- Academic Editor
Background: Disease risk variants are likely to affect gene expression in a context- and cell-type specific manner. The membrane bound O-acyltransferase domain containing 7 (MBOAT7) rs8736 metabolic-dysfunction-associated fatty liver disease (MAFLD)-risk variant was recently reported to be a negative regulator of toll-like receptors (TLRs) signalling in macrophages. Whether this effect is generic or cell-type specific in immune cells is unknown. Methods: We investigated the impact of modulating TLR signaling on MBOAT7 expression in peripheral blood mononuclear cells (PBMCs). We also examined whether the rs8736 polymorphism in MBOAT7 regulates this effect. Furthermore, we measured the allele-specific expression of MBOAT7 in various immune cell populations under both unstimulated and stimulated conditions. Results: We show that MBOAT7 is down-regulated by TLRs in PBMCs. This effect is modulated by the MBOAT7 rs8736 polymorphism. Additionally, we provide evidence that MBOAT7 acts primarily as a modulator of TLR signalling in mononuclear phagocytes. Conclusion: Our results highlight the importance of studying Genome-Wide Association Studies (GWAS) signals in the specific cell types in which alterations of gene expression are found.
Metabolic dysfunction–associated fatty liver disease (MAFLD) is the leading cause of chronic liver disease and its complications. MAFLD is characterized by substantial phenotypic heterogeneity mediated by inter-individual genetic variations interacting with a variety of environmental cues. This results in the well described disparate clinical presentations and outcomes [1, 2, 3, 4].
Although numerous genetic variants have been linked to the susceptibility to human diseases such as MAFLD, the overwhelming majority of these variants occur in non-coding portions of the genome. This suggests that they function locally to modify gene expression. Given that cis-regulatory areas often exhibit strong cell type specificity, it is probable that disease-associated mutations will impact gene expression in a manner that depends on the cellular context, specifically affecting a certain population of cell types inside the body [5, 6]. The lack of association between identified risk single nucleotide polymorphisms (SNPs) in non-coding genes and the specific cell types in which they impact function has greatly impeded the advancement of functional investigations focused on determining the biological impacts of Genome-Wide Association Studies (GWAS) SNPs [7]. Hence, identifying the exact cell types in which disease risk variations alter gene expression may facilitate mechanistic and functional investigations into the genetic underpinnings of certain diseases [8, 9].
A genetic variant in the membrane bound O-acyltransferase domain containing 7 (MBOAT7) gene has been identified through GWAS and candidate gene studies. This specific genetic variation has been found to have a significant impact on inflammation and fibrosis in various types of liver diseases, including alcoholic fatty liver disease, MAFLD, and viral hepatitis [10, 11, 12].
Our recent research has revealed that MBOAT7 acts as a negative regulator of Toll-Like Receptor (TLR) signaling in macrophages, and that this function is modulated by the MBOAT7 rs8736 (T) variant, which increases the risk of developing MAFLD [13].
MBOAT7 is expressed in immune cells [10], and given the involvement of various immune cell populations in MAFLD pathogenesis [14, 15], it is important to determine whether the effects of the MBOAT7 rs8736 variant on gene regulation are constitutive or cell-specific. To this end, we aim to investigate the precise subtypes of immune cells that are affected by the genetic effects of MBOAT7 on gene expression regulation.
Volunteer blood was used to isolate peripheral blood mononuclear cells (PBMCs) by employing Ficoll Paque Plus (GE Healthcare, Chicago, IL, USA). CD4, CD8, CD56, CD14, CD20 isolations were performed using specific Kits as per manufacturer procedures (STEMCELL Technologies, Vancouver, British Columbia, Canada).
A human TLR ligand kit was obtained from Invivogen (tlrl-kit1hw, Invivogen, San Diego, CA, USA). Each individual ligand was diluted as per the manufacturer’s instructions, and the cells were subsequently challenged by administering a standard concentration of 100 ng/mL of Pam3CSK4 (a TLR2 ligand), 100 ng/mL of Poly (I:C) (a TLR3 ligand), 500 ng/mL of Lipopolysaccharide (LPS) (a TLR4 ligand), and 100 ng/mL of CpG DNA (a TLR9 ligand), as previously described [13, 16]. After 24 hours treatment, cells were harvested for RNA extraction and supernatants collected for further analysis.
RNA extraction and the real-time polymerase chain reaction (RT-PCR) analysis were done as described previously. RNA extraction was performed using the Qiagen miRNeasy Mini Kit (217004, QIAGEN, Hilden, Germany), following the instructions provided by the manufacturer.
The real-time PCR analysis were performed on the Applied Biosystems (Waltham, MA, USA). TaqMan Fam labelled expression probes and the TaqMan™ Fast Advanced Master Mix (4444965, Thermo Fisher Scientific, Waltham, MA, USA) were used. Alternatively, forward and reverse primers specific to the MBOAT7 gene (For: CATGCGGTACTGGAACATGA Rev: CCAGTAGGCGCTCAGCAG) were used in combination with SYBR Select Master Mix from Applied Biosystems (4312704, Applied Biosystems, Waltham, MA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression using specific primers (For: AAGGTGAAGGTCGGAGTCAAG Rev: GGGGTCATTGATGGCAACAATA) was used a control. The expression level was quantified by measuring the CT values and normalizing them to the CT value of GAPDH.
The supernatant was analyzed for TNF-
Genotyping for MBOAT7 rs8736 was performed using TaqMan genotyping probe (catalogue number 4351376), according to protocol provided by the manufacturer (Applied Biosystems®), as described previously [17].
Allele specific expression was measured the ratio of genomic DNA (gDNA) and complementary DNA (cDNA) from 10 individuals who were heterozygous for the variant using RT-PCR.
The expression of MBOAT7 mRNA was evaluated in 19 human tissues using a TissueScan Human Normal cDNA Array (Origene, Rockville, MD, USA), and human primary (hepatocytes, hepatic stellate cells, and hepatic sinusoidal endothelial cells) (ScienceCell) by RT-PCR. Additionally, PBMCs were also included in the analysis, following the previously reported methodology [18].
We first assessed the expression of MBOAT7 across panels of human tissues and cells. Although we can identify MBOAT7 ubiquitously, although it shows different expression levels across various human tissues (Fig. 1a). MBOAT7 is most strongly expressed in circulating PBMCs at a cellular level, with approximately 7 times higher expression compared to different subsets of liver cells namely, hepatocytes, sinusoidal endothelial cells, or hepatic stellate cells (Fig. 1b) [19].
Fig. 1.MBOAT7 expression in Various Human Tissues and Cells. (a) Expression of MBOAT7 mRNA in 19 human tissues. (b) MBOAT7 mRNA expression in human primary hepatic cell types and PBMCs. Gene expression was assessed by RT-PCR and normalized to GAPDH. MBOAT7, membrane bound O-acyltransferase domain containing 7; PBMCs, peripheral blood mononuclear cells; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Our recent study shown that MBOAT7 functions as a suppressor of TLR signaling in macrophages [13]. Herein, we investigated the impact of TLR signaling modulation on MBOAT7 expression in PBMCs. MBOAT7 expression was significantly down-regulated upon stimulation of TLR4 with lipopolysaccharide (Fig. 2a), an effect that was abolished by pharmacological TLR4 inhibition using TAK-242, confirming the specificity of this effect (Fig. 2b).
Fig. 2.PBMCs from rs8736 heterozygous carriers (n = 7). (a) were left
untreated or challenged with LPS and/or (b) a specific TLR4 inhibitor (TAK-242),
(c) challenged with (Pam3Cys4 [TLR1/2], Poly (I:C) [TLR3], and CpG [TLR9]) for 24
hours. MBOAT7 mRNA expression analyzed by PCR and normalized to GAPDH. Values are
means with Standard Error of the Mean (SEM) depicted as vertical bars.
ns, not significant, *p
We next examined whether the MBOAT7 expression differences were specific to TLR4 or spanned other toll-like receptors (TLRs) ligands. Repression of MBOAT7 in response to stimulation of TLRs TLR1/2 and TLR9 was observed, but not in response to TLR3 (Fig. 2c).
The rs8736 polymorphism in MBOAT7 has been linked with the entire spectrum of MAFLD [12] and we recently found it to regulate MBOAT7 effects on TLR signalling in macrophages [13]. Therefore, we investigated whether the expression of MBOAT7 in PBMCs is controlled in a genotype-dependent way in response to TLR signaling. We thus conducted an experiment where we stimulated PBMCs obtained from healthy individuals, then genotyped these cells for a specific genetic variant called rs8736. Next, we used an allele-specific test to analyze the expression levels in individuals who were heterozygous for the rs8736 variant, which is associated with MAFLD. This experiment was conducted under basal conditions and following stimulation of TLRs. At baseline, individuals with the rs8736 TT genotype exhibited lower levels of MBOAT7 mRNA expression in their PBMCs compared to individuals with the CC genotype (Fig. 3a); this differential effect was further enhanced on TLRs stimulation (Fig. 3b). Thus, MBOAT7 expression attenuates upon TLRs challenge, while PBMCs from rs8736 T risk carriers express less MBOAT7 of the levels observed in CC carriers.
Fig. 3.Allele-specific expression was evaluated in PBMCs obtained from
subjects who were heterozygous carriers of rs8736. The PBMCs were either (a)
unstimulated or (b) stimulated for 24 hours with various doses of Pam3Cys4
(recognized by TLR1/2), Poly (I:C) (recognized by TLR3), LPS (recognized by TLR4),
and CpG (recognized by TLR9). (c) The secretion of TNF-
We investigated if the rs8736 polymorphism in MBOAT7, which is linked to MAFLD,
affects the downregulation of MBOAT7 in PBMCs by TLRs in a genotype-dependent
manner. Specifically, we examined whether the cytokine secretion triggered by
TLRs in primary human PBMCs is influenced by the MBOAT7 genotype. In line with
the reduced MBOAT7 expression in PBMCs of individuals with the rs8736 TT risk
genotype, those with the rs8736 T risk genotype produced a higher amount of
TNF-
In order to identify the specific cell type accountable for the variations in cytokine production, we undertook the isolation of monocytes, T-cells (CD4 and CD8), B-cells (CD20), and NK-cells (CD56), which were subsequently exposed to LPS. We quantified the allele-specific expression of MBOAT7 under both unstimulated and stimulated conditions. Monocytes derived from individuals with the rs8736 TT genotype exhibited lower levels of MBOAT7 mRNA compared to individuals with the CC genotype, both under normal conditions (Fig. 4a) and when stimulated with TLR4 (Fig. 4b). NK cells exhibited a contrasting trend; cells derived from individuals with the rs8736 TT genotype displayed elevated levels of MBOAT7 mRNA compared to individuals with the CC genotype, both at baseline and upon TLR4 stimulation. There was no noticeable variation in allele-specific expression between T- and B cells before and after TLR4 stimulation, as shown in Fig. 4a,b.
Fig. 4.Allele-specific expression was analyzed in B cells, CD4
MAFLD has a substantial heritable component. Nevertheless, most known risk variants explain only a small fraction of heritability and SNPs linked to MAFLD are mainly located in noncoding regions of the genome that include a high concentration of enhancer elements. These enhancer elements are frequently unique to distinct cell types [20]. The current challenge lies in establishing the connection between disease-associated regions and the genes they impact, as well as determining the precise cell types where there is variation in gene expression and the direction of these effects. This then will allow us to identify the specific mechanisms and biological pathways involved in patients who are genetically vulnerable. SNPs in the MBOAT7 gene have been associated with an increased risk of inflammation and fibrosis in viral and non-viral liver diseases [10, 11, 12]. MBOAT7 is highly expressed in various types of immune cells and was recently found to regulate the signalling of TLR-induced pro-inflammatory genes in macrophages [13]. Nevertheless, the precise immune cell subtype that is predominantly influenced by the MBOAT7 MAFLD-risk mutations remains undefined. Accurate data is crucial for studying the genetic origins of diseases like MAFLD, where many immunological and structural cells found in the liver are believed to play a role in its development. MBOAT7 is expressed at higher levels in PBMCs and primary immune cell types compared to non-immune cells such hepatocytes, sinusoidal endothelial cells, or hepatic stellate cells, as previously documented [19].
Based on the data we’ve gathered, it appears that in healthy individuals with a
disease-associated SNP, PBMCs stimulated by TLRs exhibit decreased expression of
MBOAT7 mRNA and an increased release of proinflammatory cytokines compared to
individuals in lower-risk groups. Interestingly, the overproduction of these
cytokines seems to be triggered by various TLRs, except for TLR3, which
specifically signals through the TIR-domain-containing adaptor-inducing
interferon-
The rs8736 variant of MBOAT7 has been shown to regulate gene expression in a cell-specific manner. In monocytes from healthy individuals with a disease-associated SNP, MBOAT7 mRNA levels were lower compared to both baseline and TLR-stimulated monocytes. Conversely, no genotype-dependent effect on gene expression was observed in T and B cells. Interestingly, NK cells from the same individuals exhibited higher MBOAT7 expression. Notably, individuals with the disease-associated SNP demonstrated an increased production of cytokines in PBMCs. NK cells play a bifunctional role in the development and progression of liver disease, which includes both immunostimulatory and immunosuppressive effects leading to profibrotic and anti-fibrotic effects. A regulatory network and crosstalk between macrophages and NK cells have also been described [21]. Further studies are required to clarify the role of MBOAT7 in NK cells.
The present study reveals that the impact of the MBOAT7 MAFLD-risk variants is confined to specific primary immune cell types, particularly mononuclear phagocytes, in a cell-specific manner. These observations are in line with our prior data on macrophages as well as our predictions based on cell-specific methylation QTLs (mQTL) of MBOAT7 risk variants in blood and monocytes that plays a pivotal role in regulating the effect of rs8736 on mRNA stability and, consequently, the expression of MBOAT7 [13]. These results may have important implications for the development of targeted therapies for metabolic disorders, particularly in populations with high prevalence of MBOAT7 risk variants. It is anticipated that further investigations into the underlying mechanisms of this cell-specific effect will shed light on the role of MBOAT7 in metabolic diseases.
In conclusion, our findings demonstrate that the expression of MBOAT7 is significantly affected by the MBOAT7 MAFLD-risk SNPs in primary mononuclear phagocytes. Our findings emphasize the significance of examining GWAS signals in the particular cell types where changes in gene expression occur.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Formal analysis was performed by ZP, JA, and AB; Methodology was designed by JG, ME and ZP; Resources were handled by ME and JG; Study concept and design was provided by ME; Writing—original draft was done by ZP and ME; Writing—review and editing was done by ZP, JG and ME. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
The patient samples were obtained for research purposes from January 2019 to January 2020. The study received ethical approval from the Sydney West Area Health Service and the Human Research Ethics Committee (HREC/17/WMEAD/433) at the University of Sydney. Written informed consent was obtained from all patients, including for genetic testing.
We would like to thank all the patients and healthy volunteers for their participation in this study.
ME and JG are supported by the Robert W. Storr Bequest to the Sydney Medical Foundation, University of Sydney; a National Health and Medical Research Council of Australia (NHMRC) Program Grant (APP1053206) and Project and ideas grants (APP2001692, APP1107178 and APP1108422).
The authors declare no conflict of interest.
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.