- Academic Editor
†These authors contributed equally.
Background: Diabetic liver disease is one of the main complications that leads to the aggravation of diabetes, but it has not received sufficient attention. This study aimed to provide a better understanding of the altered molecular networks in in diabetic rats with liver damage after stem cell therapy. To a certain extent, our research would be instructive, since almost no studies of this kind have been performed on patients with diabetic liver disease after stem cell therapy. Methods: Streptozotocin-induced diabetic rats were treated with adipose-derived stem cells. RNA-Seq analysis was performed on the liver tissues of these animals, and key pathway factors were further identified and validated. Results: RNA-Seq analysis revealed numerous affected signaling pathways and functional categories. The results showed that the network of dual specificity phosphatase 1 (DUSP1), an oxidative stress-related gene, was prominently activated in the liver after stem cell therapy, and the enrichment of genes associated with liver damage, steatosis and fibrosis was also detected. The extracellular regulated protein kinase (ERK)/signal transducer and activator of transcription 3 (STAT3) signaling pathway may be involved in this process by regulating the nucleotide-binding and oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasome. Conclusions: These data provide novel insights into liver biology, suggest common alterations in the molecular networks during diabetic liver damage, and show the advantages of stem cell therapy, indicating its further application potential for early treatment of diabetic liver damage and delaying the progression of liver fibrosis in the later stage.
Diabetes mellitus (DM) is one of the most common chronic diseases in the world, and its global prevalence has more than doubled in the past 20 years [1, 2]. The traditional complications of diabetes are well known for their prolonged effects and heavy burdens. Complications were once limited to vascular disease, but advances in diagnosis and treatment have brought complications such as cognitive decline, obstructive sleep apnea, and liver disease into view [3]. Recent studies have shown that among individuals with diabetes worldwide, more than half have nonalcoholic fatty liver disease (NAFLD), and nearly half have nonalcoholic steatohepatitis (NASH) [4]. Liver damage or fibrosis, which are major complications of diabetes, can cause serious and irreversible consequences over time, including liver cirrhosis and liver cancer [5], which may also endanger patient lives. Decades of extensive research and clinical trials have resulted in a detailed protocol for the treatment of these diseases, but the specific mechanism remains unclear, greatly limiting early intervention and the prevention and treatment of complications.
Stem cell injection has been widely used to treat hematological diseases,
autoimmune diseases and other diseases. Furthermore, based on the current
epidemic trend in COVID-19, stem cells have shown great potential in the
prevention and treatment of COVID-19 and related sequelae [6, 7, 8]. In patients
with type 1 diabetes mellitus (T1D)-induced depletion of islet beta cells
(
In recent years, transcriptomic analyses of diabetes models have revealed
multiple possible targets for, which is consistent with our transcriptome
sequencing results. Se novo germline gain-of-function (GOF) mutations can occur
accidentally in the transcriptional regulator signal transducer and activator of
transcription 3 (STAT3), which is one of the rarer causes of diabetes. A specific
class of CD8
Advances in transcriptome analysis are furthering our understanding of diabetes. In the current study, we compared the RNA-seq results of treated and untreated streptozotocin-induced diabetic rats, analyzed the expression status of each factor and identified multiple potentially significant networks. Our data showed the transcriptomic changes and networks in diabetic rats after ADSC treatment, and we further validated the results using the human hepatoma cell line HepG2 in vitro, setting the foundation for further identification of therapeutic targets for diabetic liver damage.
ADSCs were isolated as described previously [11]. In brief, white adipose tissue
from the inguinal region of rats was placed in a digestion solution containing
0.1% collagenase type I and subjected to continuous agitation at 37 °C
for 1 h. The reaction was stopped by the addition of culture medium, and the cell
suspension was centrifuged at 2000 rpm for 10 min. The acquired cells were
resuspended and filtered through 100-µm filters. After being washed
twice, the cellular precipitate was resuspended in cell culture medium and
cultured in 25 mm
All studies were performed in accordance with the National Institute of Health
guidelines and were granted formal approval by the Research Ethics Committee of
Shandong Institute of Endocrine & Metabolic Diseases. Male 8-week-old SD rats
were exposed to 12 h of light/darkness under constant temperature and humidity
and had free access to water and regular food. All of the rats had similar body
weights and growth statuses before streptozotocin (STZ) administration. Twenty
rats were fasted for 16 h (with free access to water) and were then
intraperitoneally injected with 60 mg/kg STZ (#S8050, Solarbio, Beijing, China).
After the injection, the rats were allowed to roam free for three days to
stabilize the results. Fasting blood glucose levels were taken from the tail tip
and measured daily using a glucometer until both blood glucose measurements were
above 16.7 mmol/L. At this time, the rats were diagnosed with STZ-induced
diabetes, which was set as day 0 of the experiment. Fourteen days later, the rats
were randomized again. One group was the ADSC treatment group (ADSC group), and
these rats received 2.0
A TRIzol kit (#15596026, Thermo Fisher Scientific, Waltham, MA, USA) was used to extract total RNA from liver tissue according to the manufacturer’s instructions. The total RNA concentration was determined by a NanoDrop microvolume spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The ratio of OD260 to OD280 was considered an indicator of RNA purity. In addition, we used agarose gel electrophoresis to ensure RNA integrity and exclude gDNA contamination.
RNA-seq analysis was performed by Health Biotechnology (Shanghai, China).
Briefly, the NEBNextTM Ultra II Directional RNA Library Prep Kit was used to
construct sequencing libraries for validation and quantification. The Illumina
HiSeq X platform was then used for 150 bp peer sequencing. The expression level
of each gene was estimated by calculating sequences mapped to reference sequences
(reads), of which the most commonly used method is read per million transcripts
per kilobyte (RPKM). In the DEGseq v1.20.0 software package, the differentially
expressed genes (DEGs) were analyzed using the random sampling (MARS) model.
Differences in gene expression among samples were considered significant when all
of the following conditions were met: fold change (FC)
The human hepatoma cell line HepG2 was provided without
Mycoplasma contamination and authenticated using short tandem repeat (STR)
profiling analysis by Procell Life Science & Technology (Wuhan, China) under the
catalog number CL-0103. The cells were maintained in DMEM supplemented with 10%
fetal bovine serum and 50 U/mL penicillin/streptomycin in an incubator under a
humidified atmosphere of 5% CO
HepG2 cells were plated in 6-well plates at 1
To obtain whole protein extracts, rat livers were treated with lysis buffer
containing protease and phosphorylation inhibitors. The stained membranes were
scanned using the Odyssey CLx imaging system (LI-COR, Lincoln, NE, USA) to
measure the fluorescence at 800 nm and 700 nm. The fluorescence intensity of the
bands was also quantified with the Odyssey CLx imaging system, and the results
are expressed as the fold change relative to the control after normalization to
the respective internal control. Antibodies against P-ERK1/2
(#4370), ERK1/2 (#4695), P-P38 (#4511),
P38 (#8690), P-c-jun N-terminal kinase (JNK) (#9255), JNK (#9252), P-STAT3
(#9145), STAT3 (#9139), GAPDH (#5174) and
Using the QuantiTect Reverse Transcription Kit (QIAGEN, Hilden, Germany), total
RNA in each sample was reverse transcribed into cDNA. Using the Light Cycler
system, the resultant cDNA was used as a template for real-time quantitative PCR.
Nonspecific amplification was used to perform melt curve analysis. The data were
normalized to
Gene symbol | Accession | Forward primer (5 |
Reverse primer (5 |
myelin basic protein (Mbp) | NM_001025289 | CAGCACCGCTCTTGAACACC | TGCCTCCCCAAACACATCACT |
lymphocyte antigen 6 complex, locus A-like (Ly6al) | NM_001128099 | CCATATTTGCCTTCCCGTCT | CAGGATGAACAGAAGCACCC |
acid phosphatase 3 (Acpp) | NM_001134901 | CCAGAACGAGCCCTACCCA | AGAACAAGCAGCAATATCACC |
2 |
NM_001009490 | TCACCTCCCTGCTGACACC | TGTTCGCCCATCACAACCC |
amylase 2a3 (Amy2a3) | NM_031502 | ATGACCCACACACTGCGGATG | TGCACCCCTCCAAATCCCT |
one cut homeobox 1 (Onecut1) | NM_022671 | AATTCAGGCAACTCTTCGTCT | CGTGGTTCTTCCTTCATGCTT |
The gene expression data were input into Ingenuity Pathways Analysis (IPA) software (Ingenuity Systems; https://ingenuity.com/) to establish a causal network. Upstream regulator analysis, downstream effect analysis and mechanistic network analysis were performed to determine likely causal mechanisms, and the p value was network-bias-corrected.
The analyses were performed using Microsoft Excel 2021 and GraphPad Prism 9.0
software (San Diego, CA, USA). The results are reported as the mean
Fig. 1a–d shows that ADSCs had adipogenic and osteogenic differentiation potential and were positive for CD29 and CD90 (90.75% and 95.38%) and negative for the leukocyte antigen CD45 (1.49%). These cells met the criteria for ADSCs. The weekly blood glucose levels and the oral glucose tolerance test (OGTT) results before the rats were sacrificed are shown in Fig. 1e,f. There was no significant change in the blood glucose levels between the two groups; however, the area under the curve (AUC) of the OGTT was reduced in the ADSC group compared to the DM group. Moreover, ADSC treatment alleviated hepatic injury in our previous study [11].
Characteristics of ADSCs and physiological differences
between the two groups. (a) Morphology of ADSCs at Passage 3 (
To examine the effect of stem cell therapy on the transcriptional landscape, we
performed full transcriptome RNA-seq analysis on the liver tissues of those
STZ-induced hyperglycemic rats. Fig. 2a shows liver
transcriptome differences in diabetic rats with or without treatment. With
p
DEGs in the two groups. (a) Heatmap showing DEG levels (2.0 FC,
FDR p
Examining the upregulated gene transcripts into IPA and performing canonical pathway analysis showed that many pathways were activated or inhibited during this process, including the hepatic fibrosis signaling pathway, IL-6 signaling pathway, and insulin receptor signaling pathway, which were significantly enriched (Fig. 2d) and showed the ameliorative effect of stem cell treatment on liver damage, inflammation, and insulin secretion.
IPA of downstream effectors can be used to predict comprehensive increases or decreases in downstream biological activity and gene-related function based on the causal relationship between measured transcriptome level changes and these activities and functions. Supplementary Fig. 1a shows a high level of middle and downstream activity and function in the liver tissue of treated and untreated diabetic rats. Fig. 3 shows multiple functional categories that were enriched, such as liver pathological changes and metabolic disorders, which included liver tissue alterations, cell growth and proliferation disorders, and suggested that stem cells could improve liver function and liver injury in DM. Furthermore, functional categories associated with immune system diseases and endocrine system diseases showed significant alterations. Notably, functional categories associated with hepatotoxicity showed significant upregulation, and there were much greater increases than those associated with nephrotoxicity and cardiotoxicity (Fig. 3b and Supplementary Fig. 1b). Liver toxicity was mainly characterized by liver damage, hepatitis, liver steatosis, liver fibrosis (LF) and other factors (Fig. 3c). Taken together, our data revealed significant decreases in susceptibility to liver damage and DM after stem cell therapy.
Downstream effector analysis of the two groups. (a) The affected diseases and biological function categories based on the tree map in Supplementary Fig. 1a. (b) The top ten most significantly enriched pathways. (c) The affected hepatotoxicity-related functional categories based on the tree map in Supplementary Fig. 1b. The major colored rectangles indicate a family of associated biological functions or diseases; blue indicates a decrease and orange indicates an increase. The sizes (using Fisher’s exact test p value) of the rectangles indicate whether the category is predicted by IPA to increase or decrease significantly between groups; and higher absolute Z scores are represented by color intensities. NAFLD, nonalcoholic fatty liver disease; NASH, nonalcoholic steatohepatitis; ASH, alcoholic steatohepatitis.
Multiple liver-related functional categories were enriched in stem cell-treated
diabetic rats compared to untreated diabetic rats. Among the differentially
enriched categories, liver damage and liver steatosis were the most prominent
(Fig. 3c). Fig. 4a shows a heatmap of the log
Heatmap showing the amelioration of liver damage and liver
steatosis in diabetic rats. Heatmap showing the expression of several
upregulated and downregulated genes related to liver damage (a) and liver
steatosis (b) in eight diabetic rats treated with or without ADSCs. The data are
presented as the log
Moreover, some genes associated with liver steatosis were downregulated in stem cell-treated diabetic rats compared to untreated diabetic rats (Acbd5, Bhlhe40, Casp2, Cnr2, Ddit3, Dnajc7, Egfr, Helz, Ifit2, Il18, Irf3, Isg15, Isg15, Lime1, Nr1i3, Ptpn2, Sirt1, Srsf2, Tp53inp1, Thra, Egfr, Epas1, Foxo1, Gldc, Gna11, Gpam, Insig2, Insr, Klf2, Lrp6, Mapk14, Mboat7, Mgll, Acox1, Adipor2, Atf6, Stk24, Pdpk1 and Plin2; Fig. 4b). Interestingly, our data suggest that the progression of liver damage and hepatic lipid accumulation may be ameliorated by the inhibition of Cnr2, Ddit3, Il18, Irf3, Mapk14, Nr1i3 and Sirt1 following stem cell therapy.
Upstream regulator analysis can predict upstream molecules. Thus, we identified
relevant factors by which stem cell therapy inhibits processes related to liver
damage. IPA was used to predict possible factors, resulting in 30 factors with a
Upstream regulator analysis and mechanistic network analysis predict multiple affected signaling networks. (a) Upstream regulators that are indirectly associated with liver damage. (b) The possible upstream location of DUSP1 was jointly predicted based on changes in factors associated with DUSP1. (c) DUSP1 mechanism network diagram showing its associated mechanism network and possible changes in downstream factors.
Upstream Regulator | |Z score| | p value of overlap |
P38 MAPK | 4.355 | 3.91 |
ZBTB10 | 4.249 | 2.73 |
Eldr | 4.536 | 4.90 |
STRA8 | 3.207 | 7.42 |
CCNDI | 3.200 | 1.02 |
FEV | 4.060 | 3.09 |
SOX2 | 4.076 | 7.02 |
REL | 3.181 | 3.02 |
LEF1 | 3.915 | 2.06 |
STAT4 | 4.618 | 4.69 |
ISL1 | 3.207 | 2.68 |
COPS5 | 3.024 | 1.00 |
INHBA | 3.893 | 2.50 |
CREB1 | 3.095 | 9.25 |
PTGER2 | 3.916 | 1.15 |
APP | 3.091 | 8.21 |
TICAM1 | 4.907 | 3.34 |
MITF | 3.703 | 1.67 |
AHR | 3.543 | 1.76 |
MAPK14 | 3.731 | 4.06 |
KMT2D | 3.805 | 7.16 |
NFKB1 | 3.293 | 3.07 |
ERBB2 | 3.802 | 4.57 |
MEIS1 | 3.148 | 4.13 |
TLR3 | 4.846 | 4.77 |
CBX5 | 3.289 | 2.78 |
DUSP1 | 3.435 | 2.42 |
GRIN3A | 3.335 | 3.05 |
CITED2 | 4.259 | 4.01 |
Upstream regulator analysis of DEGs explained the mechanistic networks
underlying the observed changes in gene expression during stem cell therapy for
DM (Supplementary Fig. 1), including the STAT4 (
By analyzing the factors that were downstream of DUSP1, the functional networks identified by IPA helped us to identify a mechanistic network in which DUSP1 affects multiple functions through multiple factors. The network is shown as genes and biological relationships between the nodes and lines, and nodes with specific shapes indicate the regulatory effect determined by IPA. The first network we identified consisted of the DEGs, their upstream and downstream relationships, and the functional changes that might result (32; as indicated in the legend); in short, this network probably moderates sensory system development (Fig. 6a). The other interesting enriched network moderated the antiviral response (Fig. 6b). Interestingly, we identified DUSP1 as a key hub gene in liver damage and other liver disease networks (Fig. 6c). Furthermore, with the Grow and Path Explorer IPA functions, we confirmed the indirect relationship between DUSP1 expression and numerous liver diseases (Fig. 6d).
Numerous disease-associated enrichment networks in diabetic rats. (a) Schematic of sensory system development and (b) antiviral response functional networks revealed by IPA. In this figure, red indicates activation, while blue indicates suppression. (c,d) DUSP1 is closely related to a variety of liver diseases and lipid metabolism disorders.
However, we also sought to explore the mechanism by which DUSP1 causes liver
damage. The protein encoded by DUSP1 can dephosphorylate mitogen-activated
protein kinase (MAPK), thus playing an important role in multiple pathological
processes. We examined the phosphorylation status of the ERK1/2, P38 and JNK
pathways, which are three pathways that play key roles in glucose metabolism
disorders, in stem cell-treated diabetic rats compared to untreated diabetic
rats. The results showed that the phosphorylation of ERK1/2 was significantly
downregulated in ADSC-treated DM rats (Fig. 7a,c). This finding was further
confirmed in vitro. P-ERK1/2 was increased when HepG2 cells were cultured with
H
Phosphorylation status of the ERK1/2, P38, JNK and STAT3
pathways. (a,c) The phosphorylation of ERK2, P38 and JNK in stem cell-treated
diabetic rats and untreated diabetic rats. An unpaired t test was used to compare
the two groups. (b,d) The phosphorylation of ERK1/2 and STAT3 in HGF- or stem
cell-treated HepG2 cells induced by H
The pathogenesis and pathological processes of diabetes are complex and varied, and organ specificity is obvious, which has not been thoroughly examined thus far [19, 20]. Research on disease-related signaling factors and functional networks by many international research teams has led to the targeted monitoring and treatment of diabetes in clinical practice. Although there have been numerous studies of transcriptional data from diabetic and healthy individuals, few studies have been performed on patients with diabetes after stem cell therapy. Our study investigated the therapeutic effect of ADSC treatment on diabetes-related liver disease, and the results suggested that ADSC treatment may have additional therapeutic effects on diabetes-induced liver injury and identified possible key pathways and important targets in this process.
We performed whole-transcriptome RNA-seq analysis of STZ-induced hyperglycemic rats treated with ADSCs. Furthermore, research into the biology of diabetes has revealed multiple signaling and functional perturbations that occur in response to ADSC therapy during the development of diabetes, showing many important signaling networks in diabetes. Our results revealed the enrichment of genes and pathways according to liver damage, hepatitis, liver steatosis, LF and other hepatic diseases, and changes in the endocrine system and lipid metabolism were also identified. Therefore, we sought to identify relevant factors through which stem cell therapy plays a role in ameliorating liver damage.
Upstream regulator analysis identified DUSP1 as a factor that was significantly
downregulated in the transcriptome. At the top of the hierarchy, mechanistic
network analyses revealed that DUSP1 activated several signaling pathways: the
IL-12 complex, IL-1B, and TNF. Furthermore, silencing DUSP1 in vitro enhanced
TNF-
Liver damage plays a key role in diabetes [28], which led us to further explore
whether DUSP1 was also involved in diabetic liver damage. Our data revealed a
change in DUSP1, suggesting that DUSP1 may be an important upstream factor
affecting diabetic liver damage. A review of previous studies showed that DUSP1
plays different roles in liver damage caused by different etiologies.
Alcohol-induced downregulation of DUSP1 in liver tissue was previously shown to
further enhance TNF-
Mechanistic network analysis showed that the expression of several chemokines (including C-C motif chemokine ligand 4 (CCL4) and C-C motif chemokine ligand 20 (CCL20)) was changed in liver tissue after ADSC treatment compared with untreated diseased tissue. A study showed a potential connection between upregulated CCL4 expression, reduced cholesterol levels in liver tissue and the progression of liver damage, which is consistent with our results [31]. Moreover, massive secretion of CCL20 can activate the p38 MAPK pathway, thereby reducing inflammatory symptoms and improving liver repair in mice [32]. It was also found that inhibiting the chemokine CCL20 reduced immune cell infiltration and extracellular matrix (ECM) production, and ECM production actively promoted NASH progression [33]. In conclusion, altered chemokine expression in liver tissue has multiple consequences, including early liver damage, hepatitis, LF, and even liver cirrhosis.
On the other hand, our results suggest that the activation of another class of proinflammatory mediators, including IL-6, IL-1B, and TNF, has potential inhibitory activity against liver damage. Interestingly, the expression of IL-10, an anti-inflammatory cytokine, was bidirectionally altered in our study, which may indicate a complex mechanism that is active during the treatment of diabetic liver damage. Targeting IL-10 can not only prevent liver damage but also play a role in liver lipid metabolism dysregulation and liver cirrhosis. IL-10, which is preferentially expressed in natural killer cells and can alleviate liver damage to some extent, has been reported to have immunoregulatory effects [34]. Moreover, the receptors for some cytokines were also upregulated, such as Il12rb2. IL-12/IL-23-mediated Th1/Th17 signaling is implicated in the pathogenesis of primary biliary cirrhosis (PBC), and targeting Il12rb2 may alleviate but not reverse the progression of liver damage [35].
In addition to the aforementioned alterations in cytokines and chemokines, we
also screened for specific genetic changes, which were to some extent
corroborated by previous studies. Several reports have suggested that loss of the
protein tyrosine phosphatase 1B (PTP1B) gene inhibits fas expression, which may
contribute to resistance to liver damage and lethality [36], as well as to the
treatment of lipotoxic liver damage [28]. Significant alterations were also found
in MAPK14, an important member of the MAPK family. Despite the dual functions of
MAPK14, in most cases, it has been shown that therapeutic targeting of MAPK14 can
exert anti-inflammatory and antioxidant effects on the liver by increasing the
polarization of M2 macrophages, ultimately facilitating liver regeneration [37, 38]. These factors showed a close correlation with DUSP1 in the functional
network identified by IPA. Then, we explored the possible signaling pathways
regulated by DUSP1. DUSP1 is related to the NLRP3 inflammasome in cerebral injury
[39]. It was reported that mesenchymal stem cell-derived exosomes could block the
malignant behaviors of hepatocellular carcinoma stem cells through the lncRNA
C5orf66-AS1/microRNA-127-3p/DUSP1/ERK axis [40]. In the present study, we found
that ADSCs decreased the phosphorylation levels of ERK1/2 and STAT3 in the livers
of DM rats and in HepG2 cells induced by H
In summary, the data in this study suggest that DUSP1 plays an important role in the therapeutic effect of ADSCs on diabetes and that the effects of proinflammatory mediators such as IL-6, IL-1B, TNF and the NLRP3 inflammasome and anti-inflammatory factors such as IL-10 cannot be ignored. Therefore, our data highlight possible targets for ADSCs in diabetes treatment, and determining whether these targets and the related pathways can add to the current arsenal of treatments for diabetes requires further studies with larger sample sizes and clinical experiments.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XW and DLiu designed the study, acquired funding, reviewed and edited the manuscript. YH and GG performed the research and wrote the manuscript. WD and PW analyzed the data. CL and DLin provided administrative support on the research. CL conducted animal experiments and DLin conducted cell culture and treatments. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content and agreed to be accountable for all aspects of the work in ensuring that questions related to its accuracy or integrity.
The animal study protocol was approved by the Ethics Committee of the Shandong Institute of Endocrine and Metabolic Diseases (2018-008, Oct 2018).
Not applicable.
This work was supported by the China National Natural Science Foundation, grant number 81900736; China Postdoctoral Science Foundation, grant number 2023M732137; Guidelines for Prevention and Intervention of Disability among the Elderly in Shandong Province; Qilu Geriatric Diseases Chinese and Western Academic School Inheritance Workshop Project (No.2022-93-1-10); and Postdoctoral Project of Shandong University of Traditional Chinese Medicine.
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.