Twenty-three PD patients (male: 12; female: 11) with a mean age of 63.5 $\pm$1.0 years and on anti-parkinsonian medications were recruited from the Brain Hospital affiliated with the Nanjing Medical University and included in this study (Table 1). The participants with PD were diagnosed according to PD diagnostic criteria released by the Movement Disorders and PD Group within the Chinese Neurology Association. Participants diagnosed with other comorbid conditions, such as diabetes, arthritis, or heart disease were excluded from the study. In addition to the PD cohort, 30 age- and gender-matched healthy volunteers (male: 15, female: 15) with a mean age of 65.0 $\pm$ 0.8 years were contacted via the physical examination center of our hospital and invited to participate in this study as members of the control group. To be eligible for inclusion, all controls were required to be free of neurological conditions and have no history of diabetes, arthritis, or heart disease. The protocols for this research were approved by the appropriate Ethics Committees of the Nanjing Brain Hospital (Ethics Reference No: 2017-KY010), and all participants involved gave their written informed consent to participate.

The PD participants were predominantly in the early stages of the disease (Hoehn & Yahr score 1.4 $\pm$ 0.9) and had an average unified Parkinson’s Disease rating scale (UPDRS) total score of 40.9 $\pm$ 17.9. For the three UPDRS sub-scales, UPDRS I, II, and III, the mean scores were 2.8 $\pm$ 2.2, 11.5 $\pm$ 7.4, and 26.6 $\pm$ 10.8, respectively (Table 2).

Eight-week-old C57/BL mice were provided by Nanjing Medical University (Nanjing, Jiangsu, China). Forty C57/BL mice (20 males and 20 females) were acclimatized and kept at a temperature of 22 $\pm$ 2 °C and a humidity of 60% $\pm$ 2% with ad libitum feeding. All experimental procedures used in this study were approved by the Institutional Animal Care and Use Committee of our hospital (Ethics Reference No: 2017-KY010). Twenty of the C57/BL mice received the miR-1976 mimic lentiviral vector injected into neurons of the substantia nigra and were euthanized 24 h after receiving treatment. Meanwhile, the remaining 20 mice received only saline injections into the neurons of the substantia nigra and served as controls.

The dopaminergic neuronal cell line (MES23.5) used in this study was cultured in Gibco Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 15% fetal bovine serum at 37 °C and 5% CO${}_2$ before being prepared for transfection.

To facilitate analysis, HSA-miR-1976 mimics (and negative controls), PINK1 shRNA, and PINK1 inhibitors were purchased from Shengbo Biotechnology Co., Ltd (Shanghai, China). Once the MES23.5 cells that were cultured in DMEM had reached approximately 50% confluence, cells (1 $\times$ 10${}^6$) were seeded into each well of a 6-well plate and transfected with the above mimics or inhibitors using Lipofectamine${}^{\text{TM}}$ 2000 (11668, Invitrogen, CA, USA) according to the manufacturer’s protocol. These cells were subsequently collected after 12 h, 24 h, and 36 h and used in the subsequent experiment.

Blood samples (3 mL) were drawn from each subject and were centrifuged at 3500 rpm for 5 min. Plasma samples were then stored at –80 °C before analysis.

Total RNA was isolated using the TRIzol protocol. In brief, TRIzol (15596, Ambion, Carlsbad, CA, USA) was added to the plasma samples. Following a 10 min incubation at ambient temperature, 200 $\mu$L of chloroform was added and mixed vigorously. The mixture was then centrifuged at 14,000 rpm for 15 min at a temperature of ~4 °C. The upper aqueous phase was then transferred into a new tube and combined with 500 $\mu$L of ethanol to facilitate RNA extraction. The RNA precipitant obtained by centrifugation was washed with 75% ethyl alcohol, and the integrity of extracted total RNA was determined using a microspectrophotometer (MSP100, Angstrom Sun Technologies Inc, NewYork, NY, USA).

Total RNA (100 $\mu$g) was added to 5 times the volume of lysis buffer, then combined with 1/10th the volume of miRNA Homogenate Additive and 1/3rd the volume of ethyl alcohol. The mixture was subsequently centrifuged at 5000 rpm for 1 min. Following centrifugation, the precipitate was combined with 700 $\mu$L of miRNA Washing Solution 1 and 500 $\mu$L of miRNA Washing Solution 2 and recentrifuged an additional two times. Finally, 50 $\mu$L of Elution Solution was added to the column and left for 2 min prior to centrifuging the samples for 1 min at 10,000 rpm. The flowthrough containing the miRNA was stored at –80 °C until used.

Microarray data was normalized using the R package fRMA from Bioconductor and analyzed with the R limma package. Unless otherwise indicated, data were considered significant with a p-value lower than 0.05 and absolute fold change higher than 1. First, the solution used for microarray hybridization was prepared by combining 2.4 $\mu$L of 15% formamide, 3.2 $\mu$L of 0.2% sodium dodecyl sulfate, 4 $\mu$L of 3 $\times$ SSC2, 1.6 $\mu$L of 50 $\times$ Denhardt’s solution, and 6.4 $\mu$L of diethyl pyrocarbonate. Following this process, the RNA described above was added to this solution and incubated for 3 min at 95 °C. Hybridization of the miRNAs was performed on the mammalian miRNA microarray chip (V3.0), after which the hybridized chips were washed and scanned on a microarray scanner (G2565CA, Agilent, Santa Clara, CA, USA).

Total RNA was extracted using the procedures described above for microarray hybridization. Both primers for each miRNA (miR-1976, miR-153, miR-103a, miR-29a, miR-210, miR-375, miR-146a, and miR-101a) and the internal reference U6 reverse transcription primers were provided by Ribobio (Guangzhou, Guangdong, China). For real-time PCR, the cDNA from individual samples of total RNA was synthesized using the FastQuant RT kit (KR106, TIANGEN, Beijing, China). The real-time PCR was performed in a 20 $\mu$L reaction system comprising 10 $\mu$L SYBR Green (163795-75-3, TaKaRa, Kyoto, Japan), 1 $\mu$L upstream/downstream primers, 1 $\mu$L deoxynucleotide solution, 2 $\mu$L Taq polymerase, and 5 $\mu$L cDNA. Cycling conditions included 10 min at 95 °C pre-denaturation, followed by 40 cycles of 5 sec denaturation at 95 °C, 2 min annealing at 60 °C, and 30 sec elongation at 72 °C. All reactions were performed on a Prime Quantitative PCR detector (7300, ABI, Arlington, VA, USA).

The 3’UTR fragment of PINK1, which contains binding sites for miR-1976 (WT) and a 3’UTR fragment with a corresponding mutation (MUT), were designed based on the results of information prediction. The primers used in this assay were miR-1976-F (CTC CTG CCC TCC TTG CTG T) and U6-F (CCT AGC ACC ATG AAG ATC AAG AT). They were then plated into a 24-well plate and co-transfected with 40 nM of either an miR-1976 mimic or a negative control and 100 ng of either the PINK 3’UTR WT or MUT reporter using the Lipofectamine${}^{\text{TM}}$ (3000, Invitrogen, CA, USA). Forty-eight h later the cells were collected, and the luciferase activity was measured using the dual luciferase assay system (E2920, Promega, Madison, WI, USA).

The MES23.5 cells were first cultured and then digested using pancreatin. After washing with phosphate-buffered saline, cells were centrifuged for 10 min at 800–1000 rpm, after which the supernatant was discarded, and the remaining precipitate was resuspended at 1500 rpm for 10 min. The compacted cell mass was then fixed with 2.5% glutaraldehyde and 1% osmic acid. After embedding with Epon 812, cells were stained and observed using a transmission electron microscope (JEM-1010, JEOL, Tokyo, Japan).

The MES23.5 cells were seeded into 64-well plates, pretreated with pancreatic enzymes in their logarithmic phase and washed twice with phosphate-buffered saline. Each pellet was resuspended in 250 $\mu$L of binding buffer and combined with both 5 $\mu$L Annexin V-FITC and propidium iodide for a 30-min incubation period. Following this, flow cytometry (ab204534, Chuangsai, Shanghai, China) was used to assess apoptosis at an excitation wavelength of 488 nm and emission wavelength of 515 nm.

Focusing on miR-1976, we predicted its putative mRNA targets using TargetScan (https://www.targetscan.org) and microrna.org, respectively. First, we searched the target genes from these two databases (Target gene dataset A), then the common target genes were collected and intersected with Target gene dataset B (different expression genes that were negatively related with miR-1976 and detected based on the miRNA microarray).

GO (http://geneontology.org) and pathway analysis (https://www.kegg.jp) were performed to detect the coordinated changes in functionally related genes. GO analysis was carried out by using the database, while the pathway analysis of obtained predicted target genes was conducted using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

The statistical analyses were conducted using SPSS 20.0 software (20, SPSS, Chicago, IL, USA). The differences in miR-1976 expression among different groups were analyzed using the Student’s t test when only two groups were compared, or assessed by one-way analysis of variance (ANOVA) when there were more than two groups. The nonparametric Mann-Whitney U test was performed to compare the miRNA expression between patients and normal controls, and the Kruskal-Wallis test was used when there were more than two groups. The Mann-Whitney U test and the Kruskal-Wallis test were used to evaluate the correlations between the results of the miRNA expression and other parameters. A two-tailed p-value of 0.05 was considered statistically significant. Categorical variables were evaluated using the Chi-square test. For comparison of differences, p 0.05 was considered statistically significant.

To assess differences in the expression of miRNAs between the healthy volunteers and the PD cohort, total RNA from plasma was collected from the 13 participants with PD and the 11 age-matched controls to facilitate miRNA microarray expression profiling. Based on the bioinformatics evaluation, 18 miRNAs that were differentially regulated between the two study cohorts (p 0.05) were detected. Among these miRNAs, 11 (miR-29a, 103a, 1976, 153, 30b, 103a, 7, 9, 129, 132, and 105) were shown to be upregulated in participants with PD compared with controls, while seven (miR-210, 375, 146a, 101a, 34b, 34c, and 56) were downregulated (Fig. 1a).

Fig. 1.

Differences in the expression of miRNAs between the 13 PD patients and the 11 controls. (a) The miRNA microarrays of PD patients. (b) Expression of miRNAs in PD patients and control individuals. (c) Expression level of miR-1976 in PD patients and control individuals. NC, Normal control. ***, p 0.001; **, p 0.01 compared with the control group.

To examine whether these miRNAs were related to PD progression, plasma RNA was collected again from the same cohorts, PD patients and the healthy controls, and the expression of these miRNAs were detected using real-time PCR. The results confirmed that the expression of miR-1976, miR-153, miR-103a, and miR-29q was significantly upregulated in PD patients, while the expression of miR-210, miR-375, miR-146a, and miR-101a was significantly downregulated in PD patients compared with controls. Of these miRNAs, the greatest difference was observed in the expression of miR-1976, with the PD cohort having a 5.64 $\times$ higher expression than the control group (p 0.01) (Fig. 1b). Given the large difference observed for miR-1976 expression between the PD patient and control cohorts, we hypothesized that a higher level of miR-1976 might be relevant to the development of PD.

The expression level of miR-1976 was determined in PD patients and normal controls using real-time PCR. Results showed that miR-1976 was significantly upregulated in the serum of PD participants compared with that of matched non-PD controls (Fig. 1c). We then examined the sequence conservation of miR-1976 among different species via miRBase searching. Alignment results showed that the sequence “CCUCCUGCCCUCCUUGCUGU” had high conservation among many species, including humans, Macaca mulatta, horses, house mice, zebrafish, Rattus norvegicus, tropical clawed frogs, Pongo pygmaeus, and ornithorhynchus anatinus (Table 3).

To evaluate the overexpression of miR-1976 on apoptosis of MES23.5 cells, the miR-1976 mimics or mock control mimics were transfected using liposomes into MES23.5 cells. Real-time PCR confirmed the high overexpression at 12 h, 24 h, and 36 h post-transfection (Fig. 2a). The effects of miR-1976 overexpression on cell apoptosis were subsequently further evaluated. The FITC staining results showed more apoptotic bodies observed under the electron microscope when cells were transfected with miR-1976 mimics (Fig. 2b). Similarly, the overexpression of miR-1976 showed a strong cell apoptotic rate as reflected using a flow cytometry chart (Fig. 2c,d).

Fig. 2.

Overexpression of miR-1976 increased apoptosis of dopaminergic neurons. (a) Overexpression of miR-1976 was verified using real-time PCR. (b) Apoptotic bodies stained with FITC observed under the electron microscope. (c,d) Cell apoptosis rate reflected using a flow cytometry chart. (e) MiR-1976 induced greater cell apoptotic bodies in C57/BL mice. (f) MiR-1976 induced more cell apoptosis shown via the TUNEL assay. NC, normal control. TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling. ***, p 0.001; **, p 0.01; *, p 0.05; ${}^{\mathrm{\#}}$, p $>$ 0.05.

For the in-vivo study, the effects of overexpression of miR-1976 on the dopaminergic neuronal cells of mice were assessed by constructing an overexpressing miR-1976 mouse model that involved injecting miR-1976 mimics via a lentiviral vector into the substantia nigra of C57/BL mice. As a result, miR-1976 induced more cell apoptotic bodies with relatively integrated cell cytomembranes and organelles (Fig. 3e). These results were supported by the TUNEL assay, which showed cell apoptosis in the group treated with the miR-1976 mimics (Fig. 3f). Collectively, these data suggest that the miR-1976-induced nerve cell apoptosis might be crucial in the development of PD.

Fig. 3.

The prediction and analysis of miR-1976 target genes. (a) The effect of miR-1976 on the PINK or MAPK signaling pathways. (b) The target sequence of miR-1976 in PINK1 was detected using TargetScan. (c) Dual-luciferase assay demonstrated that the PINK1 expression was regulated by miR-1976. NC, normal control. ***, p 0.001; **, p 0.01; *, p 0.05; ${}^{\mathrm{\#}}$, p $>$ 0.05.

Using the GO and pathway programs, as well as the microarray that we had performed in our preliminary study, we identified that phosphatidylinositol 3-kinase (PI3K) was a predicted target of miR-1976. Furthermore, bioinformatics analysis identified two pathways (PINK1 and MAPK-mitogen-activated protein kinase) that were significantly correlated with miR-1976 (p 0.0001).

To detect the effects of miR-1976 on the PINK or MAPK signaling pathways, the mRNAs of the proteins PINK1, MAPK4, 6, 16, and BP1 (binding protein1) were evaluated via real-time PCR in miR-1976 mimic treated MES23.5 cells or empty vector treated cells (NC). Results showed that the high expression of miR-1976 significantly inhibited the expression of PINK1 (p 0.05) but showed no significant effect on expression of proteins of the MAPK signaling pathway. These results indicated that the PINK1 signaling pathway might be a target pathway of miR-1976 (Fig. 3a).

We subsequently explored whether the target sequence of miR-1976 was in PINK1. We found that PINK1 harbors one conserved miR-1976 cognate site named 89-91 of PINK1 3’-UTR (Fig. 3b), which is a predicted target of miR-1976. To identify whether PINK1 expression was indeed regulated by miR-1976, the PINK1 3’-UTR was cloned into a luciferase reporter plasmid (Fig. 3c) that was used to quantify the ability of miR-1976 to inhibit expression of the PINK1 coding region. The luciferase assay showed that miR-1976 suppressed luciferase activity when the reporter plasmid carried the wild type PINK1 3’-UTR. However, no significant suppression was observed when the reporter plasmid carried a mutant PINK1 3’-UTR. These results demonstrated that miR-1976 directly binds to the predicted binding site in the PINK1 3’-UTR.

To detect the effect of PINK1 on dopamine neuronal cells, we constructed the PINK1 shRNA lentivirus vector to infect MES23.5 cells. We first observed cell apoptosis using flow cytometry at 0-, 12-, 24-, and 36-h time points after transfection. As shown in Fig. 4a, low expression of PINK1 induced more cell apoptosis in a time-dependent fashion, indicating that the inhibition of PINK1 regulated cell apoptosis. This result was supported by the observed changes in mitochondrial morphology, which showed that the number of mitochondria was reduced with increased time. Furthermore, relative to the 0-h time point, a greater number of physalides and fewer mitochondrial cristae were found at the 36-h mark (Fig. 4b).

Fig. 4.

Silencing of PINK1 expression increases the apoptosis of MES23.5 cells and affects the morphology of mitochondria. (a) Cell apoptosis was observed via flow cytometry at 0-, 12-, 24-, and 36-h time points after transfection. (b) Electron microscopy showed more physalides and fewer mitochondrial cristae. NC, Normal control. ***, p 0.001; **, p 0.01; *, p 0.05; ${}^{\mathrm{\#}}$, p $>$ 0.05.