Eight-month-old male APP/PS1 transgenic mice (APPswe/PSEN1dE9) were purchased from Shanghai Research Center, and age- and sex-matched wild-type (WT) C57BL/6 mice were purchased from Vital River Laboratory Animal Technology Company Limited (Beijing, P. R. China). All animals were housed in the animal house of the Institute of Brain Science, Shanxi Datong University. The Ethics Committee approved all experiments of Shanxi Datong University, Datong, P. R. China.

APP/PS1 double transgenic mice were randomly divided into two groups: An APP/PS1 transgenic mice group (APP group, n = 8) and a Fasudil-treated APP/PS1 transgenic mice group (APP + Fa group, n = 8). Age- and sex-matched wild-type (WT) male C57BL/6J mice served as controls (WT group, n = 8). Groupings were blind during behavioral tests and analysis.

Fasudil (Tianjin Chase Sun Pharmaceutical Co., Ltd.) was dissolved in a sterile saline solution. The APP + Fa group was treated with Fasudil (25 mg/kg $\cdot$ day) for two months by intraperitoneal injection, starting at eight months. In the APP and WT groups, mice were injected with the same volume of 0.9% NaCl.

Morris water maze (MWM) tests were performed as described previously (Yu et al., 2018). Briefly, the MWM was a 90 cm diameter pool, containing a transparent platform (5 $\times$ 5 cm) below the water surface in the center of the target quadrant (internal SW zone) of the pool. The pool was filled with opaque water and maintained at around 19 ${}^{\circ }$ C. Animals individually underwent five consecutive days of training, four times a day, in the pool before testing. If a mouse failed to reach the hidden platform within 60 s, they were guided to the platform to rest for 10 s and learn its location. Each mouse’s swimming trajectory was recorded by an automated video acquisition and analysis system (SMART V3.0 system, Panlab, Barcelona, Spain). A probe trial was carried out 24 hours after the final training trial. The platform was removed, and mice were placed into the pool and swim freely for 60 s. Swimming trajectories within the 60 s were video recorded and analyzed. Latency to target, mean distance to target, and latency to first entrance to the SW zone were measured for each mouse to assess the degree of memory consolidation.

The Y-maze test was based on a previously described method (Xu et al., 2018) to test short-term memory functions. The Y-maze consists of three symmetrical opaque arms (30 cm long, 8 cm wide, 15 cm high), randomly designated as novel, start or other arms. During the training period, the novel arm was blocked, and mice freely explored the maze’s remainder for 10 min. Between tests, the maze was wiped with 75% ethanol to eliminate olfactory cues from previous mice. All trials were recorded, and the spontaneous alternation rate between maze arms was calculated using the following equation: alternations (%) = (sequence of arm choices)/(total arm choices - 2) $\times$ 100.

An in situ cell death detection kit (Beyotime Biotechnology) was used to detect apoptotic cells with Deoxyuride-5’-triphosphate biotin nick end labeling (TUNEL) assay, as per the manufacturer’s protocol. Half the mice were briefly anesthetized and perfused with saline and 4% paraformaldehyde in phosphate buffer (PBS, 0.01 M, pH 7.4). Brain tissue was collected, frozen in liquid nitrogen and cut into 10 $\mu$ m thick coronal sections for the TUNEL assay. Slides were washed for five minutes three times with PBS at 25 ${}^{\circ }$ C for then permeabilized with 0.3% Triton X-100 for five minutes. Tissues were then submerged in fluorescein TUNEL reagent for 10 minutes at 37 ${}^{\circ }$ C. Nuclei were counterstained with 4 ${}^{\prime }$ , 6-diamidino-2-phenylindole (DAPI; 1 $\mu$ g/mL) for five minutes then washed. Slides were visualized (FV1200 software) under a confocal laser scanning microscope (CLSM, Olympus, Tokyo, Japan). A quantitative analysis of the number of positive cells was performed (Image-Pro Plus 6.0 software).

For double immunohistochemistry, sections were incubated with 0.3% Triton X-100 in 1% bovine serum albumin (BSA) - phosphate buffer saline (PBS) for one hour to block unspecific binding, then incubated at 4 ${}^{\circ }$ C overnight with the following primary antibodies: anti-NeuN/A $\beta$ (Cell Signaling Technology), anti-NeuN/NogoA (Cell Signaling Technology), anti-NeuN/NgR (Cell Signaling Technology), anti-NeuN/P75NTR (Cell Signaling Technology) and anti-synaptophysin (Cell Signaling Technology). Sections were then incubated with the corresponding secondary antibodies at room temperature for two hours. Sections were visualized under a confocal laser scanning microscope. Quantitative analysis of the area (polygon) of positive cells was then carried out (Image-Pro Plus software).

Half of the mice were anesthetized and perfused with saline only. Total brain RNA was extracted (Total RNA extraction kit, Promega, USA) and reverse transcribed (Promega, USA) for complementary DNA synthesis. The GoTaq ${}^{\mathrm{\circledR }}$ Green Master Mix (Promega, USA) was then used to perform polymerase chain reaction (PCR) amplification reactions. Image Lab software (Bio-rad, Hercules, CA, USA) was used to determine the target genes’ relative expression levels. According to previous publications, the primers used were synthesized (Kan et al., 2017; Liddelow et al., 2017). Sequences included: growth-associated protein 43(Gap43): (FWD- AAACAAGCCGATGTGCCT, REV- CTTTACCCTCATCCTGTCG, 181bp), NgR: (FWD- GTTGTGCTGTGGCTTCGG, REV- CCATTGCCTGGTGGAGTGT, 192bp), p75NTR: (FWD- ATTCCTGTCTATTGCTCCATCT, REV- CCTGAGGCAGTCTGCGTAT, 224bp), NogoA: (FWD- AGTAGTAGCACCTGTGAGGGAAGA, REV- AAAGGGAAAGTGTTTGCTGTGG, 309bp), LINGO-1: (FWD- CTGGACATCAGCGAGAAC AAGA, REV- GGAAAGATTGAGGAAACGGAGATA, 444bp), glyceraldehyde-3-phosphate dehydrogenase (GAPDH): (FWD- AAGAGGGATGCTGCCCTTAC, REV- TACGGCCAAATCCGTTCACA, 119bp).

Equal amounts of protein (50 $\mu$ g) were separated on sodium dodecyl sulfate (SDS) - polyacrylamide gel electrophoresis (PAGE) gels and transferred onto a polyvinylidene fluoride (PVDF) membrane (Immun-Blot, BD). Membranes were blocked with 5% non-fat milk for two hours at room temperature and incubated at 4 ${}^{\circ }$ C overnight with the following primary antibodies: anti-A $\beta$ (Cell Signaling), anti-p-tau (Cell Signaling), anti-NogoA (Cell Signaling), anti-NgR (Cell Signaling), anti-P75NTR (Cell Signaling), anti-LINGO-1 (Cell Signaling), anti-synaptophysin (Cell Signaling), anti-ROCK2 (Cell Signaling), anti-p-ROCK2 (Cell Signaling), anti-Bax (Abcam), anti-Bcl-2 (Abcam), anti-Cleaved caspase-3 (Abcam) and anti-GAPDH (Cell Signaling) antibody. Immunoblots were incubated at room temperature for two hours with HRP-conjugated secondary antibodies and visualized using a chemiluminescence (ECL) kit under the ECL system (Bio-rad, Hercules, CA, USA). Band intensities were quantified with the Image Lab Software (Bio-rad, Hercules, CA, USA).

All statistical analyses employed GraphPad Prism 5.0 (GraphPad Software, San Diego, CA). Data are presented as mean $\pm$ SEM. Two-way ANOVA was used for escape latency analysis. One-way analysis of variance followed by Dunnett’s post hoc test was used to compare data between the groups. Statistical significance was assumed at P 0.05.

Initially, an MWM test was conducted to evaluate Fasudil’s effects on cognitive function in APP/PS1 transgenic mice. Representative swimming paths and the behavioral performance of mice in each group are displayed in Fig. 1a. These data indicate that APP/PS1 mice performed more unnecessary swimming. In the five-day initial training period, APP/PS1 Tg mice exhibited an increased latency and mean distance to the target (finding the hidden platform) compared to WT mice. Fasudil-treated mice showed reduced latency and mean distance to target compared to APP/PS1 Tg mice. However, there was no significant difference between groups in mice’s time to locate the hidden platform (Fig. 1b). The platform was removed on the sixth day, and mice were placed into the pool and allowed to swim freely for 60 seconds. APP/PS1 transgenic mice exhibited an increased latency and mean distance to target and latency to first entrance to the SW zone when compared with WT mice (Fig. 1c). This suggests that APP/PS1 transgenic mice exhibited cognitive deficits. However, this effect was partly reversed by Fasudil treatment, as evidenced by the significantly shorter time taken and distance traveled to reach the platform from the starting point on to the platform exhibited by Fasudil-treated APP/PS1 transgenic mice when compared with APP mice (Fig. 1c).

Fig. 1.

Fasudil improves spatial learning of APP/PS1 Tg mice. Eight-month-old APP/PS1 Tg mice were injected with saline (n = 8) or Fasudil (n = 8) for two months. (a) Typical diagram of the Morris water maze test and the corresponding parameters. (b) Latency to target and mean distance to target for five consecutive daily tests. (c) On the sixth day, latency to target, mean distance to target, latency to first entrance to the SW zone were recorded in a retention test session, representing the time spent and distance traveled by animals from the starting point onto the platform or to the SW zone. (d) Typical diagram of the Y maze tests. (e) The percentage of time spent in the novel arm and the spontaneous alternation rate of each group in Y maze tests. Quantitative results for several parameters are mean $\pm$ SEM of the eight mice in each group. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

Following the MWM trials, mice’s behavioral performance was assessed in the Y maze (Fig. 1d). Results showed that APP mice spent less time in the novel arm and exhibited a lower spontaneous alternation rate than the WT group (Fig. 1e). Following Fasudil treatment, the time spent in the novel arm and the spontaneous alternation rate was increased significantly (Fig. 1e). This suggests that Fasudil could rescue learning and memory deficits.

The pathogenesis of AD involves an abnormal accumulation of A $\beta$ and tau in the brain. The formation of A $\beta$ plaques and tau protein contributes to neuronal apoptosis and learning and memory deficits (van der Kant et al., 2020). To evaluate Fasudil’s effect on the formation of A $\beta$ and tau, the levels of A $\beta$ and p-tau in mice that underwent MWM tests were investigated. Using immunofluorescent staining, A $\beta$ deposits were observed in the cortex and hippocampus area CA1 of APP mice. Fasudil treatment was found to significantly reduce the expression of A $\beta$ (Fig. 2a and 2b). Additionally, results showed that Fasudil administration increased the number of NeuN immunopositive cells in the cortex and hippocampus area CA1 of APP/PS1 transgenic mice (Fig. 2a and  2b). Finally, Western blots confirmed that Fasudil administration decreased A $\beta$ and p-tau protein levels in the brain of APP/PS1 transgenic mice (Fig. 2c).

Fig. 2.

Fasudil reduces A $\beta$ and p-tau deposition and neural apoptosis in hippocampus area CA1 of APP/PS1 mice. (a) Immunofluorescence image of neurons (NeuN, green) and A $\beta$ (red) in the hippocampus area CA1 of mice. Quantitative analysis of area (polygon) of A $\beta$ ${}^{+}$ cells and the number of NeuN immunopositive cells. (b) Immunofluorescence image of neurons (NeuN, green) and A $\beta$ (red) in mice’s cortical area. Quantitative analysis of area (polygon) of A $\beta$ ${}^{+}$ cells and the number of NeuN immunopositive cells. (c) Detection of A $\beta$ and p-tau in the brain by Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

Another pathological feature of APP transgenic mice is neuronal apoptosis in the hippocampus (Obulesu and Lakshmi, 2014). TUNEL assay revealed apoptosis in APP mice’s brain tissue was significantly increased compared with the WT mice, while apoptosis was markedly reduced in APP + Fa mice (Fig. 3a). To further explore the anti-apoptotic effects of Fasudil in APP/PS1 transgenic mice, protein levels involved in apoptosis were analyzed via Western blot. Results showed that following Fasudil treatment, expression of the pro-apoptotic proteins cleaved-caspase-3 and Bax decreased significantly, while the expression of anti-apoptotic protein Bcl-2 increased significantly in APP/PS1 Tg mice (Fig. 3b).

Fig. 3.

Fasudil inhibits apoptosis in the brain of APP/PS1 mice. (a) Representative images of TUNEL staining in hippocampus area CA1 of mice and the number of TUNEL immunopositive cells. (b) Detection of cleaved-caspase-3, Bax and Bcl-2 protein levels in brains by Western blot and quantitative results of Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

Synaptic dysfunction is another pathological characteristic of AD, contributing to cognitive function loss (Bello-Medina et al., 2019). Levels of synaptophysin and Gap43, key markers for functional synapses, are significantly reduced in AD transgenic mouse models (Bereczki et al., 2018; Goetzl et al., 2016). For these reasons, the expression of synaptophysin and Gap43 in the brain were investigated to test whether Fasudil may improve synaptic function. In the APP mouse brain, the expression of synaptophysin was significantly reduced compared to WT mice, while its expression was greatly improved after Fasudil treatment (Fig. 4a). Similarly, Gap43 mRNA and protein expression in APP + Fa mice’s brain was increased compared to untreated APP mice (Fig. 4b). This indicates that Fasudil’s positive effect on learning and memory may be related to an upregulation of synaptophysin and Gap43.

Fig. 4.

Effect of Fasudil on synaptophysin and Gap43 expression. (a) Detection of synaptophysin in hippocampus area CA1 of mice by immunofluorescence staining and Western blot. Quantitative analysis of area (polygon) of synaptophysin ${}^{+}$ cells and the gray value ratio between synaptophysin and GAPDH. (b) Detection of Gap43 mRNA and protein levels in brains by RT-PCR and Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

Previous studies have shown that Nogo-A/NgR is closely related to AD’s pathogenesis by regulating the metabolism of A $\beta$ and neurodegeneration (Xu et al., 2015). Therefore, Fasudil’s effect on Nogo-A in the brain was explored by immunofluorescence, Western blot and RT-PCR. Immunofluorescence staining revealed that NogoA- expression in the cortex and hippocampus was significantly reduced in the APP + Fa group compared to the untreated APP group (Fig. 5a and 5b). Likewise, the mRNA and protein levels of Nogo-A were also significantly decreased after Fasudil treatment (Fig. 5c).

Fig. 5.

Fasudil inhibits the expression of NogoA. (a) Immunofluorescence image of neurons (NeuN, green) and NogoA (red) in hippocampus area CA1 of mice and quantitative analysis of area (polygon) of NogoA ${}^{+}$ NeuN ${}^{+}$ cells. (b) Immunofluorescence image of neurons (NeuN, green) and NogoA (red) in the cortex of mice and quantitative analysis of area (polygon) of NogoA ${}^{+}$ NeuN ${}^{+}$ cells. (c) Detection of NogoA mRNA and protein levels in brains by RT-PCR and Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

The expression of the Nogo-A receptor complex, NgR/p75NTR/LINGO-1, was next investigated. Compared with the APP group, the expression of NgR in the cortex and hippocampus was reduced in APP + Fa mice (Fig. 6a and 6b). Similarly, Western blot and quantitative mRNA analysis revealed that the protein and mRNA levels of NgR in the brain were significantly decreased after Fasudil treatment (Fig. 6c). Similar results were found for other components of the Nogo-A receptor complex, including p75NTR and LINGO-1. Furthermore, the protein and mRNA levels of p75NTR and LINGO-1 were significantly increased in APP mice compared with WT mice, but this was rescued by Fasudil treatment (Fig. 6d).

Fig. 6.

Fasudil inhibits the expression of the NgR/p75NTR/LINGO-1 receptor complex. (a) Immunofluorescence image of neurons (NeuN, green) and NgR (red) in hippocampus area CA1 of mice and quantitative analysis of area (polygon) of NgR ${}^{+}$ NeuN ${}^{+}$ cells. (b) Immunofluorescence image of neuron cells (NeuN, green) and NgR (red) in the cortical area of mice and quantitative analysis of area (polygon) of NgR ${}^{+}$ NeuN ${}^{+}$ cells. (c) Detection of NgR mRNA and protein level in brains by RT-PCR and Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. (d) Detection of p75NTR and LINGO-1 mRNA and protein levels RT-PCR and Western blot. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{*}$ P 0.05, ${}^{**}$ P 0.01, ${}^{***}$ P 0.001.

Previous studies have provided substantial evidence that Fasudil inhibits the ROCK pathway and promotes neuroregeneration and remyelination (Li et al., 2017; Wang et al., 2020). Here, ROCK2 and phospho (p)-ROCK2 protein was quantified in the brain of Fasudil-treated and untreated APP mice. Expression of ROCK2 and p-ROCK2 was found to be significantly reduced after Fasudil treatment. Additionally, the activity of ROCK2, measured as the proportion of p-ROCK2 and total ROCK2, was found to be decreased after Fasudil treatment (Fig. 7).

Fig. 7.

Fasudil inhibits the rhoA/ROCK pathway. Detection of ROCK2 and phospho-ROCK2 by Western blot. Quantitative results of Western blot are expressed as fold changes relative to GAPDH bands and ratio of gray values between p-ROCK and ROCK. Quantitative results are mean $\pm$ SEM from three independent experiments. ${}^{***}$ P 0.001.