The siRNA used in this study was obtained from GenePharma (Shanghai, China). Rabbit polyclonal antibody targeting PPP3CB was acquired from GeneTex (Shanghai, China). Mouse monoclonal antibodies against $\beta$-tubulin and $\beta$-actin were obtained from TransGene Biotech (Beijing, China), and mouse monoclonal antibody against GAPDH was purchased from CWBIO (Beijing, China). Rabbit polyclonal antibody against green fluorescent protein (GFP) was acquired from Abcam (Cambridge, UK), mouse polyclonal antibody against Flag was purchased from Santa Cruz Biotechnology (Dallas, TX, USA), rabbit polyclonal antibody against PDHB was purchased from Proteintech (Hubei, China), while rabbit monoclonal antibody against PDHK1 and rabbit monoclonal antibody against p-DHK1 (S293) were purchased from Cell Signaling Technology (Boston, MA, USA). Sodium dichloroacetate (DCA) was purchased from Topscience (Shanghai, China) and cycloheximide (CHX) from MCE (Dallas, TX, USA).

Human bladder cancer cell lines T24 and human embryonic kidney cells HEK-293T were obtained from the American Type Culture Collections (ATCC). All cell lines were grown in Dulbecco’s Modified Eagle’s Medium (Gibco, Thermo Fisher Scientific, New York, NY, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific, USA) and 1% penicillin/streptomycin (PS) (Hyclone, cytiva, Logan, UT, USA). Cell lines were cultured in a humidified incubator at 37 °C and with 5% CO${}_2$. All cell lines were validated by STR profiling and tested negative for mycoplasma.

The coding sequence (CDS) for h.PPP3CB was amplified from complementary DNA (cDNA) obtained from HEK-293T. Forward primer: 5${}^{\prime }$-ggatccgaattc ATGGCCGCCCCGGAGCC-3${}^{\prime }$. Reverse primer: 5${}^{\prime }$-atggtggtgctcgag TCACTGGGCAGTATGGTTGCCCG-3${}^{\prime }$. For truncated variants, the reverse primer for the 1–401 truncation was: 5${}^{\prime }$-atggtggtgctcgag AATTTCAGGCTGCAGCTGAACC-3${}^{\prime }$; the forward primer for the 402–524 truncation was: 5${}^{\prime }$-ggatccgaattc ATGTGCAGCCCGGAAAGAA-3${}^{\prime }$; the reverse primer for the 1–415 truncation was: 5${}^{\prime }$-atggtggtgctcgag TCACTTGCCAATTGCTCGAATTTT-3${}^{\prime }$; the reverse and forward primers for the $\mathrm{\Delta }$357–415 truncation were 5${}^{\prime }$-gaagactcttgccat CATAAAATTAGGCAACCAGTAAGGA-3${}^{\prime }$ and 5${}^{\prime }$-ttgcctaattttatg ATGGCAAGAGTCTTCTCTGTTCTCA-3${}^{\prime }$, respectively.

The coding sequence (CDS) for h.PDHK1 was amplified from cDNA obtained from HEK-293T cells. Forward primer: 5${}^{\prime }$-ggatccgaattc ATGAGGCTGGCGCGGCTGC-3${}^{\prime }$. Reverse primer: 5${}^{\prime }$-atggtggtgctcgag CTAGGCACTGCGGAACGTCGTCAT-3${}^{\prime }$. PCR products were cloned into CMV-GFP or CMV-FLAG vectors using EcoRI and XhoI sites. The candidate sgRNA sequence for PPP3CB was identified using the SYNTHEGO design tool (https://tools.synthego.com/). Primers were as follow: (sense) 5${}^{\prime }$-caccg AAGCGAUGUGUUGGGGGGAA-3${}^{\prime }$; (anti-sense) 5${}^{\prime }$-aaac TTCCCCCCAACACATCGCTT c-3${}^{\prime }$. The PCR product was ligated into CRISPR-V2 vector using the BsmbI site. The following sequence was used for si-RNA: si-PPP3CB: ACCTGCTAATACACGATACCTT.

Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used for siRNA transfection as per the manufacturer’s instructions. HEK-293T cells were transiently transfected using Linear Polyethylenimine following the manufacturer’s instructions. For the immunoprecipitation assay, T24 cells were transfected using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) as recommended by the manufacturer. For lentivirus infection, the cells were grown to 50–60% confluence and subsequently treated with medium containing lentivirus. They were then harvested 48 hours after transfection and incubated overnight. Virus particles were collected and used to infect T24 cells in the presence of 8 µg/mL polybrene (Sigma, Saint Louis, MO, USA). After infection, stable clones were selected using puromycin (Invitrogen, Carlsbad, CA, USA).

Cell proliferation assays were conducted 24 hours after transfection. Cells were seeded at a density of 2000 per well in a 96-well plate. The CCK-8 reagent was diluted with DMEM to a 10% concentration and then added to each well. The absorbance at 450 nm was measured at 24-hour intervals.

T24 cells (1000 per well) were seeded into 6-well plates and incubated under normothermia conditions for 2 weeks, with the culture medium refreshed every 3 days. Following this, cell colonies were fixed with 4% paraformaldehyde (Sangon, Shanghai, China) for 15 minutes and subsequently stained with 0.5% crystal violet (Beyotime, Shanghai, China) for 20 minutes at room temperature. The images of colonies were recorded using a microscope (Leica, DMC5400, Wetzlar, Germany).

The isolation of total RNA from cells was carried out using Trizol reagent (Invitrogen, Carlsbad, CA, USA). cDNA synthesis was performed using an oligonucleotide primer and transcription kit (Thermo Scientific, Waltham, MA, USA). Subsequently, quantitative real-time PCR was conducted using Ultra SYBR Mixture (CWBIO, Beijing, China). All experiments were normalized to internal control (18 s). The following primer pairs were utilized for quantitative real-time PCR: human PPP3CB, forward: 5${}^{\prime }$-CTTGGCGATTATGTGGACAGAGG-3${}^{\prime }$, reverse: 5${}^{\prime }$-GGTGTCTGCATTCATGGTTGCC-3${}^{\prime }$. Human PDHK1, forward: 5${}^{\prime }$-CATGTCACGCTGGGTAATGAGG-3${}^{\prime }$, reverse: 5${}^{\prime }$-CTCAACACGAGGTCTTGGTGCA-3${}^{\prime }$.

Protein A agarose beads (Millipore, Billerica, MA, USA) were washed three times with PBS before the addition of anti-GFP antibody. This mixture was incubated for 3 hours at 4 °C. Protein was extracted from HEK-293T cells using the following lysis buffer: 50 mM Tris–HCl pH 7.5, 0.1% SDS, 1% TritonX-100, 150 mM NaCl, 1 mM dithiothreitol, 0.5 mM EDTA, 100 mM PMSF, 100 mM leupeptin, 1 mM aprotinin, 100 mM sodium orthovanadate, 100 mM sodium pyrophosphate, and 1 mM sodium fluoride. Cell extracts were centrifuged at 13,000 g for 10 min and the resulting supernatants were added to the bead and antibody mixture. Following overnight incubation at 4 °C, the immunocomplexes were washed three times with lysis buffer and then subjected to immunoblotting using specific antibodies. Image Lab software (Bio-Rad, version 3.0, Berkeley, CA, USA) was used to quantify the band intensity.

Approximately 3000 cells were seeded into a 24-well plate and grown for 24 hours at 37 °C. The cells were then fixed with 4% paraformaldehyde (Sigma) for 10 min, followed by permeabilization with 0.1% Triton X-100 (Sigma) for 10 minutes and then blocking with 10% bovine serum albumin (BSA) (Sigma) at room temperature for 1 hour. The primary antibodies anti-GFP, anti-PDHK1 and anti-PDHA1 were diluted (1:100) in 2% BSA and 20 µL was added to each sample and incubated overnight. After washing, secondary antibodies diluted with 2% BSA and mixed with DAPI were added to each sample and incubated for 1 h. The cells were then viewed using a Leica TCS SP8 confocal microscope.

Sections of bladder tissue on slides were purchased from Shuangxuan company (Wuhan, China). The slides were deparaffinized by immersing twice in xylene for 5 minutes each, and then immersed twice in 100% alcohol for 3 minutes each. This was followed by sequential immersion in 95%, 85%, and 75% alcohol for 3 minutes each. Antigen retrieval was achieved by boiling the slide in citric acid (pH = 6.0) for 20 minutes, then cooling to room temperature. Endogenous peroxidase activity was blocked by incubating the sections in a 3% H${}_2$O${}_2$ solution (ZSGB-BIO, Beijing, China) in methanol at room temperature for 10 minutes. The tissue was then blocked with 5% BSA for 1 hour, followed by the addition of 50 µL anti-PPP3CB antibody and overnight incubation at 4 °C. Subsequently, Sav-HRP (ZSGB-BIO) conjugates were applied to the sections and incubated at room temperature for 30 minutes. This was followed by the addition of 50 µL DAB substrate solution (ZSGB-BIO) to the sections for approximately 1 minute to visualize the antibody staining. Tissue slides were then dehydrated by sequential immersion in alcohol solutions (85%, 98%, 100%, 100%) for 5 minutes each, with the process repeated four times. This was followed by immersion in xylene three times. A microscope was used to visualize the antibody staining in the tissue sections.

Extracellular lactate and glucose concentrations were quantified under normoxic conditions using lactate (solarbio, BC2230, Beijing, China) and glucose (solarbio, BC2505) assay kits, respectively. Briefly, 1 $\times$ 10${}^6$ cells suspended in 2 mL of medium were seeded into 6-well dishes. After 6 hours, the medium was replaced with serum-free DMEM. For the assessment of glucose consumption and lactate production, cells were incubated for 18 hours and 8 hours, respectively. The culture supernatant was then collected to measure the concentrations of glucose and lactate as described by the manufacturer of each kit.

The measurement of glucose content involved three reagents within the kit. Use as described by the manufacturer of each kit.

The animal studies conducted in this research were approved by the Animal Research Ethics Committee of Chongqing Medical University. Male BALB/c mice aged 6-weeks were housed and maintained in the experimental animal center of Chongqing Medical University. A total of 4 $\times$ 10${}^6$ cells with or without PPP3CB knockout were resuspended in 100 µL of PBS and subcutaneously injected into the hind leg flanks of the mice. Tumor growth was monitored every three days after inoculation by measuring the width (W) and height (H) of the tumor. The tumor volume (V) was calculated using the formula: V = (H $\times$ W^2) / 2. All mice were euthanized 5 weeks after cell injection and the tumor was harvested and its weight measured.

A total of 5 $\times$ 10${}^5$ T24 cells were seeded into 6-well dishes and incubated for 48 hours. The cells were then washed three times with PBS and digested using EDTA-free trypsin. Subsequently, the cells were centrifuged at 2500 rpm for 5 minutes and the supernatant discarded. The cell pellet was resuspended in 1 ml of PBS and analyzed by flow cytometry for the detection of apoptosis.

T24 cells were digested and centrifuged at 1000 rpm, washed three times with PBS, snap frozen with liquid nitrogen and then stored at –80 ℃. Untargeted metabolomics were performed using Ultra High Performance Liquid Chromatography (UHPLC) (1290 Infinity II, Agilent Technologies, Santa Clara, CA, USA) equipped with a quadrupole time-of-flight mass spectrometer (AB Sciex TripleTOF 6600) at Shanghai Applied Protein Technology Co., Ltd. (Shanghai, China). Cell metabolites were separated on an ACQUITY UHPLC BEH Amide column under optimized conditions. The samples were kept at 4 °C throughout the UHPLC-Mass Spectrometry (UHPLC-MS) analysis. Mass spectrum analysis was performed using the electrospray ionization (ESI) source in both positive and negative modes. Metabolite identification was carried out by converting the raw MS data to mzXML files and analyzing with XCMS software (Mass Consortium, version 4.0.0, La Jolla, CA, USA). Metabolites were identified by comparing their m/z values and MS/MS spectra with an in-house database of authentic standards and metabolic reaction network. All metabolomic sample readings were averaged.

Statistical analysis was performed using Graphpad Prism 8 software (GraphPad Software Inc., La Jolla, CA, USA). * p 0.05, ** p 0.01, *** p 0.001, and **** p 0.0001 denoted statistically significant differences compared with the control group. Two-sided Student’s t-tests were performed for two-group comparisons.

PPP3CB was recently reported to be a key regulator of epithelial-mesenchymal transition (EMT) in G401 cells [15]. However, the function of PPP3CB in bladder cancer remains unclear. Bioinformatic analysis of the TCGA cohort revealed that PPP3CB is significantly downregulated in bladder tumor tissue (Fig. 1A,B). To confirm this result, we performed immunohistochemical (IHC) staining of bladder cancer tissue using tissue microarrays. This revealed that most tumor tissues have lower PPP3CB expression levels compared with their paired normal tissue (Fig. 1C,D), indicating that PPP3CB is a potential suppressor in bladder cancer.

Fig. 1.

PPP3CB expression is downregulated in bladder cancer. (A) PPP3CB expression in bladder cancer is low in the The Cancer Genome Atlas (TCGA) cohort. (B) The PPP3CB expression level in bladder cancer tissue was significantly lower than in para-cancerous tissue. (C) Immunohistochemical (IHC) staining showing lower PPP3CB expression in the tumor tissue of bladder cancer patients compared to adjacent normal tissue. (D) Average integrated optical density (IOD) in bladder cancer tissue was lower than in adjacent tissue. Error bars represent the mean $\pm$ standard deviation (SD) of three experimental replicates. Statistical significance was assessed using a two-tailed unpaired Student’s t-test.

In order to validate the anti-tumor effect of PPP3CB in vitro, we performed PPP3CB overexpression and knockout experiments in T24 cells. Flow cytometry showed that overexpression of PPP3CB promotes the apoptosis of T24 cells (Fig. 2A–C). In contrast, knockout of PPP3CB inhibited the apoptosis of T24 cells. We also investigated the effect of PPP3CB on the proliferation of T24 cells (Fig. 2D–F). Cell viability assays revealed that PPP3CB overexpression inhibited the growth of T24 cells (Fig. 2G), whereas knockout of PPP3CB promoted their proliferation (Fig. 2J). Consistent with these findings, the colony formation assay revealed that PPP3CB overexpression suppressed the colony formation ability of T24 cells (Fig. 2H,I), whereas knockout of PPP3CB promoted colony formation (Fig. 2K,L). Collectively, these results suggest that PPP3CB can inhibit the proliferation of bladder cancer cells in vitro and promote their apoptosis.

Fig. 2.

PPP3CB inhibits the proliferation of bladder cancer cells and promotes their apoptosis. (A–C) PPP3CB overexpression promotes the apoptosis of T24 cells. (D–F) Knockout of PPP3CB inhibits the apoptosis of T24 cells. (G) PPP3CB overexpression inhibits the proliferation of T24 cells. (H,I) Overexpression of PPP3CB inhibits colony formation of T24 cells. (J) Knockout of PPP3CB promotes the proliferation of T24 cells. (K,L) Knockout of PPP3CB promotes colony formation by T24 cells. Error bars represent the mean $\pm$ SD of three replicate experiments. Statistical significance was assessed using a two-tailed unpaired Student’s t-test. *p 0.05, ***p 0.001, ****p 0.0001.

To investigate whether PPP3CB deficiency promotes the proliferation of T24 cells through glucose metabolism, we first examined glucose metabolism after knockdown of PPP3CB. Specifically, metabolomics was performed to investigate differences in intracellular metabolites between the negative control and PPP3CB knockdown cells (Fig. 3A). The increase in glycolysis metabolites after PPP3CB knockdown (Fig. 3B) indicates a pivotal role for PPP3CB in T24 cell glucose metabolism. To confirm these results, we also measured glucose uptake and lactate production. Consistent with the above findings, overexpression of PPP3CB reduced glucose uptake and lactose production (Fig. 3C,D), whereas knockdown of PPP3CB increased glucose uptake and lactate production (Fig. 3E,F). Collectively, these results suggest that PPP3CB is a negative regulator of glucose metabolism in T24 cells.

Fig. 3.

PPP3CB inhibits glycolysis in bladder cancer cells. (A) Schematic representation of the metabolic pathways and specific metabolites affected by PPP3CB knockout in T24 cells. (B) Knockdown of PPP3CB upregulates glycolysis intermediates. (C,D) Overexpression of PPP3CB decreases glucose uptake and lactate production. (E,F) Knockdown of PPP3CB enhances glucose uptake and lactate production. Error bars represent the mean $\pm$ SD of three experimental replicates. Statistical significance was assessed using a two-tailed unpaired Student’s t-test, *p 0.05, **p 0.01.

Due to the upregulation of lactate, we deduced that PPP3CB may affect the expression of LDHA. However, the results showed no difference in LDHA level between the two groups (Supplementary Fig. 1). Therefore, we next examined whether the change in glucose metabolism could be attributed to changes in pyruvate dehydrogenase (PDH). For this, we evaluated the expression levels of pyruvate dehydrogenase E1 subunit alpha1 (PDHA1), phospho-PDHA1, pyruvate dehydrogenase E1 subunit beta (PDHB), and pyruvate dehydrogenase kinase 1 (PDHK1). Interestingly, knockdown of PPP3CB in T24 cells resulted in increased expression levels of PDHK1 and p-PDHA1, but not PDHB or PDHA1 (Fig. 4A, Supplementary Fig. 3). In line with this, knockout of PPP3CB also increased the expression of PDHK1 and p-PDHA1 (Fig. 4B,C). In contrast, the overexpression of PPP3CB in T24 cells led to a reduction in the expression of PDHK1 and p-PDHA1 (Fig. 4D,E). We next investigated whether increased expression of PDHK1 was due to changes in mRNA or protein stability. Quantitative real-time PCR showed the mRNA level increased after knockdown of PPP3CB (Supplementary Fig. 2). Knockdown of PPP3CB also attenuated the degradation of PDHK1 after cycloheximide (CHX) treatment (Fig. 4F,G). These results indicate that knockdown of PPP3CB enhances PDHK1 protein expression by increasing its transcription level and stabilizing protein expression.

Fig. 4.

PPP3CB decreases the expression pyruvate dehydrogenase kinase 1 (PDHK1). (A) Knockdown of PPP3CB increased the expression of PDHK1 in normoxia and in CoCl${}_2$-induced hypoxia. (B) Knockout of PPP3CB increased the expression of PDHK1. (C) Protein quantification after knockout of PPP3CB. The results shown are the mean $\pm$ SEM (n = 3). NS, not significant; ***p 0.001. (D) Overexpression of PPP3CB reduced the expression of PDHK1. (E) Protein quantification following the overexpression of PPP3CB. The results shown are the mean $\pm$ standard error of the mean (SEM) (n = 3). NS, not significant; **p 0.01. (F,G) Knockdown of PPP3CB enhanced the stability of PDHK1. *p 0.05, **p 0.01.

To further study the mechanism by which PDHK1 expression increased, immunofluorescence (IF) was performed to evaluate the co-localization of PPP3CB and PDHK1, while co-immunoprecipitation (co-IP) was used to examine the interaction between these proteins. IF showed that PPP3CB co-localized with PDHK1 in T24 cells (Fig. 5A). Exogenous PDHK1 was also found to interact with endogenous PPP3CB in T24 cells (Fig. 5B). Moreover, exogenous PDHK1 interacted with both exogenous PPP3CB (Fig. 5C) and endogenous PPP3CB (Fig. 5D) in HEK-293T. In line with this, co-IP revealed that exogenous PPP3CB interacted with exogenous PDHK1 in HEK-293T (Fig. 5E). To identify the precise interaction domain of PPP3CB, we constructed plasmids with different deletion mutations of PPP3CB (Fig. 5F). co-IP experiments with HEK-293T cells showed that PPP3CB interacted with the PDHK1 catalytic domain and with the calcineurin B binding domain (Fig. 5G).

Fig. 5.

PPP3CB interacts with PDHK1. (A) Immunofluorescence showing the co-localization of PPP3CB with PDHK1 in T24 cells. (B) GFP-PDHK1 interacting with endogenous PPP3CB in T24 cells. (C) GFP-PDHK1 interacting with Flag-PPP3CB in HEK-293T cells. (D) GFP-PDHK1 interacting with endogenous PPP3CB in HEK-293T cells. (E) GFP-PPP3CB interacting with Flag-PDHK1 in HEK-293T cells. (F) The structural domain of PPP3CB. (G) PPP3CB mainly interacts with the catalytic domain of PDHK1 in HEK-293T cells.

Taken together, these results indicate that PPP3CB interacts with PDHK1, resulting in the destabilization and degradation of PDHK1. Hence, the low expression of PPP3CB in bladder cancer cells leads to reduced degradation of PDHK1, thereby promoting the Warburg effect.

Since PPP3CB interacts with PDHK1, we inferred that PPP3CB inhibits glycolysis and the proliferation of bladder cancer cells through PDHK1. We therefore treated T24 cells with DCA, which is an inhibitor of PDHK1 [24]. Both PDHK1 and p-PDHA1 expression were significantly downregulated by DCA (Fig. 6A), with flow cytometry also showing increased apoptosis (Fig. 6B–D). In line with this, the cell viability and colony formation assays showed that proliferation of T24 cells was suppressed by DCA (Fig. 6E–G). Furthermore, treatment with DCA inhibited glucose uptake and lactate production in T24 cells (Fig. 6H,I). As stated previously, overactivated PDHK1 can inhibit PDC, thereby switching tumor cells from oxidative phosphorylation to glycolysis and promoting bladder cancer cell proliferation. The present results confirm that inhibition of PDHK1 with DCA blocks glycolysis and the proliferation of bladder cancer cells.

Fig. 6.

Dichloroacetate (DCA) promotes apoptosis and inhibits proliferation and glycolysis in T24 cells. (A) Suppression of PDHA1 phosphorylation by DCA treatment of T24 cells for 2 hours. (B–D) DCA treatment increases apoptosis. (E) DCA treatment inhibits the proliferation of T24 cells. (F,G) Decreased colony number after DCA treatment. For the Cell Counting Kit-8 (CCK-8) and clonal formation assays, DCA was added 24 hours after cell seeding. (H,I) DCA treatment (0.5 mmol/L) decreased glucose uptake and lactate production. *p 0.05, ***p 0.001.

In order to confirm that increased glycolysis and cell proliferation induced by PPP3CB knockdown were due to PDHK1, we conducted immunoblot analysis to determine the expression level of p-PDHA1 in T24 cells. DCA was used to inhibit PDHK1 due to its relative specificity for this enzyme. The upregulation of p-PDHA1 after PPP3CB knockdown was found to be blocked by DCA treatment (Fig. 7A, Supplementary Fig. 4). This indicates that PPP3CB upregulates the expression of both PDHK1 and p-PDHA1, whereas DCA treatment reversed this effect. Next, flow cytometry revealed that DCA could block apoptosis resulting from PPP3CB knockdown (Fig. 7B–E). In line with this, the proliferation of T24 cells after PPP3CB knockout was attenuated by DCA treatment (Fig. 7F–H). As expected, glucose uptake and lactate production were significantly upregulated after PPP3CB knockdown, but DCA treatment blocked this effect (Fig. 7I,J). Nevertheless, our findings indicate that PPP3CB deficiency increases glycolysis and the proliferation of T24 cells by upregulating the expression of PDHK1.

Fig. 7.

PPP3CB knockdown promotes cell proliferation and inhibits apoptosis by upregulating PDHK1. (A) DCA blocks the upregulation of PDHK1 after PPP3CB knockdown in T24 cells. (B–E) DCA abolishes the effect of PPP3CB knockdown on apoptosis. (F) DCA blocks the increased proliferation of T24 cells after PPP3CB knockout. Statistical analysis was performed using a two-way ANOVA with Bonferroni’s post hoc test. (G,H) DCA abolishes the increased number of T24 cell colonies induced by PPP3CB knockout. (I,J) DCA blocks the increase in glucose uptake and lactate production induced by PPP3CB knockdown. *p 0.05, **p 0.01, ***p 0.001.

To investigate the tumor-promoting effect of PPP3CB deficiency, we established a xenograft mouse model by injecting T24 cells with or without PPP3CB knockout (Fig. 8A, Supplementary Fig. 5). The results showed that injection of T24 cells with PPP3CB knockout resulted in significantly higher tumor weight and volume in nude mice (Fig. 8B,C), thus demonstrating the anti-tumor effect of PPP3CB in vivo.

Fig. 8.

Knockout of PPP3CB promotes the growth of bladder tumors formed by injection of T24 cells. (A) Sacrificed mice and the corresponding tumors. (B) Greater tumor volume in PPP3CB knockout tumors. (C) Increased tumor weight of PPP3CB knockout tumors. Error bars represent the mean $\pm$ SD of three experimental replicates. Statistical significance was assessed using a two-tailed unpaired Student’s t-test. *p 0.05, **p 0.01.

As shown in Fig. 9, deficiency of PPP3CB stabilizes PDHK1, thereby increasing phospho-PDHA1. This deactivates the PDC, leading to an enhanced Warburg effect and faster growth of bladder tumors.

Fig. 9.

Working model derived from the study results. P represents phosphorylation of PDHA1.