Background: Interferons are inducible secretory glycoproteins with
immunomodulators, antiviral, antiangiogenic and antiproliferative
effects. Evaluate the mechanisms responsible by regression of patients diagnosed
with Cervical Intraepithelial Neoplasia (CIN) and treated with IFN-
The Human Papilloma Virus (HPV) infection is the leading cause of cervical
cancer and a relevant factor in the development of anogenital cancer (anus,
vulva, vagina, and penis) as well as head and neck cancer. HPV 16 and HPV 18 are
responsible for about 70% of all cervical cancer cases worldwide [1]. The
proteins E6 and E7 from HPV are able to interfere with several mechanisms in the
infected keratinocytes, including the synthesis of Interferon-alpha cytokine
(IFN-
The expression of STAT-1 has an essential role in viral pathogenesis, been necessary for genome amplification and maintenance of episomes, however the HPV infection, between the oncoproteins E6 and E7 suppressed this transcription factor at transcriptional level [3].
Type I interferons (IFN-
A study realized by Li et al. [6] concluded that DNA binding ability and ISGF-3 (Interferon-Stimulated Gene Factor) transactivation are decreased in cells expressing HPV-18 E6 protein after IFN treatment, resulting in decreased phosphorylation of TYK2, STAT2, and STAT-1. This fact was explain through HPV-18 E6 proteins physical interaction with TYK-2 binding to the cytoplasmic portion of IFNAR1, thereby inhibiting the pathway to IFN activation [7].
The most common treatments of CIN are surgical, such as conization, LEEP (loop electrical excision procedure), and hysterectomy. However, the patients are of reproductive age and these surgical treatments imply difficulty in getting pregnant and maintaining the pregnancy to term, a fact before which researchers around the globe have been dedicating their efforts in order to guide and stimulate the consolidation of healthy polices and secondary strategies that collaborate with prevention, diagnosis and early treatment of cervical cancer.
It is in this scenario that the potential of immunotherapy as a treatment option has been progressively acknowledge, either through its application coextending surgical procedure or in isolation. Immunotherapy currently includes the application of vaccines, recombinant viral proteins, monoclonal antibodies, cytokines, and dendritic cells [8]. In this context, the use of IFN-alpha becomes relevant by their potential to act as antiviral, immunomodulatory, antiangiogenic, and antiproliferative in several cell types. And consequently, assuming ample potential due to their antitumor effect, which has been handled in several studies on the subject. A study demonstrated that patients with cervical intraepithelial neoplasia showed a systemic increase in the number of T lymphocytes that express IFNR1 and IFNR2 [9].
The purpose of this study is elucidated the mechanisms of tumor regression
involved in vivo immunotherapy with IFN-
A prospective study was conducted at the Maria da Glória outpatient clinic,
in the Gynecology and Obstetrics Discipline of the Hospital School of the Federal
University of the Triângulo Mineiro. Eighteen Patients with CIN II–III with
18 to 82 years of age, were included in the study. Were adopted as inclusion
criteria for the patients in the study without any previous treatment, absence of
bleeding during the examination; no sexual activity for two days preceding sample
collection; no use of oral antibiotics, vaginal fungicides or creams over the
previous 30 days; previous history of treatment for HPV; and no colposcopic
change
The clinical evaluation of the patients consisted of colposcopic examination and histological analysis. Therefore, colposcopy showed the disappearance or regression of the lesion, and it was confirmed by histological analysis from biopsy, with regression to CIN I or no CIN, the treatment was considered as a right, characterizing the responsive group. The patients were submitted to follow-up with cytology and colposcopy every 6 months. If no regression of the lesion was observed at the colposcopic examination, confirming the persistence of CIN II or III in biopsies, failure of the treatment was considered, characterizing the without response group. All patients with CIN II and III were immediately submitted to cold knife conization (Table 1).
Patient | Age | Smoker | Initial diagnosis | Final diagnosis | Treatment outcome |
1 | 36 | No | CIN III | Normal Epithelium | Regression |
2 | 82 | No | CIN III | CIN III | Without Response |
3 | 54 | No | CIN III | Normal Epithelium | Regression |
4 | 28 | No | CIN II | Normal Epithelium | Regression |
5 | 32 | No | CIN III | CIN III | Without Response |
6 | 35 | No | CIN III | CIN III | Without Response |
7 | 18 | No | CIN II | CIN II | Without Response |
8 | 34 | No | CIN II | CIN II | Without Response |
9 | 38 | No | CIN III | CIN II | Regression |
10 | 37 | No | CIN III | CIN III | Without Response |
11 | 34 | No | CIN III | CIN II | Without Response |
12 | 47 | No | CIN III | Normal Epithelium | Regression |
13 | 26 | No | CIN III | Normal Epithelium | Regression |
14 | 24 | Yes | CIN II | CIN II | Without Response |
15 | 28 | Yes | CIN II | Normal Epithelium | Regression |
16 | 60 | No | CIN III | CIN III | Without Response |
17 | 42 | No | CIN III | CIN III | Without Response |
18 | 33 | No | CIN III | CIN III | Without Response |
CIN, Cervical Intraepithelial Neoplasia. |
Human recombinant pegylated IFN-
Peripheral blood samples were drawn from the patients, and cells were evaluated by flow cytometry (BD FACS Calibur cytometer and cell sorter, BD Biosciences, Franklin Lakes, NJ, USA). Cytometry protocols were deployed in accordance with those suggested by the manufacturer. The peripheral blood cells were verify by: T lymphocytes (CD3+, CD4+, and CD8+) and macrophages (CD14+). The procedure was performed in prior (pretreatment), to the 3rd and 6th application.
Briefly, leukocytes were isolated from peripheral blood samples via
centrifugation at 4
After extracellular tagging, the cells were incubated at 4
For intracellular verification, the cells were incubated with the following
antibodies (according to the fluorochrome extracellular antibodies) for 30 min at
4
RNA was extracted from cervical cells of biopsies using Trizol reagent (Invitrogen) obtained from all patients. cDNA synthesis was performed with Superscript III rt (Invitrogen). Quantitative PCR was performed with GoTaq qPCR Master Mix (Promega) using the 7900 HT Fast Real-Time PCR System (Applied Biosystems). Nucleotide sequence of prime with annealing temperature is in Table 2.
Primer | Nucleotide sequence primer | Temperature | Primer | Amostra |
5′GTGGGGCGCCCCAGGCACCA3′ | 60 ºC | 2 |
1 | |
5′CTCCTTAATGTCACGCACGATTTC3′ | 60 ºC | 2 |
1 | |
IFNR1 Forward | 5′-CTTTCAAGTTCAGTGGCTCCACGC-3′ | 60 |
1.5 |
3 |
IFNR1 Reverse | 5′-TCACAGGCGTGTTTCCAGACTG-3′ | 60 |
1.5 |
3 |
IFNR2 Forward | 5′-GAAGGTGGTTAAGAACTGTGC-3′ | 60 |
1 |
2 |
IFNR2 Reverse | 5′-CCCGCTGAATCCTTCTAGGACGG-3′ | 60 |
1 |
2 |
IFN- |
5′-ACTTTGGATTTCCCCAGGA-3′ | 60 |
1 |
2 |
IFN- |
5′-CAGGCACAAGGGCTGTATT-3′ | 60 |
1 |
2 |
Interferon- |
An electronic database was developed for the statistical analysis. Variables
were analysed with the GraphPad Prism 4.0 program. Values were submitted to
Mann-Withney or Kruskal Wallis test. Differences with p
The Tables 3 and 4 demonstrate the means of the general values of flow cytometry,
representing the mean of values of the number of lymphocytes and monocytes
peripheric and the intensity of fluorescence of transcriptions factors involved
of activation of IFN-
Celular type and transcriptions factors | Groups | ||||||
% Gate (mean of fluorescence intensity) | |||||||
Pre-therapy | 3rd Application | 6th Application | |||||
CD4 | IRF-7 | 7.22 | (29.47) | 16.08 | (29.77) | 7.25 | (31.16) |
STAT-1 | 12.28 | (49.02) | 15.83 | (29.92) | 6.747 | (31.84) | |
IFN-alpha | 8.07 | (28.56) | 15.91 | (30.69) | 6.42 | (30.29) | |
IFNR1 | 7.72 | (28.77) | 13.96 | (30.39) | 8.42 | (38.13) | |
IFNR2 | 8.45 | (30.49) | 14.21 | (30.08) | 8.63 | (33.42) | |
CD8 | IRF-7 | 17.27 | (38.53) | 18.86 | (39.18) | 12.08 | (29.49) |
STAT-1 | 17.33 | (41.47) | 18.95 | (39.25) | 13.06 | (30.86) | |
IFN-alpha | 16.71 | (37.29) | 18.74 | (37.77) | 12.07 | (29.17) | |
IFNR1 | 17.61 | (41.75) | 19.77 | (42.04) | 13.52 | (30.03) | |
IFNR2 | 17.97 | (39.45) | 19.91 | (41.30) | 13.54 | (30.89) | |
CD14 | IRF-7 | 0.60 | (46.98) | 2.19 | (54.60) | 5.49 | (55.58) |
STAT-1 | 0.82 | (47.95) | 2.40 | (55.71) | 2.21 | (56.79) | |
IFN-alpha | 0.63 | (49.15) | 1.84 | (55.65) | 1.36 | (58.65) | |
IFNR1 | 4.18 | (133.2) | 2.34 | (55.88) | 3.94 | (52.34) | |
IFNR2 | 1.28 | (44.49) | 2.27 | (54.94) | 2.77 | (53.55) | |
Distribution of values mean expression of IFN-alpha, IFNR1 and IFNR2, IRF-7, STAT-1 in T lymphocytes helper (CD4+), cytotoxic (CD8+) and monocytes (CD14+) obtained from periferic blood of patients with regression of lesion. |
Celular type and transcriptions factors | Groups | ||||||
% Gate (mean of fluorescence intensity) | |||||||
Pre-therapy | 3rd Application | 6th Application | |||||
CD4 | IRF-7 | 4.50 | (23.41) | 2.53 | (30.55) | 6.57 | (28.86) |
STAT-1 | 9.14 | (20.30) | 4.47 | (25.59) | 9.43 | (27.26) | |
IFN-alpha | 8.16 | (24.05) | 2.50 | (22.21) | 5.70 | (23.11) | |
IFNR1 | 6.15 | (24.07) | 2.61 | (29.01) | 6.67 | (31.19) | |
IFNR2 | 6.26 | (24.32) | 2.90 | (30.80) | 7.11 | (28.46) | |
CD8 | IRF-7 | 11.73 | (36.33) | 12.93 | (35.89) | 16.95 | (31.17) |
STAT-1 | 10.32 | (33.32) | 14.34 | (40.53) | 15.18 | (30.99) | |
IFN-alpha | 10.40 | (36.17) | 13.95 | (41.07) | 14.85 | (29.68) | |
IFNR1 | 13.32 | (38.49) | 15.24 | (40.67) | 16.96 | (31.50) | |
IFNR2 | 13.40 | (37.55) | 13.44 | (39.38) | 13.62 | (28.99) | |
CD14 | IRF-7 | 1.82 | (100.9) | 1.85 | (54.65) | 4.26 | (53.33) |
STAT-1 | 2.40 | (68.28) | 1.88 | (53.39) | 3.13 | (52.65) | |
IFN-alpha | 1.61 | (54.89) | 2.14 | (61.52) | 2.77 | (51.89) | |
IFNR1 | 1.63 | (86.02) | 2.92 | (56.86) | 2.77 | (55.83) | |
IFNR2 | 2.64 | (74.00) | 2.12 | (54.40) | 4.94 | (54.19) | |
Distribution of values mean expression of IFN-alpha, IFNR1 and IFNR2, IRF-7, STAT-1 in T lymphocytes helper (CD4+), cytotoxic (CD8+) and monocytes (CD14+) obtained from periferic blood of patients without regression of lesion. |
When comparing treatment phases with lesion regression in systemic helper T
lymphocytes (CD3+, CD4+), patients who did not achieve lesion regression showed a
significant increase on both IFNR1 (p = 0.0336) and IFNR2 (p =
0.0165) during the 3rd application and a decreasing during the 6th application.
Likewise, the STAT-1, IRF-7, and IFN-
Number (%) of helper T lymphocytes positive for IFN-
By analyzing systemic cytotoxic T lymphocytes (CD3+, CD8+), when comparing the treatment phases with the lesion regression, a significant reduction in IFNR1 (p = 0.0391) was observed in patients who did not obtain lesion regression when comparing the 3rd and 6th applications (Fig. 2). Unlike helper T lymphocytes, cytotoxic T lymphocytes showed no discrepancy in IFNR1 and IFNR2 expression.
Expression (MFI) of IFN-
Fig. 3 shows the local expression of IFNR1, IFNR2 and IFN-
Expression of IFN-
The graphs of Fig. 4 illustrate de comparation of % Gate mean in systemic T
helper lymphocytes and the expression of IFNR1, IFNR2, IFN-
Comparation of IFN-
The balance in the cellular expression of IFNR1, IFNR2 results in a good response to treatment with IFN-alpha, activating the intracellular pathways.
Interferons (IFNs) are pleiotropic cytokines (they have multiple effects on different cells) and have been widely studied for the treatment of tumors. They were discovered in the 1950s and initially classified as proteins produced by cells of the immune system in response to viral infections [10].
IFNs are known for their ability to induce an activated state of infected cells, having an important characteristic of inducing antiviral factors, interfering in various stages of the viral replication cycle [11]. In addition, they have functions that influence the innate and adaptive immune response, not only in viruses, but also in bacterial pathologies, as well as having a potent antiproliferative activity, essential for the blocking of the growth and immune survival of tumor cells [12].
Peginterferon-
Several data of our group indicate that there is essential differences between
the in lesion regression when the patients were submitted to immunotherapy. A
case report has shown a successful pregnancy after the patient was treated with
intralesional IFN-
Experimental and clinical data have demonstrated that locally and systemically
cytokine treatment can induce tumor regression. Moltó et al. [16]
concluded that patients with bladder tumors had no recurrence of the disease and
had a significant increase in proliferative response in peripheral mononuclear
cells after underwent treatment with IFN-
The interaction of IFN-
There is also the presence of soluble cytokine receptors in body fluids that can
modulate immunologic activity during homeostasis and disease. Soluble receptors
of IFNR2 are found in serum, urine, salve, peritoneal fluid, and they may
inactivate the action of IFN-
Besides host cells to produce IFNARs during viral infections, certain viruses have evolved to produce a soluble form of IFNR as a mean of evading the immune system. The poxvirus, for example, encodes a homologous soluble receptor of IFN that neutralizes type I IFN, which becomes essential for its virulence and is an escape mechanism of the immune system [30].
Our study, during the 3rd application, demonstrated patients who did not obtain regression of their lesions showed a significant increase in IFNR1 and IFNR2 in CD4+ T lymphocyte when compared to patients who obtained regression. However, this increase was not observed during the 6th application. In CD8+ T lymphocytes, the number of IFNR1- labeled cells in patients who did not have lesion regression was significantly reduced from the 3rd to the 6th applications. These data demonstrated that patients who do not respond to the treatment have higher levels of sistemic T helper cells with IFNR1 and IFNR2 than those who respond to the treatment.
Zhang et al. [31] concluded in their study that cells from bladder
tumors presented low expression of IFNR1 and IFNR2 when compared to cells from
healthy tissue, which demonstrates resistance to immune therapeutic treatment
with IFN-
Already the interaction between IFNRs and cytoplasmic transcriptional factors is significant for the activation of immune response activator genes. Researches have shown that cells that express E6 protein from HPV-18 demonstrated to have a decreased capacity of binding on DNA and transactivation of ISGF-3 transcription factors. E6 proteins impair phosphorylation of STAT-1 and STAT2 by physically interacting with Tyk-2 [32].
The present study demonstrated that there was a significant increase in
STAT-1-labeled CD4+ T lymphocytes in patients who did not obtain regression of
lesion during the 3rd application, however, this increase was not maintained
until the 6th application. The production of cytokines in the tumor
microenvironment influences the expression of transcriptional factors. Nguyen
et al. [33] has presented that the absence of STAT-1 leads to inhibition
of the IFN-
STAT-1 transcription factor plays an essential role in responses mediated by
IFN-
The family of the Regulator Factor of IFN-
By analyzing the systemic immune response through the evaluation of the presence of IRF-7 in helper and cytotoxic T lymphocytes, it was observed that patients who did not have regression of lesion demonstrated increasing of positive cells during the 3rd application but not after it. Additionally, despite the attempt of IRF-7 activation during the 3rd application, this result points to the impossibility of maintaining this pathway in non-responsive patients.
When assessing the integrity of the IFN-
This result demonstrates the attempt to respond to treatment with
Peginterferon-
Studying the inflammatory infiltrate in the tumor microenvironment, Silva et al. [42] concluded that there is a predominance of CD3+ and CD20+ lymphocytes in patients with CIN III compared to samples from patients with invasive cancer and that cell migration seems to be proportional to progression of the injury. Another study showed that there is a positive expression of CD3+ T lymphocytes in patients with recurrence, after conization by CIN III [43].
A study by Fernandes and collaborators [44] investigated the number and function of circulating neutrophils in patients with cervical neoplasia and observed an increase in the number of cells in patients with microinvasion. Soluble mediators released by tumor cells, such as nitric oxide, could interfere with the ability of neutrophils to migrate, thus impairing the host’s immune response.
One of the first signs of viral infection is pain. An established study that
type I IFNs (IFN-
All of these studies may point out that interferon immunotherapy is influenced not only by the expression of receptors in systemic or tissue immune cells, but also by the cells of the cervix itself, developing the ability to eliminate the HPV virus and set local tissue homeostasis. Thus, further studies are need, which include the investigation of the inflammatory infiltrate and cervical tissue of these patients.
We concluded with immunomodulation by interferon-alpha seems to depend on the systemic expression of IFN receptors. Our data suggest that patients who can respond to immunotherapy already have a pattern of IFN receptors expression in lymphocytes, which contributes to successful treatment. The local and systemic distribution of IFN receptors is different, demonstrating that there may be a different expression of these receptors in the local stroma, which needs to be evaluated.
MAM and EFCM conceived, designed the experiments; LMS performed the experiments, analyzed the data and wrote the paper; RSN and MAT selected the patients, accompanied and performed all clinical procedures. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.
Informed consent was obtained from all subjects involved in the study. All procedures performed followed the criteria developed by the Ethics Committee (approval number: CEP/UFTM Nos. 759 and 1525).
Grateful to the reviewers for their suggestions for improvement.
This research was funded by the Studies and Projects Funding Body (FINEP), the National Council for Scientific and Technical Development (CNPq) and the Uberaba Foundation for Teaching and Research (FUNEPU), the Foundation for Research Assistance of the State of Minas Gerais (FAPEMIG) number CDS-RED-00011-14.
The authors declare no conflict of interest.