Male Sprague-Dawley rats (Fuzhou Animal Center, Fuzhou) weighing 220–260 g at the time of surgery were used. Animals were housed in a quiet room kept at 22 $\pm$ 0.5 °C under 12 h light/dark cycles (lights on at 6:30 h and off at 18:30 h) and had free access to food and water ad libitum. Experiments were performed following the guidelines for investigations of experimental pain in conscious animals [18]. Experimental protocols were approved by Fujian Normal University Institutional Laboratory Animal Care and Use Committee. After implantation of intrathecal catheter, animals were housed individually. Surgeries and experimental procedures were done between 9:30 and 16:30 h. Every effort was made to minimize animal numbers and their discomfort.

Nerve lesion in the periphery was produced by ligation of unilateral spinal nerve at L5 [19]. Rat was anesthetized with pentobarbital (50 mg/kg, i.p.). Ligation of L5 spinal nerve was carried out as described before [19]. The dorsal vertebral was exposed at lumbar level (L4 to L6). The paraspinal muscles were bluntly separated and transverse spinal processes at L5 was removed. L5 nerve at the right side was exposed and ligated tightly with 5-0 suture. The muscle layer was closed with nylon threads. Ceftiofur sodium (Shenggong, Shanghai, China) was given in the wound to prevent possible infection. Sham surgery was performed with same procedure without removing spinal process and disturbance of the spinal nerves. The same procedure was followed without ligation of the spinal nerve in the sham operated animals. The rats were allowed to fully recover.

Animals were implanted with indwelling catheters in the subarachnoid space. Briefly, rat was injected with pentobarbital (50 mg/kg, i.p., Shenggong, Shanghai, China). The dura mater overlying the atlanto-occipital membrane of rats was exposed and a small slit was cut in the membrane. A PE-10 catheter (Stoelting, Wood Dale, IL, USA) was inserted into the subarachnoid space with its tip being positioned at the L4 segment. The catheter was flushed with saline (10 $\mu$L) and closed. Then the rats were allowed to recover for 1 week. The location of intrathecal catheter tip was checked by i.t. administration of lidocaine (200 $\mu$g/10 $\mu$L, Shenggong, Shanghai, China), which caused a motor paralysis of the lower limbs. Vehicle (saline) or drag (AM${}_{22-52}$) (Angtuolaisi, Zhejiang, China) was given i.t. in a volume of 10 $\mu$L.

Nociceptive test responding to mechanical stimulation was used to evaluate the effect of drugs on pain threshold in rats. Mechanical pain threshold was tested in the right hindpaw (n = 7–9 each) using an electrodynamic von Frey apparatus (Dynamic Plantar Anesthesiometer, Ugo Basile, Italy). Animals were placed in plastic cages with a metal net floor. They were acclimatized to the environment for 40 min for five days and again habituated for 15 min prior to testing to minimize variability of behavioral measurements. The von Frey filament (0.5 mm diameter) was applied to the mid-plantar surface of hindpaw. Paw withdrawal threshold (PWT) was tested by application of a force. The actuator automatically lifted the filament and applied an increasing force. The force was stopped once rat moved its hindpaw. Forty g for 30 s was preset as a cut-off force in the apparatus to avoid possible injury in the tissue. PWT was measured three times at 2 min interval to generate a mean value. Investigator was blind to the tested drug conditions.

Animals were anesthetized with pentobarbital (50 mg/kg i.p.). Rats were perfused intracardially with cold 0.01 M PBS (phosphate buffered saline) followed by 4% paraformaldehyde in 0.1 M PB (phosphate buffer). L4/L5 spinal nerves and L4/L5 DRG (n = 5 or 6 each) were cut out. After being fixed in 4% paraformaldehyde overnight, the tissues were transferred to sucrose (30% in PB). The nerve or DRG was sectioned at a thickness of 10 $\mu$m. Immunostaining procedures were done at room temperature. Non-specific proteins in nerve or DRG sections were blocked with H${}_2$O${}_2$ (0.3%) and goat serum (10%, Shenggong) for 1 hour. The tissue sections were incubated with rabbit AM (1:100, Santa Cruz Biotechnology Inc., California, USA) or RAMP2 (1:200, Bioss Biotechnology Inc., Beijing, China) antibody overnight at 4 °C. After being thoroughly washed in PBS, the sections were incubated with donkey anti-goat or anti-rabbit IgG conjugated to FITC (fluorescent marker, 1:1000, Abcam, Cambridge, UK) for 2 hours. The sections were dehydrated and coverslipped. The AM or RAMP2 antibody was omitted in the immunostaining protocol for controls. Negative staining was resulted in this procedure. Stained sections were examined with a fluorescence digital microscope (BX51, Olympus, Tokyo, Japan). Images were captured with a Q-Fire cooled camera (DP70, Olympus, Tokyo, Japan). AM-positive staining in nerves was quantified as pixel number above a predefined threshold using software Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD, USA) as described previously [12, 17]. The AM staining intensity in the nerve was analyzed in 870 $\times$ 640 $\mu$m${}^2$ area at 40$\times$ magnification with 6 sections per animal. The total pixel from 6 tissue sections was averaged to give a mean number of pixel for each rat [20, 21].

AM and RAMP2 immunoreactivity-stained DRG neurons was quantified using software Image-Pro Plus 6.0. A field of 870 $\times$ 640 $\mu$m${}^2$ at 20$\times$ magnification was taken randomly from each of 10 DRG sections each rat. To analyze staining neurons, a threshold of cytoplasmic optical intensity of AM or RAMP2 immunofluorescence was preset by the software. The threshold was applied to whole DRG section. The neurons with optical intensity over the threshold were taken as AM or RAMP2-positive. Other cells were counted as negative staining neurons. Neuronal soma area was measured by imaging software to determine neuron size (small neurons 600 $\mu$m${}^2$, medium neurons 600–1200 $\mu$m${}^2$ and large neurons $>$1200 $\mu$m${}^2$ [22]).

The preparation of stained sections was consistent with the method described above by immunofluorescence. The tissue sections were incubated with rabbit AM (1:500, Bioss Biotechnology Inc., Beijing, China) or RAMP2 (1:200, Bioss Biotechnology Inc., Beijing, China) or CLR (1:500, Bioss Biotechnology Inc., Beijing, China) antibody and mouse nNOS antibody (1:100, Santa Cruz Biotechnology Inc., California, USA) together overnight at 4 °C. After being thoroughly washed in PBS, the sections were incubated with donkey anti-rabbit or anti-mouse IgG conjugated to FITC (1:1000, Abcam, Cambridge, UK) or Rhodamine (1:800, Abcam, Cambridge, UK) for 2 hours at room temperature. AM, CLR and RAMP2 immunoreactivity were labeled as green, whereas nNOS were labeled as red.

The rats were decapitated, L4–L6 dorsal root ganglia were removed and collected. A mixture of cell lysate and protease inhibitor (10:1, Beyotime, Shanghai, China) was added to the tissue, and then all samples were centrifuged (15,000 r/min, 30 min, 4 °C). The extracted protein was quantified by BCA kit (Beyotime, Shanghai, China). Proteins were denatured with SDS loading buffer (95 °C,10 min) and processed to SDS polyacrylamide gels. After transferring the protein, nitrocellulose filter membrane was blocked with 10% skimmed milk in TBST at room temperature for 2 h. Then the membrane was incubated with rabbit anti-nNOS (1:500, Bioss Biotechnology Inc., Beijing, China) and $\beta$-actin (1:2000, Proteintech, Wuhan, China) overnight at 4 °C in 5% milk. The Membrane was then incubated with Donkey anti-Rabbit IgG and Donkey anti-Mouse IgG (1:1000, LI-COR, Lincoln, USA) for 2 h at room temperature in 5% milk. The strip band was analyzed with Odyssey CLX laser imager (LI-COR, Lincoln, USA) and was normalized to $\beta$-actin loading control. The final result was obtained by the change multiple of the control group.

The dorsal half of the spinal cord at L4/5 was dissected. To isolate RNA, samples were homogenized in 1 ml of Trizol reagent using RNA prep pure kit (Transgen Biotech, Beijing, China). Deoxyribonuclease I treatment was done to prevent DNA contamination. Concentration of RNA was measured using an ultraviolet–visible spectrometer (NanoDrop ND-2000, Thermo Scientific, Waltham, USA). The quality and quantity of the RNA were assessed at 260/280 A. All samples showed absorbency ratios ranging from 1.8 to 2.0. A total of 1 $\mu$g of RNA was reverse-transcribed using TransScript one-step gDNA removal and cDNA synthesis supermix (Transgen Biotech, Beijing, China).

Forward (5’-3’) and reverse (5’-3’) primer sequences used were: GTTTCCATCGCCCTGATGTTATT and GTAGTTCCCTCTTCCCACGACTTAG for the gene encoding AM; AACCTTAGAAAGCAGCCCAGGCATG and GTGGGCACAAAGTTGTCCTTCACCA for the gene encoding CGRP; GTTTGTGATGGGTGTGAAC and TCTTCTGAGTGGCAGTGA for the gene encoding the gene encoding GAPDH. Twenty ng of cDNA from the same cDNA batch was subjected to real-time PCR to amplify all genes in triplicate in a total reaction volume of 20 $\mu$L using Platinum SYBR Green Master mix (Invitrogen, Carlsbad, USA). Reactions were conducted on an Mx300P thermocycler (Stratagene, La Jolla, USA). one cycle at 28 °C for 15 min, 42 °C for 30 min, 99 °C for 5 min, and 4 °C for 5 min. Each cycle consisted of 4 steps: 28 °C (15 min), 42 °C (30 min), 99 °C (5 min) and 4 °C (5 min). A non-template reaction served as negative control. Melting curve analysis of products as well as amplicon size verification on a 3% agarose gel confirmed the specificity of the PCR. The raw expression level for each gene was calculated using the same external standard curve made with a mixture of cDNA samples. GAPDH was used as internal reference for normalization of target gene expression.

All data were presented as the mean $\pm$ SEM (standard error of mean). Statistical evaluation of AM or RAMP between groups was performed by one-way repeated measure analysis of variance. Statistical comparisons of changes over time between groups (group $\times$ time) were performed by a two-way ANOVA. A value of p 0.05 was accepted to be statistically significant.

PWT in the hindpaw on the surgical side significantly shortened one day following nerve ligation operation. Behavioral examination showed that basic mechanical threshold (the value measured before i.t. administration) was remarkably decreased by SNL, but not by sham, surgery, indicating mechanical pain hypersensitivity or allodynia. This state was maintained thereafter throughout the experiment (15 days) and was not changed by i.t. administration of saline (once per day). Daily administration of AM${}_{22-52}$ (10 nmol) did not change mechanical allodynia on the first 5 days. However, the basic mechanical threshold elevated on day 6 and this elevation was statistically significant compared to the pre-drug administration (Fig. 1A, p 0.05). Moreover, the elevated mechanical threshold still remained 24 hours after the last AM${}_{22-52}$ administration on day 7. On the other hand, AM${}_{22-52}$ administration (10 nmol) immediately increased mechanical threshold. Fig. 1B,C illustrated that mechanical threshold was significantly increased by AM${}_{22-52}$, but not by saline, administration on day 2 or 10 compared to the pre-drug level (p 0.05). The increase started at 40 min and 20 min after the drug administration on day 2 or 10, respectively, and maintained for 20 min.

Fig. 1.

Effect of i.t. administration of AM${}_{\mathrm{𝟐𝟐}\mathbf{-}\mathrm{𝟓𝟐}}$ on SNL-induced mechanical hypersensitivity in the hindpaw. Spinal nerve ligation (L5) surgery was performed on day 0. (A) AM${}_{22-52}$ (10 nmol) was administered i.t. once per day for 7 days. PWT responding to mechanical stimuli was tested before the drug administration. (B) AM${}_{22-52}$ (10 nmol) or saline was administered i.t. on day 2. (C) AM${}_{22-52}$ (10 nmol) or saline was administered i.t. on day 10. PWT was measured before and after the i.t. administration. The data are presented as mean $\pm$ SEM. *p 0.05 compared to pre-SNL surgery. # p 0.05 compared to saline group.

To characterize the association of AM receptor activity with neuropathic pain, nerve ligation was performed on day 0. L4/5 spinal nerves, DRG and the dorsal half of the lumbar spinal cord were taken on naive rats (day 0 or D0) and 1, 3, 7 and 15 days post-SNL. The samples were proceeded by qRT-PCR assay or immunofluorescence staining to examine the changes of AM mRNA or protein with respect to the development of neuropathic pain. The experiment in each assay was repeated five times. AM immunoreactivity was shown in nerve fibers. The density of AM-immunoreactive fibers was remarkably increased in L5 nerve (damaged nerve) on day 3 and remained at a high level throughout the experiment (up to 15 days, Fig. 2A–F, p 0.05 vs D0). Similarly, the expression of AM mRNA was also increased on days 3–15 (Fig. 2G, p 0.05 vs D0). In L4 nerve (undamaged nerve), the increased level of AM protein was observed on day 3 and maintained until day 15 (Fig. 3A–F, p 0.05 vs D0). However, the expression of AM mRNA was increased on days 1–5 but significantly declined to the level on day 15 that was even lower than that on day 0 (Fig. 3G, p 0.05 vs D0).

Fig. 2.

Expression pattern of AM protein and mRNA in L5 spinal nerve in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L5 spinal nerve on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. The AM staining intensity was quantified as pixels in F. AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 50 $\mu$m.

Fig. 3.

Expression pattern of AM protein and mRNA in L4 spinal nerve in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L4 spinal nerve on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. The AM staining intensity was quantified as pixels in F. AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 50 $\mu$m.

AM neurons were mainly observed in medium- and small-diameter DRG neurons. In DRG at L5 (containing damaged neurons), SNL induced an increase in the expression of AM in both medium- and small-diameter neurons only on day 7 (Fig. 4A–F). The expression of AM mRNA in L5 DRG exhibited a different profile. It was increased on days 1–7 post-SNL (Fig. 4G, p 0.05 vs D0) and returned to the normal level on day 15. In L4 DRG containing undamaged neurons, AM-positive neurons were increased in small and medium populations throughout the experiment starting on day 3. AM expression in large-sized neurons was also slightly but significantly increased on days 7–15 (Fig. 5A–F, p 0.05 vs D0). The expression of AM mRNA was increased on days 1–7 post-SNL (Fig. 5G, p 0.05 vs D0). In the spinal dorsal horn, AM mRNA level was remarkably increased on days 1–7 (Fig. 6, p 0.05 vs D0). The increase disappeared on day 15 (p $>$ 0.05 vs D0).

Fig. 4.

Expression of AM protein and mRNA in DRG at L5 in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L5 DRG on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. Arrows of different sizes indicate small-, medium- or large-sized cells (H). Quantification of AM expression is represented as a number of AM-positive cells in small- or medium-sized subpopulation (F). AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 100 $\mu$m.

Fig. 5.

Expression of AM protein and mRNA in DRG at L4 in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L4 DRG on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. Arrows of different sizes indicate small-, medium- or large-sized cells (H). Quantification of AM expression is represented as a number of AM-positive cells in small- or medium-sized subpopulation (F). AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 100 $\mu$m.

Fig. 6.

Expression of AM mRNA in the spinal dorsal horn in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The dorsal part of the lumbar spinal cord on the operate side was harvested at various times. The samples were assayed using RT-PCR techniques. Histograms indicate the mean $\pm$ SEM of AM mRNA. *p 0.05 compared to day 0. N = 5 each.

AM mainly activates AM1 receptor which is a complex of CLR with RAMP2 [13]. This study examined characteristics of the temporal expression of RAMP2 in DRG. In consistence with previous report [12], RAMP2 immunofluorescence staining was seen in medium- and small-diameter DRG neurons (Fig. 7). The expression of RAMP2 in both sized neurons was remarkably increased on day 1 post-SNL in L5 DRG. This increase maintained throughout the experiment (Fig. 7A–F, p 0.05 vs D0). Particularly, expression of RAMP2 was increased in large-sized neurons on days 3 and 7 (p 0.05 vs D0). As illustrated in Fig. 7G, RAMP2 mRNA in L5 DRG was increased only on day 3 compared with day 0 (p 0.05) and did not change on days 1, 7 and 15 (p $>$ 0.05).

Fig. 7.

Expression of RAMP2 protein and mRNA in DRG at L5 in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L5 DRG on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. Arrows of different sizes indicate small-, medium- or large-sized cells (H). Quantification of AM expression is represented as a number of AM-positive cells in small- or medium-sized subpopulation (F). AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 100 $\mu$m.

RAMP2 expression in medium- and small-diameter neurons in L4 DRG was also increased on day 1 post-SNL (Fig. 8A,B, p 0.05 vs D0). This increase maintained throughout the experiment including day 15 (Fig. 8C–F, p 0.05 vs D0). The expression of RAMP2 was also increased in large-sized neurons on days 3 and 7 (p 0.05 vs D0). RAMP2 mRNA was increased on day 1 (p 0.05 vs D0). The increase maintained for a couple days (p 0.05 vs D0) and was completely abolished on day 15 (Fig. 8G, p $>$ 0.05).

Fig. 8.

Expression of RAMP2 protein and mRNA in DRG at L4 in SNL rats. Spinal nerve ligation (L5) or sham surgery was performed on day 0. The L4 DRG on the operate side was harvested at various times. The samples were assayed using immunofluorescence staining and RT-PCR techniques. Representative immunofluorescence images are presented as following: A-day 0, B-day 1, C-day 3, D-day 7, E-day 15. Arrows of different sizes indicate small-, medium- or large-sized cells (H). Subpopulation Quantification of AM expression is represented as a number of AM-positive cells in small- or medium-sized subpopulation (F). AM mRNA levels at various times were shown in G. *p 0.05 compared to day 0. N = 5 each. Scale bar = 100 $\mu$m.

To explore cellular mechanism of AM-induced activity, nNOS protein in DRG was assayed. AM${}_{22-52}$ (10 nmol) or saline was given immediately on day 2 or day 10, which time point is the early and late stage of neuropathic pain. The DRG was taken at 40 min. Protein analysis showed that SNL remarkably elevated the expression of nNOS protein compared to sham surgery on day 2 (Fig. 9A, p 0.05). However, in the group in which AM${}_{22-52}$ was given immediately on day 2, the level of nNOS was back to the level that was identical to the sham group (p $>$ 0.05). Similarly, nNOS protein increased significantly after nerve injury on day 10 (Fig. 9B, p 0.05), the expression of nNOS returned to near control group level when AM${}_{22-52}$ was given immediately on day 10 (p $>$ 0.05). Moreover, the double immunostaining confocal results show that nNOS immunoreactivity (nNOS-IR) colocalizes with AM, CLR and RAMP2 (AM/CLR/RAMP2-IR) immunoreactivity in DRG neurons (Fig. 9C).

Fig. 9.

Effect of i.t. AM${}_{\mathrm{22}\mathrm{-}\mathrm{52}}$ on SNL-induced level of nNOS protein in DRG. Spinal nerve ligation (L5) or sham surgery was performed on day 0. AM${}_{22-52}$ (10 nmol) was administered i.t. on day 2 (A) or day 10 (B) post-SNL. The DRG on the operate side was harvested at 40 min after injection. Histograms indicate the mean $\pm$ SEM of nNOS protein. *p 0.05 compared to sham group. #p 0.05 compared to SNL + Saline group N = 6 each. Confocal images showing localization of nNOS-IR, AM-IR and its receptor components in DRG neurons (C). AM-IR, CLR-IR and RAMP2-IR neurons are identified by Alexa Fluor 488 (Leftmost pictures; arrows; green) fluorescence, whereas nNOS-IR-positive neurons are labeled by Alexa Fluor 568 (Second column pictures; arrows; red) fluorescence. DAPI is the staining of nucleus (blue). nNOS-IR is extensively colocalized with AM-IR, CLR-IR, RAMP2-IR in DRG neurons (Rightmost pictures; arrows; yellow). Scale bar = 50 $\mu$m.

To further explore cellular mechanism of AM-induced activity, CGRP mRNA in the spinal dorsal horn was assayed. AM${}_{22-52}$ (10 nmol) or saline was given once per day for 7 days. The dorsal half of the lumbar spinal cord was taken on day 8. mRNA analysis showed that SNL remarkably elevated the expression of CGRP mRNA compared to sham surgery (Fig. 10, p 0.05). However, in the group in which daily administration of AM${}_{22-52}$ was given for 7 days, the level of CGRP mRNA was back to the level that was identical to the sham group (p $>$ 0.05).

Fig. 10.

Effect of i.t. AM${}_{\mathrm{22}\mathrm{-}\mathrm{52}}$ on SNL-induced level of CGRP mRNA in the spinal dorsal horn. Spinal nerve ligation (L5) or sham surgery was performed on day 0. AM${}_{22-52}$ (10 nmol) was administered i.t. once per day for 7 days. The dorsal part of the lumbar spinal cord on the operate side was harvested on day 8. Histograms indicate the mean $\pm$ SEM of CGRP mRNA. *p 0.05 compared to sham group. #p 0.05 compared to SNL + Saline group N = 5 each.