend, San Diego, CA, United States), anti-mouse CD11b-APC (BioLegend, San Diego, CA, United States) and anti-mouse F4/80-BV421 (123131, BioLegend, San Diego, CA, United States). Subsequently, after staining with anti-mouse MHCII-PE (107608, BioLegend, San Diego, CA, United States) and anti-mouse CD206-FITC (BioLegend, United States), cells were analyzed using a CytoFLEX Flow Cytometer (B5R3V5, Beckman, California, United States). Data analysis was performed using FlowJo software (v10, FlowJo LLC, Ashland, OR, USA).
The right lung tissue was excised and immersed in 4% neutral paraformaldehyde overnight at room temperature, and subsequently embedded in paraffin. Tissue was sectioned cut into 5 µm-thick sections for histological analysis using established protocols. After dewaxing, the alveolitis and fibrosis were investigated using hematoxylin and eosin (H&E) staining. Sirius red and Masson’s trichrome staining method were conducted to reveal collagen deposition (blue staining). The severity of fibrosis changes was scored using the Ashcroft scoring system scoring from 0–8 [38, 39] in a double-blind evaluation. Each object, such as aerated lung area (an indicator of lung consolidation extent) and sum or mean collagen volume area (an indicator of collagen extent), were determined using ImagePro-Plus version 6.0 (Media Cybernetics, Rockville, MD, USA). Mean values from all fields of view analyzed in for each mouse lung were calculated.
Whole blood (approx. 1 mL) was collected into 1.5 mL tubes and allow to stand
for 30 min at room temperature. The samples were subsequently centrifuged for 15
min at 350 g to obtain serum. Serum concentrations of TGF
The protein in lung homogenate was extracted used by RIPA lysis buffer (Takara,
Dalian, China). Western blot was analyzed using established procedures with
indicated primary antibodies. Briefly, protein was separated on 10%
polyacrylamide gel and electro-transferred to PVDF membrane. 5% non-fat milk was
used to block PVDF membranes for 1 h and then incubated overnight at 4
°C with primary antibody to
Quantitative RT-PCR analysis was performed using SYBR Premix Ex Taq (AQ131,
Transgen, Beijing, China). The primer sequences used for each target gene:
Tgf-
Differences between groups were analyzed using GraphPad Prism (version 9.0)
software (GraphPad Software, Santiago, MN, USA). Data were expressed as the mean
To generate Cd5l
| Genotype | Sequence (5 |
Mutation |
| Cd5l |
GGCTAGTGCCAAGAGAAGGTGGCCCTGAAAGGATGCC…(7318 bp) …CTATGGACTATGACAGAGAATGCCGTAA…(–1 bp) …T… (–4 bp) …TATAACTTCTGAGTTCTTCCACC | –7323 bp |
| WT | GGCTAGTGCCAAGAGAAGGTGGCCCTGAAAGGATGCCCTTGGAGGCTTCGTGCCTTCCACTTTCCCTTAAGAAGTTTGGC……ACTTAAAAATTGTGTATCGTGCAATCATACTATGGACTATGACAGAGAATGCCGTAAATACGGTATAACTTCTGAGTTCTTCCACC |
As Cd5l is associated with inflammation during the development of lung
fibrosis [40]. We first reasoned that Cd5l may be involved in the
pathophysiology of pulmonary fibrosis and to test this, a 3 mg/kg dose of
bleomycin was given once intratracheally to WT and Cd5l
Fig. 2.Expression of Cd5l in bleomycin-induced pulmonary fibrosis in mice. (a) A schematic diagram for BLM-induction is shown. (b) Cd5l mRNA expression in the lung of WT mice treated with saline or BLM. (c,d) Western blot analysis of Cd5l expression in the lung of WT mice following 21 days of BLM induction. Left panel: representative western blots are shown. Right panel: Immunoblot signals were quantified and a bar graph illustrating results is shown. Statistical testing used was a Student’s t test. BLM, bleomycin.
We next sought to examine the expression of Cd5l in the lung of mice with BLM-induced pulmonary fibrosis. A 2.5-fold higher Cd5l RNA and 3-fold higher protein expression were detected in BLM-induced WT mice 21 days after BLM administration as compared with 0 day (Fig. 2b–d). Collectively, these data indicate that CD5L is involved in the development of pulmonary fibrosis.
Based on the above observations, the effect of Cd5l on inflammation and fibrotic
in the lung of Cd5l
Fig. 3.Loss of Cd5l attenuates lung injury and fibrosis. (a)
Weights of mice treated with BLM. Values are means
Next, the levels of fibrosis-specific markers were examined. Acta2
(
Fig. 4.Measurement of fibrogenic and proinflammatory factors in mouse
lung. (a–c) Expression of the fibrogenic genes: Acta2 (a)
Col1a1 (b) and Eln (c) in the lung of BLM-treated mice at 21
days. Five mice were analyzed in each group. (d–f) Inflammation markers:
Tgf
It has been have previously shown that the bleomycin-treated respiratory
distress is associated with an early inflammatory reaction [42, 43], thus, we
next examined lung inflammation. The inflammation-linked genes
Tgf
We characterized proportion of differential cells in the BALF obtained from
various groups on day 21 after BLM-treatment. Flow cytometry showed that both WT
and Cd5l
Fig. 5.CD5L predominantly induce M2 polarization in lung following BLM
treatment. Left panel: Representative scatter diagram generated during FACS
analysis. Right panel: A bar graph indicating the data obtained. (a) Flow
cytometry analysis of CD45
We next analyzed apoptosis in macrophages within BALF taken from BLM-treated
mice by flow cytometry. An untreated control group were included in this
analysis, so the death detected here may be conferred by treatment with TE
buffer, and during assay preparation and centrifugation death may have occurred
[44]. Annexin V/PI staining showed that the proportions of early apoptotic cells
in both models were found as significantly increased compared over controls, but
after bleomycin treatment, apoptotic cells in BALF of Cd5l
Fig. 6.Cd5l deficiency represses apoptosis. (a) Annexin-V/PI
flow cytometry analysis of BALF following BLM stimulation. (b) Bar graph of the
flow cytometry analysis results. **p
The clinical role for CD5L in acute respiratory distress syndrome (ARDS), and trauma victims diagnosed with ARDS display a higher overall CD5L level, compared with healthy people. Further, serum CD5L was upregulated within 24 hours after trauma in patients, and severe trauma patients have higher CD5L values compared to more than mild trauma patients [45]. The serum free state of CD5L had been shown to have increased response and expression during LPS-induced lung injury in a mouse model [46].
Based on previous reports, we first examined Cd5l expression in the BLM-induced
fibrotic lung of WT mice, and found that Cd5l expression was gradually elevated
in the lung of BLM-treated mice at 7 and 21 days after BLM-treatment compared to
controls. Consistent with mRNA, Cd5l protein was enriched in the lung of treated
mice (Fig. 2). A novel Cd5l knockout mouse model was generated and an
in vivo model of moderate fibrosis was established. First, we examined a
potential suppressive role for Cd5l played in pulmonary fibrosis has been
verified by pathological assessment. Cd5l knockout results in tissue
inflammation and collagen accumulation. Additionally, both the mRNA and protein
levels of
One could hypothesize that the rise in CD5L during PF is an adaptive response to
lung injury and fibrosis. To answer these questions, flow cytometry performed on
BALF showed that M1 macrophages in Cd5l
CD5L has previously been reported to have an anti-apoptotic effect [19, 24, 51].
We verified the effects of Cd5l on macrophage apoptosis in our mouse model. The
proportion of apoptotic cells were significantly lower in Cd5l
We have shown that Cd5l protects mice from pulmonary fibrosis, but its regulatory signaling mechanisms remain unclear as does its function in inhibiting apoptosis. In future work, we plan to dissect the common signaling crosstalk as more details concerning the previously mentioned pathways and targeted factors need to be uncovered.
In conclusion, our findings demonstrate that CD5 molecule-like (CD5L)-deficiency protected mice from bleomycin-induced lung injury and fibrosis by attenuating the release of inflammatory mediators, regulating macrophages polarization and apoptosis, which could be a viable strategy for the prevention and treatment of pulmonary fibrosis in clinical settings. These findings may provide a sufficient theoretical basis for the clinical application of CD5L and development of novel therapeutics for treating pulmonary fibrosis.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
MZ carried out the molecular genetic studies. YG participated in the design of the study, performed the statistical analysis and drafted the manuscript. RS participated in its design and coordination and helped to draft the manuscript. All authors have participated sufficiently in the work and agreed to be responsible for all aspects of this work. All authors have contributed to editorial changes in the manuscript and have read and approved the final manuscript.
All procedures invovled animal research in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Shanghai Laboratory Animal Research Center (Authorization numbers: 202202002).
Not applicable.
This study was supported by Shanghai Science and Technology Innovation Action Plan (Grant NO. 2214900102).
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
