Serum samples collected from seven healthy volunteers were stored in aliquots at –80 °C. After a 1:10 dilution in Dulbecco’s phosphate-buffered saline (DPBS, Gibco, Waltham, MA, USA), serum samples were incubated with recombinant renin (1.2 µg/mL, BioVision, Waltham, MA, USA) or phosphate-buffered saline (PBS, Gibco) at 37 °C for 24 h. After incubation, the C3a level of the samples was detected immediately with a Complement C3a Human ELISA Kit (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions.

Immortalized human tubular epithelial cells (human kidney 2 (HK2) cells, CRL-2190, ATCC, Manassas, VA, USA) were routinely cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 (DMEM/F12, Gibco) containing 10% fetal bovine serum (FBS, Gibco) as described previously [26]. The cell lines were mycoplasma-free (Mycoplasma Detection Kit, Yeasen, Shanghai, China) and authenticated by STR identification.

HK2 cells were treated with 10% serum from healthy volunteer 7 (H7) supplemented with recombinant renin (1.2 µg/mL) or PBS at 37 °C for 24 h. Aliskiren (10 µM, MedChemExpress, Monmouth Junction, NJ, USA), a specific renin inhibitor, was preincubated with recombinant renin for 1 h before addition.

A C3a analogue, which has been reported to mimic the natural biological activity of C3a [27, 28], was used to explore the effect of C3a/C3aR activation. HK2 cells were treated with the C3a analogue (1 µg/mL, Sangon Biotech, Shanghai, China) or PBS for 24 h. For C3aR inhibition, cells were pretreated with the C3aR antagonist SB290157 (1 µM, Sigma‒Aldrich, St. Louis, MO, USA) for 1 h. HK2 cells were harvested for western blotting analysis, and the culture medium was used to evaluate the concentration of transforming growth factor $\beta$ (TGF$\beta$) using Human TGF$\beta$ ELISA kits (Proteintech, Wuhan, China) according to the manufacturer’s instructions.

HK2 cells after the treatment were fixed in 4% paraformaldehyde and permeabilized in 0.2% Triton X-100, followed by incubation with 2% BSA for 1 h. The cells were then incubated with PPAR$\alpha$ antibodies (1:100, Thermo Scientific) at 4 °C overnight and subsequently with the Alexa Fluor® 488-conjugated secondary antibody (1:500, Abcam, Discovery Drive, Cambridge, UK) at 37 °C for 45 min. DAPI (1:1000, Sigma‒Aldrich) was used to counterstain cellular nuclei. The cells were observed under a fluorescence microscope. The intensity of PPAR$\alpha$ fluorescence was quantified using ImageJ (version 1.51, National Institutes of Health, Bethesda, MD, USA).

The fatty acid uptake probe in the Fatty Acid Uptake Assay Kit (Dojindo Laboratories, Kamimashiki-gun, Kumamoto, Japan) functions as a fatty acid analogue and shows the cellular uptake capacity of fatty acids directly. MitoBright LT Deep Red (Dojindo Laboratories) can mark the mitochondria. HK2 cells completing the treatment were stained with the fatty acid probe and subsequently with MitoBright LT Deep Red. The cells were observed by confocal microscopy (LSCM, LSM800, Zeiss, Oberkochen, Germany). The colocalization between the fatty acid probe and MitoBright LT Deep Red was measured by ImageJ with the Coloc 2 plugin and presented as Manders’ coefficients.

Three patients with malignant arterionephrosclerosis (MANS) and three patients with benign arterionephrosclerosis (BANS) were included in this study. The study protocol was approved by the Ethics Committee of Ruijin Hospital, Shanghai Jiao Tong University School of Medicine. All of the kidney tissues were obtained from renal biopsies. Informed consent was obtained from all of the patients. Paraffin-embedded kidney sections were prepared for immunofluorescence.

Recombinant rat renin protein (active) (Abcam) and rat C3 protein (Complement Technology, Tyler, TX, USA) were used in the experiment. Purified rat C3 protein (100 µg/mL) was incubated with recombinant rat active renin at concentrations of 0, 1.2, 12.5, and 25 µg/mL at 37 °C for 24 h. After incubation, the sample was mixed with 5$\times$ loading buffer (Beyotime, Shanghai, China) and boiled for 10 min. Samples with equal volume were used to conduct western blotting analysis to detect the cleavage fragment of C3.

Male Sprague‒Dawley (SD) rats weighing 150~170 g were purchased from Charles River Laboratories (Beijing, China) and housed at optimal temperature (22 $\pm$ 2 °C) with a 12-hour light-dark cycle. The animal experiments were approved by the Animal Experiments Ethics Committee of Charles River Laboratories. Rats were acclimated to the housing conditions for 3 days prior to the experiments. For the 2K1C model, the rats were anesthetized with isoflurane (induction: 5%, maintenance: 2%), and the left kidney was exposed through a dorsal flank incision. A U-shaped silver clip with a 0.25 mm inner diameter (Alcott Biotech, Shanghai, China) was placed on the left renal artery. The same surgery was performed on the rats in the sham group but without the clip. The animals were sacrificed at 2 or 4 weeks after the surgery to collect plasma, serum and renal cortex tissue for further analysis.

The C3aR antagonist SB290157 was used to inhibit C3a/C3aR signaling activation in vivo. SB290157 was intraperitoneally injected into rats at a dose of 3 mg/kg per day for 4 weeks after the surgery. The nondrug-treated groups received an equal volume of vehicle at the same time.

The tail artery blood pressure of rats was measured at different time points (before the surgery and 2 weeks and 4 weeks after the surgery) using the BP-2000 Blood Pressure Analysis System (Visitech Systems, Apex, NC, USA). Prior to the measurement, all rats were acclimated in restraints. The blood pressure of each rat was determined by averaging 3 records.

Plasma samples were collected from rats using EDTA-coated Eppendorf tubes. The concentration of renin in plasma was measured using a Renin Assay Kit (Fluorometric) (Abcam). For acquiring kidney tissue homogenates, a piece of kidney cortex tissue from each sample was weighed. We added PBS (tissue weight (g): PBS volume (mL) = 1:9) and two beads to to each vail containing the sample and homogenized the tissue at 60 Hz for 30 s for three times with Tissue Grinders (Jingxin, Shanghai, China) to obtain tissue homogenates. The homogenates were centrifuged 5000 $\times$g at 4 °C for 10 min to obtain the supernatant. The concentrations of C3a in plasma and kidney tissue homogenates were measured using a Rat C3a ELISA Kit (Elabscience), according to the manufacturer’s instructions.

The level of serum creatinine (Scr) was determined by using a liquid chromatography-tandem mass spectrometry (LC‒MS/MS) method according to the manufacturer’s instructions. The severity of tubular damage was assessed by two nephrologists in a blinded manner after observing whole kidney sections by hematoxylin-eosin (H&E) staining. Tubular damage was scored from 0 to 4 according to the distribution of lesions as follows: 0, no lesions; 1, less than 25%; 2, 25–50%; 3, 50%–75%; and 4, more than 75%. Renal tubulointerstitial fibrosis was quantified as the percentage of blue area per field in Masson’s trichrome-stained sections using ImageJ, and ten fields of view for each sample were used to collect the data.

The renal cortex tissue and cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (Sigma‒Aldrich) containing a protease/phosphatase inhibitor cocktail (NCM Biotech, Jiangsu, China). The protein concentration of the samples was measured with a bicinchoninic acid assay (BCA) protein quantitation kit (Beyotime). Equal amounts of protein (20 µg for cells and 30 µg for tissues) were separated via 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane. After incubation in fast blocking buffer (EpiZyme, Shanghai, China), the membrane was incubated with the following primary antibodies at 4 °C overnight: anti-C3aR (1:1000, Bioss, Beijing, China), anti-C3/C3b (1:2000, Abcam), anti-TGF$\beta$ (1:1000, Proteintech), anti-PPAR$\alpha$ antibodies (1:1000, Thermo Scientific), anti-carnitine palmitoyltransterase-1alpha (CPT-1$\alpha$,1:5000, Proteintech), anti-$\alpha$-smooth muscle actin ($\alpha$-SMA, 1:4000, Sigma‒Aldrich) and anti-GAPDH (1:5000, Proteintech). After 3 washes, the membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:2500, Cell Signaling Technology, Danvers, MA, USA) at room temperature for 1 h. The visualized signal bands were measured using enhanced chemiluminescence (EpiZyme) through a chemiluminescence imaging system (Tanon, Shanghai, China). The intensity of the bands was determined with ImageJ. Target protein levels were normalized to GAPDH and expressed as fold change relative to the control group.

Total RNA from renal cortex tissues and cells was extracted using the FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Jiangsu, China). Complementary DNA was generated using the HiScript® III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme), and qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme). The specific primers used were as follows: Rat REN (F) GATCACCATGAAGGGGGTCTCTGT (R) GTTCCTGAAGGGATTCTTTTGCAC; Rat C3aR (F) AGGCAATGGGCTGGTGCTGT (R) CAGGAAGACACTGGCAAACAT; Rat $\alpha$-SMA (F) ACCATCGGGAATGAACGCTT (R) CTGTCAGCAATGCCTGGGT; Rat TGF$\beta$ (F) ATACGCCTGAGTGGCTGTCT (R) TGGGACTGATCCCATTGATT; Rat CD68 (F) TGTTCAGCTCCAAGCCCAAA (R) GCTCTGATGTCGGTCCTGTTT; and Rat GAPDH (F) GCCTTCCGTGTTCCTA (R) AGACAACCTGGTCCTCA. Data were expressed as an amplification number based on 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$ normalized to GAPDH and compared with controls.

The renal cortex tissues were cut into 1 mm${}^3$ sections and fixed in 2.5% glutaraldehyde. The tissues were then fixed in 1% osmium tetroxide, dehydrated in a graded ethanol series, embedded in hard resin and sectioned into ultrathin slices (80 nm) using an ultramicrotome (Leica, Wetzlar, Germany). The slices were then stained with uranyl acetate and lead citrate before being observed. We focused on observing lipid droplets in tubular epithelial cells.

The kidneys were fixed in 4% paraformaldehyde, embedded in paraffin and cut into 4-µm-thick sections. After dehydration and antigen retrieval by EDTA (pH 9.0) under high temperature and high pressure, the kidney sections were then incubated with the following primary antibodies at 4 °C overnight: anti-E-cadherin (E-cad) antibody (1:4000, TSA, Proteintech), anti-C3aR antibody (1:100, Bioss), anti-CD68 antibody (1:200, Servicebio, Wuhan, China), anti-$\alpha$-SMA antibody (1:200, Sigma‒Aldrich), anti-PPAR$\alpha$ antibodies (1:100, Thermo Scientific) and anti- aquaporin 1 (AQP1) antibodies (1:200, Abcam). The kidney sections were then incubated with secondary antibodies at 37 °C for 45 min. For TSA staining, the sections were additionally incubated with FITC-tyramide solution protected from light for 10 min. DAPI was used to counterstain cell nuclei. The kidney sections were observed under a fluorescence microscope. The fluorescence intensity of C3aR, PPAR$\alpha$ and the CD68% positive area of each sample were determined by ImageJ. Five fields of view of each sample from patients and ten fields of view of each sample from rats were used for analysis. Fields of view at 200$\times$ magnification were located in the renal cortex and chosen randomly under the microscopy. After acquiring the images of the specific channel, the images were converted to an 8-bit image and the positive area was included by setting a certain threshold. After selecting “Limit to Threshold” option in the “Set Measurements”, the mean fluorescence intensity and the percentage of positive area could be quantified using ImageJ [29]. The fluorescence intensity of each sample was determined by averaging the data from five or ten images. The mean intensity of the control group in each experiment was used as a reference in the statistical analysis. The colocalization of PPAR$\alpha$ and nuclei was measured by ImageJ with the Coloc 2 plugin and presented as Manders’ coefficients.

The distribution of data were exiamined by Shapiro-Wilk test. The values for each parameter were expressed as the mean $\pm$ SEM. Statistical analysis were performed using GraphPad 8.0 (GraphPad Software, La Jolla, CA, USA). Two-tailed, unpaired Student’s t tests were used when comparing two groups. One-way ANOVA followed by Tukey’s multiple comparisons test was used to compare the differences between groups when there were more than two groups. Paired t tests were performed to analyze the differences between the serum-recombinant human renin incubation groups and the serum-PBS incubation groups. p 0.05 was considered statistically significant.

Serum from seven healthy volunteers was collected and incubated with recombinant human renin or PBS. As shown in Table 1, the C3a concentration in serum incubated with recombinant renin increased significantly compared to that in the same samples incubated with PBS (with renin 922.16 $\pm$ 312.90 ng/mL vs. with PBS 561.52 $\pm$ 156.54 ng/mL, t = 2.989, p = 0.024). The median level of $△$C3a (C3a concentration with renin-C3a concentration with PBS) in these samples was 198.56 (134.46, 810.24) ng/mL.

As C3aR is mainly expressed in TECs, we used serum from H7 incubated with human recombinant renin to stimulate HK2 cells and investigated the change in C3aR. As shown in Fig. 1A, treatment with serum incubated with recombinant renin significantly increased the protein level of C3aR in HK2 cells. The addition of aliskiren, a renin inhibitor, reversed the change in C3aR protein levels.

Fig. 1.

Renin induces C3aR expression in renal tubular epithelial cells. (A) Representative western blotting images and summarized data showing the effect of renin-incubated serum and aliskiren intervention on C3aR protein levels in HK2 cells. N = 3, by one-way ANOVA. (B) Representative immunofluorescence staining images of C3aR and E-cad in kidney sections of recruited patients with MANS and BANS (200$\times$; scale bar, 100 µm; the right panel shows magnified images of the boxed areas in the left panel, arrow, positive staining of C3aR) and summarized relative mean intensity of C3aR fluorescence. MANS, malignant arteriolonephrosclerosis; BANS, benign arteriolonephrosclerosis; N = 3, by independent t test. ${}^{\text{ns}}$p $>$ 0.05, *p 0.05, **p 0.01.

To further validate the results in human kidneys, we performed immunofluorescence staining of C3aR in kidney samples from 6 hypertensive patients who underwent renal biopsy. Among them, 3 were diagnosed with BANS and 3 were diagnosed with MANS. Compared to patients with BANS, the patients with MANS were characterized by higher Scr, lower eGFR, higher renin activity and more severe tubulointerstitial fibrosis (Table 2). The results revealed areas with high C3aR expression in tubular epithelial cells (marked by E-cad) in patients with MANS (Fig. 1B). The relative fluorescence intensity of C3aR (Fig. 1B), as well as the plasma renin activity in MANS patients (with MANS 2.49 $\pm$ 0.62 ng/mL vs. with BANS 0.36 $\pm$ 0.17 ng/mL, t = 5.716, p = 0.005), was markedly higher than that in patients with BANS (Table 2). Pearson analysis revealed that the relative fluorescence intensity of C3aR was positively correlated with renin activity levels in these patients (r = 0.859, p = 0.029, data not shown). These results indicated that human renin could activate C3a/C3aR signaling in human tubular epithelial cells during the progression of hypertension.

Although renin can cleave serum C3 into C3a, it can also catalyze angiotensinogen to generate angiotensin II, which also influences the downstream signaling of C3aR [30]. To avoid the effect of angiotensin II, we used a C3a analogue that has been reported in previous studies in the following experiments.

The C3a analogue also significantly increased the C3aR protein level in HK2 cells (Fig. 2A). Notably, the C3a analogue triggered the synthesis of TGF$\beta$, a classic profibrotic factor, and promoted its secretion (Fig. 2A,B). The C3a analogue reduced the protein levels of PPAR$\alpha$, the key regulator of Mito FAO, as well as that of CPT-1$\alpha$, the rate-limiting enzyme of Mito FAO in HK2 cells (Fig. 2C). Immunocytochemistry staining results also revealed decreased PPAR$\alpha$ expression in HK2 cells upon treatment with the C3a analogue (Fig. 2D). Additionally, the colocalization between the fatty acid probe and Mito tracker was decreased in HK2 cells treated with the C3a analogue, indicating a reduction in the mitochondrial uptake of fatty acids for FAO (Fig. 2E). Pretreatment of HK2 cells with the C3aR antagonist SB290157 blocked the effect induced by the C3a analogue, as indicated by a decrease in C3aR and TGF$\beta$ protein levels, an increase in PPAR$\alpha$ and CPT-1$\alpha$ protein levels and an increase in mitochondrial uptake of fatty acids (Fig. 2). These results suggested that the activation of C3a/C3aR signaling could inhibit PPAR$\alpha$/CPT-1$\alpha$-mediated tubular Mito FAO and induce TECs transformation into a profibrotic phenotype, whereas SB290157 attenuated tubular changes by targeting C3aR.

Fig. 2.

The C3aR antagonist SB290157 mitigates the C3a analogue-induced profibrotic phenotype transition and Mito FAO inhibition in HK2 cells. (A) Representative western blotting images and summarized data of C3aR and TGF$\beta$ protein levels in HK2 cells treated with PBS, DMSO, SB290157 (1 µM, 1 h) and C3a analogue (1 µg/mL, 24 h) according to the group. (B) Summarized data of relative TGF$\beta$ levels (corrected by BCA) in the medium of HK2 cells treated with PBS, DMSO, SB290157 (1 µM, 1 h) and C3a analogue (1 µg/mL, 24 h) according to the group. N = 6. (C) Representative western blotting images, summarized data of PPAR$\alpha$ and CPT-1$\alpha$ protein levels of HK2 cells treated with PBS, DMSO, SB290157 (1 µM, 1 h) and C3a analogue (1 µg/mL, 24 h) according to the group. N = 6. (D) Representative immunofluorescence staining images of PPAR$\alpha$ (200$\times$, scale bar, 100 µm) and summarized data of relative mean intensity of PPAR$\alpha$ fluorescence in HK2 cells treated with PBS, DMSO, SB290157 (1 µM, 1 h) and C3a analogue (1 µg/mL, 24 h) according to the group. N = 6. (E) Representative images of the fatty acid probe and Mito tracker (400$\times$, scale bar, 50 µm) and summarized data of Mander’s coefficients in HK2 cells treated with PBS, DMSO, SB290157 (1 µM, 1 h) and C3a analogue (1 µg/mL, 24 h) according to the group. N = 3. ${}^{\text{ns}}$p $>$ 0.05, *p 0.05, **p 0.01, ***p 0.001 by one-way ANOVA.

Renin is a species-specific enzyme. No evidence has shown whether rat renin can cleave C3 in rats. Before performing the validation experiments in vivo, we carried out western blotting analysis to detect the effect of rat renin on rat C3. Interestingly, western blotting analysis showed that the level of C3 cleavage increased as the concentration of renin increased, as indicated by the increasing contents of iC3b and C3c, two C3 cleavage fragments (Fig. 3A). Slight increases in the contents of iC3b and C3c were detected when purified rat C3 protein was incubated with rat recombinant renin at 1.2 µg/mL and 12.5 µg/mL, but not statistically significant. Statistical analysis showed that renin-mediated C3 cleavage reached its highest level with 25 µg/mL renin (Fig. 3B,C). The above results demonstrated that rat renin could cleave C3.

Fig. 3.

Coincubation with recombinant rat renin increases the cleavage fragments of C3. (A) Representative western blotting images, summarized data of (B) iC3b and (C) C3c protein levels showing C3 cleavage after incubation with recombinant rat renin at 0, 1.2, 12.5 or 25 µg/mL. r-Renin, recombinant rat renin. N = 3, ${}^{\text{ns}}$p $\mathrm{>}$ 0.05, *p 0.05, ***p 0.001, vs. PBS, by one-way ANOVA.

Renin-dependent hypertension 2K1C rat model was used for in vivo experiments. As shown in Fig. 4A, the blood pressure (BP) of 2K1C rats was significantly elevated at 2 weeks (170 $\pm$ 7/112 $\pm$ 9 mmHg) and progressed to 205 $\pm$ 15/137 $\pm$ 14 mmHg at 4 weeks after the surgery, while the BP of the sham group remained at approximately 120/50 mmHg during this period. No difference in Scr levels was found in 2K1C rats at 2 weeks compared to that of the sham group; however, at 4 weeks, the Scr levels in 2K1C rats significantly increased compared with those in sham group (Fig. 4B). Based on its higher BP and Scr levels, 4 weeks was chosen as the time point for the following experiments.

Fig. 4.

Tubulointerstitial injury, renin mRNA and C3a concentration in the clipped kidney cortex of 2K1C rats. (A) Summarized data of blood pressure, (B) Scr levels, (C) plasma renin concentration and (D) plasma C3a concentration in sham rats and 2K1C rats. (E) Summarized data of relative REN mRNA expression and (F) C3a concentration in the renal cortex in sham rats and 2K1C rats. N = 4 per group, by one-way ANOVA. (G) Representative H&E staining images, (H) summarized data of tubular damage scores, (I) representative Masson staining images and (J) summarized data of collagen volume fraction of the kidney cortex in sham rats and 2K1C rats (clipped kidney) (200$\times$; scale bar, 100 µm; the right panel shows magnified images of the boxed areas in the left panel; blue arrow, atrophic tubule; red arrow, injured tubule; black arrow, fibrosis foci). SBP, systolic blood pressure; DBP, diastolic blood pressure; Scr, serum creatinine; N = 4 per group, by independent t test. ${}^{\text{ns}}$p $>$ 0.05, *p 0.05, **p 0.01, ***p 0.001.

As shown in Fig. 4C, the plasma renin concentration of 2K1C rats increased markedly at 4 weeks (2K1C 18.00 $\pm$ 5.18 ng/mL vs. sham 9.61 $\pm$ 2.06 ng/mL, p 0.05). However, no difference in plasma C3a levels was found between the two groups (Fig. 4D, 2K1C 336.6 $\pm$ 55.3 ng/mL vs. sham 339.9 $\pm$ 101.5 ng/mL, p $>$ 0.05). RT‒qPCR results showed a marked increase in renin mRNA levels in the clipped kidney tissues but not the nonclipped side of 2K1C rats (Fig. 4E). ELISA experiments also showed a significant increase in C3a levels in clipped kidney tissues but not in nonclipped kidney tissues (Fig. 4F). H&E staining showed that the clipped kidneys of 2K1C rats exhibited extensive tubulointerstitial injury compared with those of the rats in the sham group, with more tubular atrophy and dilation, more cast formation, more extensive inflammatory cell infiltration and higher tubular damage score (Fig. 4G,H). Masson’s trichrome staining showed that the clipped kidneys of 2K1C rats manifested more collagen deposition and fibrosis foci, as evaluated by collagen volume fraction analysis (Fig. 4I,J).

After 4 weeks of 2K1C, the protein levels of C3aR and $\alpha$-SMA (a marker of myofibroblasts) were markedly upregulated in the clipped kidneys of 2K1C rats (Fig. 5A). RT‒qPCR results also showed an increase in the mRNA levels of C3aR, $\alpha$-SMA, TGF$\beta$ and macrophage marker CD68 (Fig. 5B). These results suggested that C3a/C3aR signaling was activated in the clipped kidneys of rats with renovascular hypertension.

Fig. 5.

C3aR and mesenchymal transition markers increase in the kidney cortex of 2K1C rats. (A) Representative western blotting images, summarized data of C3aR and $\alpha$-SMA protein levels and (B) summarized C3aR, $\alpha$-SMA, TGF$\beta$ and CD68 mRNA levels in the renal cortex in sham rats and 2K1C rats (clipped kidney). N = 4 per group. *p 0.05, **p 0.01 by independent t test.

Treatment with the C3aR antagonist SB290157 did not influence the BP of 2K1C rats at 4 weeks after surgery (Fig. 6A). The renin mRNA or C3a level in the clipped kidneys of 2K1C rats was also not influenced by SB290157 (Fig. 6B,C). Of note, tubular injury and interstitial fibrosis in the clipped kidneys of 2K1C rats were attenuated by SB290157 treatment, as indicated by reduced Scr, decreased tubular damage scores and reduced collagen deposition (Fig. 6D–H). The protein levels of C3aR, TGF$\beta$ and $\alpha$-SMA were obviously increased in the clipped kidneys of 2K1C rats, while the treatment with SB290157 reduced these protein levels (Fig. 7A,B). Similar to the protein changes, the mRNA levels of C3aR, $\alpha$-SMA and TGF$\beta$ were also decreased in SB290157-treated 2K1C rats compared to vehicle-treated 2K1C rats (Fig. 7C). The increased colocalization of $\alpha$-SMA with CD68 in the clipped kidney cortex of 2K1C rats was mitigated by SB290157 treatment (Fig. 7D). These results revealed the ability of SB290157 to inhibit renovascular hypertension-induced tubulointerstitial fibrosis by blocking C3a/C3aR signaling.

Fig. 6.

The C3aR antagonist SB290157 alleviates tubulointerstitial fibrosis in 2K1C rats. (A) Summarized blood pressure and (D) Scr levels in sham+vehicle, 2K1C+vehicle and 2K1C+ SB290157 rats. N = 6 per group. (B) Summarized REN mRNA levels and (C) C3a concentration in the renal cortex in sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 6 per group. (E) Representative H&E staining images, (F) summarized tubular damage scores, (G) representative Masson staining images and (H) summarized collagen volume fraction of the renal cortex in sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats (200$\times$; scale bar, 100 µm; the lower panel shows magnified images of the boxed areas in the upper panel). N = 6 per group. ${}^{\text{ns}}$p $>$ 0.05, *p 0.05, **p 0.01, ***p 0.001 by one-way ANOVA.

Fig. 7.

The C3aR antagonist SB290157 reduces C3aR expression and mesenchymal transition in 2K1C rats. (A) Representative western blotting images and (B) summarized data of C3aR, $\alpha$-SMA and TGF$\beta$ protein and (C) mRNA levels of the renal cortex in sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 6 per group. (D) Representative immunofluorescence staining images of $\alpha$-SMA and CD68 (400$\times$; scale bar, 50 µm; white triangles, colocalization of $\alpha$-SMA and CD68) and summarized data of relative CD68-positive area (%) and CD68${}^{+}$$\alpha$-SMA${}^{+}$ cell counts per field in the renal cortex of sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 3 per group, *p 0.05, **p 0.01, ***p 0.001 by one-way ANOVA.

Under TEM, a higher abundance of lipid droplets was found in the proximal TECs of the clipped kidneys of 2K1C rats. Treatment with SB290157 reduced the accumulation of lipid droplets in the proximal TECs in 2K1C rats (Fig. 8A). The protein levels of PPAR$\alpha$ and CPT-1$\alpha$ were decreased significantly in the clipped kidneys of 2K1C rats (Fig. 8B). Accordingly, a noticeable decrease in the colocalization of PPAR$\alpha$ with nuclei in TECs (marked by AQP1) was observed in the clipped kidneys of 2K1C rats (Fig. 8C). These changes were significantly alleviated by SB290157 treatment, as indicated by the restoration of PPAR$\alpha$ and CPT-1$\alpha$ protein levels and the increased nuclear localization of PPAR$\alpha$ (Fig. 8).

Fig. 8.

The C3aR antagonist SB290157 restores PPAR$\alpha$/CPT-1$\alpha$-mediated tubular Mito FAO. (A) Representative TEM images of proximal TECs (8000$\times$; scale bar, 2 µm; the lower panel shows magnified images of the boxed areas in the upper panel; yellow arrows, lipid droplet) in the renal cortex of sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 3 per group. (B) Representative western blotting images and summarized PPAR$\alpha$ and CPT-1$\alpha$ protein levels in the renal cortex of sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 6 per group. (C) Representative immunofluorescence staining images of PPAR$\alpha$ and DAPI (200$\times$; scale bar, 100 µm; TECs marked by AQP1 with green fluorescence), summarized data of relative mean intensity of PPAR$\alpha$ fluorescence and Mander’s coefficients of PPAR$\alpha$ and DAPI in the renal cortex of sham+vehicle, 2K1C+vehicle (clipped kidney) and 2K1C+SB290157 (clipped kidney) rats. N = 3 per group. *p 0.05, **p 0.01, ***p 0.001 by one-way ANOVA.