The human sequences encoding TRPM6 or TRPM7 were synthesized and cloned into pcDNA3.0 vector to generate pcDNA-TRPM6 and pcDNA-TRPM7 plasmids. These were subcloned into pEGFP-N1 vector with forward primer (5${}^{\prime }$-ACTAAGCTTAATGGGCGACGCGGCCG-CAG-3${}^{\prime }$) containing a HindIII site, and reverse primer (5${}^{\prime }$-CATGGATCCGAAAGGTGCTGGTGGAGGTTG-3${}^{\prime }$) containing a BamHI site. All plasmids were sequenced to confirm their identities. Oligos encoding human TRPM7-specific shRNA (GCAGATCTGCTAGCGTATATTCTCGAG), or scrambled non-effective shRNA, were cloned into the LV-U6-mPGK-EGFP-T2A-Puro vector (Cyagen, Guangzhou, China) to produce recombinant lentiviral vectors in which green fluorescence protein (GFP) functions as an expression reporter.

Chinese hamster ovary (CHO) cells were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM; catalog #SH3002302, HyClone, Logan, UT, USA) containing 10% fetal bovine serum (FBS; catalog #FB12999102, Gibco, Carlsbad, CA, USA), 100 units/mL penicillin, and 100 mg/mL streptomycin (catalog #15140148, Gibco, Carlsbad, CA, USA) in a 5% CO${}_2$ incubator. CHO cells were passaged into 35 mm dishes 24 hours before transfection. Cells at 60 to 80% confluence were transfected with TRPM6 or TRPM7 plasmids using Lipofectamine 3000 reagent (catalog #L3000001, Invitrogen, Shanghai, China) according to the manufacturer’s protocol.

The ethics committee of Southwest Medical University approved all human cell culture experiments. Informed consent was obtained from donors who provided teeth for subsequent research. DFCs were obtained from embedded third molars collected from 20 individuals (aged 12–20 years). The dental follicle was gently separated from the tooth and then carefully washed with PBS containing 100 units/mL penicillin and 100 mg/mL streptomycin. The tissue blocks were minced and digested in a solution of 1% collagenase and 1% dispase (catalog #17105041, Invitrogen, Shanghai, China) for 40 minutes at 37 °C. Single cells and digested tissues were incubated in DMEM supplemented with 10% FBS, 100 units/mL penicillin and 100 mg/mL streptomycin at 37 °C and with 5% CO${}_2$. The culture media was changed every 2 days before cell passage. Cells from passages 2 or 3 were used in the experiments. DFCs were infected with lentiviruses that expressed either TRPM7 specific shRNA or scrambled non-effective shRNA at a concentration of 10${}^{10}$ plaque-forming units/mL. GFP allowed the identification of transduced cells.

DFCs cultured in 6-well plates (2 $\times$ 10${}^4$ cells/well) were fixed with 4% paraformaldehyde for 10 min, permeabilized with 0.5% triton for 15 min, and blocked with 1% bovine serum albumin in PBS for 30 minutes. Cells were then incubated overnight with primary antibodies at 4 °C. The next day, the cells were incubated with secondary antibody for 1 h. After washing with PBS, the nuclei were stained with 100 ng/mL of 4’,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI , catalog #C1005, Beyotime Biotechnology, Shanghai, China) for 5 min. Primary antibody for TRPM7 was purchased from Abcam (catalog #ab245408, Cambridge, MA, USA) and diluted at a 1:100 ratio. Images were captured with a fluorescence microscope.

Total RNA was isolated from DFCs and CHO cells with ectopic expression of TRPM6 or TRPM7 using Trizol reagent (catalog #15596026, Invitrogen, Shanghai, China) according to the manufacturer’s instructions. The isolated RNA was treated with DNase 1 and reverse transcription PCR was performed with PrimeScript${}^{\text{TM}}$ RT reagent Kit (catalog #RR037B, TaKaRa, Tokyo, Japan) according to the manufacturer’s protocol. The expression of target mRNA was visualized by ethidium bromide staining under UV light after agarose gel electrophoresis (1.5%).

Quantitative real-time PCR (qRT-PCR) was used to quantify TRPM7 and osteogenic-related gene expression levels in knockdown cells during osteogenic differentiation. Briefly, total RNA was isolated from DFCs and reverse-transcribed to cDNA using the PrimeScriptTM RT reagent Kit (catalog #RR037B, TaKaRa, Tokyo, Japan). qRT-PCR was performed using the ABI Prism 7300 Real-Time PCR System (Thermo Fisher, MA, USA) with PrimeScript RT-PCR Kit (catalog #RR014B, TaKaRa, Tokyo, Japan). Specific primers used for detection of the target mRNA were (5′-3′): TRPM7 forward CTGGTTCCTCTTCTGGTGCCTTATTC, reverse TGCAACTTGGCTGAGATGGTGTAC; TRPM6: forward AGGGCCTGCAAATCAAAGATGA, reverse: TCTCCAATCAGTCGGCCACA; ALP: forward ACTCTCCGAGATGGTGGTGGTG, reverse CGTGGTCAATTCTGCCTCCTTCC; RUNX2: forward GCAGCAGCAGCAGCAGGAG, reverse: GCACCGAGCACAGGAAGTTGG; BSP: forward TGAAGAAGAAGAGGAGGAAGAGGAAGG, reverse CTCCGCTGCTGCCGTTGC; Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control to normalize the amount of RNA in each sample. Quantitative data for mRNA expression was calibrated to the results of control cells.

DFCs were cultured in DMEM supplemented with 10% FBS, 10 mM $\beta$-glycerophosphate (catalog # G9422, Sigma, Darmstadt, Germany), 10${}^{-8}$ M dexamethasone (catalog #D4902, Sigma, Darmstadt, Germany), 50 $\mu$g/mL ascorbic acid (catalog # A92902, Sigma, Darmstadt, Germany), and 10 nM vitamin D3 (catalog #731285, Sigma, Darmstadt, Germany). The medium was changed every 3 days. After 14 days of osteogenic differentiation, the cells were fixed with 4% polyoxymethylene for 10 minutes followed by Alizarin Red staining. After washing with PBS, stained cells were visualized using Leica DM2500 optical microscope (Leica Optical, Wetzlar, Germany).

Cell proliferation of DFCs was determined using Cell Counting Kit-8 assays (CCK-8, catalog #CK0411, Dojindo, Japan). DFCs were seeded into 96-well plates (5 $\times$ 10${}^3$ cells/well) in 100 $\mu$L of DMEM. At different time points (day 2, day 4 and day 6), the culture medium was replaced with 110 $\mu$L of fresh medium containing 10 $\mu$L of CCK-8. Absorbance at 490 nm was measured in each well with a microplate reader.

Cell migration of DFCs was assayed usingtranswell cell culture chambers (catalog #3384, Corning, NY, USA). The migration of cells was stimulated by DMEM containing 10% FBS in the lower chamber. After 48 hours culture, cells that had migrated through the membrane were stained by 100 ng/mL DAPI for 5 min. To quantify the migrated cells, cells were counted in 5 random fields with a Leica DM2500 optical microscope (Leica Optical, Wetzlar, Germany) and expressed as the average number of cells per field.

Whole cell recordings were performed using an EPC-10 USB amplifier with PatchMaster software version 2x91 (HEKA Elektronik, Reutlingen, Germany). Patch pipettes with resistances of 2.0–3.0 M were used. Series resistance was smaller than 10 M and compensated at least 80% to minimize voltage errors. To elicit whole cell TRPM7 currents, a standard 2.2 s voltage ramp from –100 mV to +100 mV was applied. The standard extracellular solution contained (in mM): 140 NaCl, 2 CaCl${}_2$, 2.8 KCl, 2 MgCl${}_2$, 4 glucose, and 10 HEPES-NaOH, with pH adjusted to 7.2 with NaOH. Mg${}^{2+}$-free intracellular solution contained (in mM): 120 Cs-glutamate, 8 NaCl, 10 Cs-BAPTA, 10 HEPES-CsOH, with pH adjusted to 7.2 with CsOH.

DFCs (2 $\times$ 10${}^4$ cells/well) were first cultured in osteogenic differentiation media for 14 days. Alkaline phosphatase (ALP) activities were then determined by the p-nitrophenol phosphate conversion method using the ALP assay kit (catalog #C3206, Beyotime, Shanghai, China) according to the manufacturer’s instructions. Absorbance at 405 nm was measured using a microplate reader. Quantitative data for ALP activity was calibrated against the results of control cells at day 14 of osteogenic differentiation.

DFCs were washed with PBS and lysed on ice for 30 minutes with Radio Immunoprecipitation Assay (RIPA, catalog #89900, Thermo Fisher, MA, USA) buffer containing protease inhibitor (50 mM Tris-HCl, 0.1% Sodium dodecyl sulfate (SDS), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate and 1 mM EGTA). The lysed cells were centrifuged at 12,000 g at 4 °C for 20 minutes, the supernatant was collected, and the protein quantified with the BCA protein assay kit (catalog #23227, Pierce, Rockford, IL, USA). After normalization, cell lysates were resuspended in SDS sample buffer and denatured at 95 °C for 5 minutes. Twenty $\mu$g of total target protein was separated by 10% SDS-PAGE gel and then transferred to PVDF membranes. PVDF membranes were blocked at room temperature with 5% non-fat milk in Tween-Tris-buffered saline (TTBS, 0.1% Tween 20, 50 mM Tris, 500 mM NaCl) for 1 h, and then incubated overnight at 4 °C with primary antibodies directed against GAPDH or TRPM7 (dilution 1:1000; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The membranes were then incubated with secondary antibody for 1 hour. Protein bands were visualized with a Bio-Rad Universal Hood II System (Bio-Rad, Hercules, CA, USA).

All data are presented as the mean $\pm$ SD from at least three independent experiments, each performed in triplicate. The Student’s t-test was used to calculate p-values with GraphPad Prism version 9.2.0 (GraphPad Software, San Diego, CA, USA). p values of 0.05 were considered statistically significant.

The expression of TRPM7 mRNA and protein in DFCs was confirmed using PCR, western blot and immunofluorescence staining (Fig. 1a–d). Electrophysiological recordings were then made to determine whether TRPM7 currents were active in DFCs. In the absence of Mg${}^{2+}$, typical whole cell TRPM7-like currents with small inward currents were recorded at negative potential, and strong outward currents at positive potential. To identify the native TRPM7-like currents present in DFCs, two concentrations of 2-APB (100 $\mu$M and 2 mM) were used to examine the currents in response to a voltage ramp. The results showed that TRPM7-like currents increased after exposure to 2 mM 2-APB, whereas they decreased after exposure to 100 $\mu$M 2-APB (Fig. 1e). These biophysical properties are similar to those reported for recombinant TRPM7 [17, 18]. Together, the results demonstrate that TRPM7 is functionally expressed in DFCs.

Fig. 1.

Knockdown of TRPM7 in DFCs using lentiviruses that express TRPM7-specific shRNA. (a) TRPM7 mRNA, but not TRPM6 mRNA, was detected in DFCs by reverse transcription PCR. CHO cells with ectopic expression of TRPM6 or TRPM7 were used as positive controls. (b) qRT-PCR showed that TRPM7 gene expression was significantly reduced in TRPM7 knockdown cells. Quantitative data from three independent experiments is shown. **, p 0.01. (c) Western blot was performed to detect the TRPM7 protein expression. Proteins isolated from CHO cells transduced with TRPM7 served as positive controls. lanes 1 and 2: CHO cells transduced with TRPM7. lanes 3 and 4: DFCs transduced with scrambled shRNA. lanes 5 and 6: DFCs transduced with TRPM7 shRNA. (d) Immunocytochemistry showed that TRPM7 was highly expressed in DFCs, but barely expressed in TRPM7 knockdown cells. Scale bar: 100 $\mu$M. (e) Typical whole cell TRPM7-like currents recorded in DFCs in the absence of Mg${}^{2+}$ (black color), in the presence of 2 mM 2APB (red color), of 100 $\mu$M 2APB (pink color), or infected with TRPM7-specific shRNA (blue color).

We next evaluated whether TRPM7 has a role in the proliferation and migration of DFCs. For this purpose, shRNA-expressing lentiviruses were used to knockdown TRPM7 expression in DFCs. The effectiveness of shRNA was confirmed by performing qRT-PCR, immunofluorescence, western blot and electrophysiological recordings. The results showed significant reductions in TRPM7 mRNA and protein levels, as well as in whole cell TRPM7-like currents in the TRPM7 knockdown cells compared to control cells infected with scrambled shRNA (Fig. 1b–e).

CCK-8 and transwell chamber assays were used to assess the effect of TRPM7 knockdown on the proliferation and migration of DFCs. CCK-8 assay results showed that at all time points (2, 4 and 6 days), the proliferation of TRPM7 knockdown cells was significantly reduced compared to control cells infected with scrambled shRNA (Fig. 2a). Transwell chamber assay results showed that fewer cells with TRPM7 knockdown migrated after 48 hours culture compared to control cells infected with scrambled shRNA (Fig. 2b). Quantitative data showed that TRPM7 knockdown reduced the number of migrated cells by almost half (52.17%) compared to the control cells (Fig. 2c).

Fig. 2.

TRPM7 knockdown inhibited the proliferation and migration of DFCs. (a) CCK-8 assay showed that TRPM7 knockdown inhibited cell proliferation of DFCs. Quantitative data from five independent experiments are shown. **, p 0.01. (b) Transwell chamber assays showed less migration of TRPM7 knockdown cells. Scale bar: 100 $\mu$M. (c) Quantitative data from five independent experiments for (b) are shown. **, p 0.01.

To evaluate the effect of TRPM7 on the osteogenic differentiation of DFCs, we cultured these cells in osteogenic differentiation media for 14 days and then determined ALP activity, expression of osteogenic related genes, and formation of mineral deposits. Inhibition of TRPM7 with specific shRNA was found to enhance mineralization (Fig. 3a,b), increase ALP activities (Fig. 3c), and upregulate the expression of ALP, RUNX2 and BSP (Fig. 3d–f) compared to control cells infected with scrambled shRNA.

Fig. 3.

TRPM7 knockdown promoted the osteogenic differentiation of DFCs. (a,b) Alizarin red staining showed that TRPM7 knockdown enhanced mineralization. (c) TRPM7 knockdown increased the ALP activities of DFCs. Quantitative data from five independent experiments are shown. **, p 0.01. (d–f) TRPM7 knockdown upregulated the expression of ALP, RUNX2 and BSP genes. Quantitative data from three independent experiments are shown. **, p 0.01; *, p 0.05.

We next examined whether Mg${}^{2+}$ deficiency had an effect on the osteogenic differentiation of DFCs. DFCs cultured for 14 days in osteogenic differentiation media containing 0.1 mM Mg${}^{2+}$showed increased formation of mineral deposits, as detected by Alizarin Red S staining (Fig. 4a,b). The expression of ALP, RUNX2 and BSP was also higher in Mg${}^{2+}$-deficient cells compared to control cells (Fig. 4c–e).

Fig. 4.

Mg${}^{\mathrm{2}\mathrm{+}}$ deficiency promotes osteogenic differentiation of DFCs. (a,b) Alizarin red staining showed that 0.1 mM Mg${}^{2+}$ enhanced mineralization. (c–e) 0.1 mM Mg${}^{2+}$ upregulated the expression of ALP, RUNX2 and BSP genes. Quantitative data from five independent experiments are shown. **, p 0.01.