1 Department of Clinical Laboratory, The First People’s Hospital of Lianyungang, 222001 Lianyungang, Jiangsu, China
†These authors contributed equally.
Abstract
Obesity induces chronic inflammation and hormonal imbalances that contribute to tumor growth. This study explores the less understood dynamics of tumor-related macrophages under a high-fat diet and its consequent impact on tumor growth, with a focus on elucidating the role of high-fat diets on macrophage behavior in liver cancer.
We established a mouse obesity model using a high-fat diet, combined with a liver cancer implantation approach. Tumor-infiltrating macrophages were isolated for analysis. We investigated the specific effects of a high-fat diet on macrophages through transcriptomic and metabolomic studies and further explored the influence of N6-methyladenosine (m6A) RNA modification on macrophage differentiation using in vitro and in vivo models.
Our findings reveal that a high-fat diet significantly accelerates in-situ liver cancer growth and fosters type II differentiation of tumor-associated macrophages. RNA sequencing indicated upregulation of Cpt1a and Mettl3 genes, which are crucial for m6A modification in macrophages. Using human and mouse macrophage cell lines with either elevated Mettl3 expression or Cpt1a gene knockout, we demonstrated that methyltransferase-like 3 (METTL3) enhances fatty acid metabolism in macrophages, a process reversible by Cpt1a gene knockout. These effects were corroborated in vivo. Further, macrophages infused with high Mettl3 expression, when combined with an in-situ implantation model and adoptive cell therapy, markedly promoted liver cancer growth and increased type II macrophage differentiation (p < 0.001). Knockout of the Cpt1a gene counteracted the METTL3 effect compared to the control group (p > 0.05). METTL3 and m6A RNA Immunoprecipitation (RIP) assays confirmed that METTL3 stabilizes Cpt1a mRNA. Additionally, multispectral staining of clinical specimens revealed a positive correlation between METTL3 protein levels in liver cancer tumor-associated macrophages and M2 macrophage prevalence, inversely correlating with M1 macrophages (p < 0.01). High Mettl3 expression in macrophages was associated with poor prognosis in liver cancer patients, correlating significantly with tumor size and tumor node metastasis (TNM) classification stage.
Our research identifies that a high-fat diet elevates METTL3-driven m6A modification of carnitine palmitoyltransferase 1A (CPT1A) in tumor macrophages, fostering type II macrophage differentiation, and exacerbating liver cancer growth and immune evasion.
Keywords
- high-fat diet
- liver cancer
- macrophage
- m6A modification
The global escalation of obesity presents a significant public health challenge, with the World Health Organization reporting that around 13% of the global adult population is now classified as obese, a figure that has been climbing sharply for decades. This issue transcends economic boundaries, affecting both affluent and developing nations, where rates of obesity are climbing in the wake of urbanization and the adoption of Western lifestyles [1, 2]. The implications of obesity are profound, with a heightened risk of chronic conditions such as type 2 diabetes, cardiovascular diseases, certain cancers, and musculoskeletal disorders [3, 4, 5]. Furthermore, obesity often leads to diminished life expectancy and deteriorated quality of life. A common comorbidity of obesity is hyperlipidemia, which has been identified as a critical mediator in the relationship between obesity and cancer development. The high levels of lipids in the bloodstream, characteristic of hyperlipidemia, not only exacerbate the risk of metabolic and cardiovascular conditions but also provide a conducive environment for cancerous cells to initiate and progress, thus cementing the intricate link between obesity, lipid imbalances, and oncogenesis [6, 7, 8].
Obesity and hyperlipidemia are intricately linked to tumorigenesis through a web of biological pathways. Obesity itself initiates a chronic low-grade inflammatory state, with cytokines and chemokines released in this milieu fostering tumor growth [9]. It also perturbs hormonal balance, with insulin resistance and hyperinsulinemia known to be pro-carcinogenic for certain cancers. Additionally, obesity-induced alterations in sex hormone levels have been implicated in increasing the risk of breast and endometrial cancers [10]. Hyperlipidemia, particularly elevated serum cholesterol, is independently associated with tumorigenesis, given cholesterol’s critical role in cell membrane integrity and signaling pathways; disruptions in these processes can precipitate cellular proliferation and cancer [9]. Moreover, cancer cells may exploit circulating fatty acids as a fuel source, thereby facilitating their proliferation and metastasis. Often occurring concurrently, obesity and hyperlipidemia might amplify the risk of cancer through their combined metabolic effects. High-fat diets, a common cause of both conditions, contribute to this risk by potentiating chronic inflammation, oxidative stress, and hormonal imbalances [11]. This suggests that both conditions could not only independently drive tumor development but might also act synergistically, underscoring the need for dietary and lifestyle interventions in cancer prevention strategies [12].
In our research, we induced obesity in mice through a high-fat diet regimen. Subsequent omics analyses revealed that this diet precipitates alterations in the N6-methyladenosine (m6A) modification of genes involved in lipid metabolism within macrophages associated with hepatic tumors. Further clinical investigations have corroborated that changes mediated by methyltransferase-like 3 (METTL3) in this context are intimately linked with the prognosis of liver cancer patients.
Paraffin-embedded human liver cancer specimens were obtained from 79 patients diagnosed between 2013 and 2015, with written informed consent obtained from all participants. This study was in accordance with the Declaration of Helsinki and approved by the Ethics in Research Committee of People’s Hospital of Lianyungang, China. The THP-1 and Raw246.7 cell lines were procured from Procell Life Science & Technology Co., Ltd. (Wuhan, China). Cellular samples were incubated in an RPMI 1640 solution from Invitrogen, based in Carlsbad, California, supplemented with 10% FBS (Cat. A5256701, Invitrogen, Carlsbad, CA, USA), 100 micrograms per milliliter of streptomycin, and penicillin G at a concentration of 100 units per milliliter. Both THP-1 and Raw246.7 cell lines have undergone mycoplasma infection testing and STR validation. Cells were cultured at a constant temperature of 37 degrees Celsius within an environment containing 5% carbon dioxide. Each treatment group of cell lines has 6 replicates to render sufficient statistical power, and every experiment was performed in triplicate.
Lentiviral vectors for Mettl3 over-expression (METTL3 OE) and Cpt1a knockdown (CPT1A shRNA) were obtained from GeneChem (Shanghai, China), and an empty vector was used as the negative control (NC), as specified in Table 1. Each cell line has three treatment groups: Control, METTL3 OE (Group A), and METTL3 OE + CPT1A shRNA (Group B). The Control group was transfected with empty lentiviral vectors, Group A was transfected with METTL3 OE lentiviral vectors, and Group B was transfected with METTL3 OE and CPT1A shRNA lentiviral vectors. Stable transduced cells were selected using puromycin (Cat.No.: ST551-10mg, Beyotime, Shanghai, China). To reduce batch-to-batch variation, each comparison involved pairs of samples from the same batch. All transfections were performed according to the manufacturer’s instructions.
| Category | Primers and shRNA | Sequence (5′-3′) |
| Human | ||
| shRNA target oligo | shMETTL3 | GCTGCACTTCAGACGAATT |
| shCPT1A | TCCAGAGTCCGATTGATTTTTGC | |
| Primers used in PCR | Mettl3 forward | CTGGGCACTTGGATTTAAGGAA |
| Mettl3 reverse | TGAGAGGTGGTGTAGCAACTT | |
| Cpt1a forward | TTCAGTTCACGGTCACTCCG | |
| Cpt1a reverse | TGACCACGTTCTTCGTCTGG | |
| Gapdh forward | CAGGAGGCATTGCTGATGAT | |
| Gapdh reverse | GAAGGCTGGGGCTCATTT | |
| Mouse | ||
| shRNA target oligo | shMettl3 | CCTCAGTGGATCTGTTGTGAT |
| shCpt1a | AGCCCTGAGACAGACTCACA | |
| Primers used in PCR | Mettl3 forward | CTGGGCACTTGGATTTAAGGAA |
| Mettl3 reverse | TGAGAGGTGGTGTAGCAACTT | |
| Cpt1a forward | AGATCAATCGGACCCTAGACAC | |
| Cpt1a reverse | CAGCGAGTAGCGCATAGTCA | |
| Gapdh forward | TTGTCATGGGAGTGAACGAGA | |
| Gapdh reverse | CAGGCAGTTGGTGGTACAGG | |
RNA was entirely extracted from the cells using the TRIzol reagent (Invitrogen,
Carlsbad, CA, USA, Cat. No. 15596026) following the manufacturer’s instructions.
Subsequently, cDNA synthesis was performed with the PrimeScript RT Master Mix Kit
(TaKaRa, Dalian, China, Cat. No. RR036A). Real-time PCR analysis was conducted
using SYBR Premix Ex Taq (Tli RNaseH Plus) (TaKaRa, Dalian, China, Cat. No.
RR420A). Gene expression levels were normalized to GAPDH, which served as the
reference gene. The primers used for amplification are detailed in Table 1. After
amplifying cDNA, the quantification is typically done using the
The THP-1 human monocyte cell line was cultivated in RPMI 1640 medium, enriched with 10% heat-inactivated FBS, at a constant environment of 37 °C and 5% CO2. To induce macrophage activation, the THP-1 cells were exposed to 5 ng/mL of PMA (Sigma, St. Louis, MO, USA, Cat. No. P8139) for 48 hours. For tumor-associated macrophage (TAM) activation, macrophages derived from THP-1 were treated with a conditional medium derived from tissue lysate, adjusted to a protein concentration of 50 µg/mL, for 48 hours. To induce M2 macrophages, differentiate THP-1 cells with PMA (50–100 ng/mL) (Sigma, Cat. No. P8139) for 24–48 hours, then polarize with IL-4 (10–20 ng/mL) (Sigma, Cat. No. I4269) and IL-13 (10–20 ng/mL) (Sigma, Cat. No. SRP3211) for 24–48 hours.
In vitro macrophage stimulation in Raw246.7 cells is simpler than in THP-1 cells because they are already macrophage-like and do not need a differentiation step using PMA before stimulation. Stimulus steps are the same as THP-1 cells with IL-4 and IL-13 proteins.
Leukocytes infiltrating tumors were isolated following previously established methods [8]. In summary, non-essential tissue like fat, connective tissue, and necrotic material was discarded. The remaining tissue was finely chopped into pieces of 1–2 mm in RPMI 1640 (Invitrogen, CA), then transferred to conical tubes of 15 or 50 mL. These samples underwent a digestion process using a medium containing three enzymes: DNase at 30 U/mL, hyaluronidase at 0.1 mg/mL, and collagenase at 1 mg/mL (Invitrogen). This digestion occurred over 2 hours at ambient temperature with mild agitation. The tissues were then suspended in 10 mL of RPMI 1640 and strained through a 70-µm cell strainer (BD Pharmingen, San Diego, CA, USA). Any tissue retained by the strainer was individually placed into wells with 1 mL of T-cell growth medium in a 24-well plate, for further isolation or analysis via flow cytometry.
For flow cytometry and sorting, the isolated cells were first washed and then
resuspended in FACS buffer (1
Ninety 3-week-old C57BL/6 mice that consistently weigh around
13~15 g (Gemphamatec, Nanjing, China) were purchased and first
subjected to a high-fat diet for eight weeks per previously successfully built
animal model [13]. The Non-Alcoholic Fatty Liver Disease (NAFLD) Activity Score
(NAS) for evaluating NAFLD in mouse models includes scoring steatosis (0–3),
lobular inflammation (0–2), hepatocellular ballooning (0–2), and fibrosis
(0–4) [14]. An orthotopic hepatocellular carcinoma (HCC) model was established
using both NAFLD and non-NAFLD mice with the mouse HCC cell line Hep1-6. NAFLD
mice were divided into 3 groups: Control, Group A, and Group B. To anesthetize
the mice, propofol was injected into the abdomen at a dosage of 50 mg/kg. Eight
weeks post-orthotopic transplantation with 3
Proteins were extracted from cultured cells using a Protein Extraction Kit (Kaiji, Nanjing, China). These proteins were then separated using SDS-PAGE gels and subsequently transferred onto PVDF membranes (Millipore, Burlington, MA, USA) with a pore size of 0.45 µm. For the detection process, anti-rabbit (A0208) or anti-mouse (A0216, Beyotime, Shanghai, China) horseradish peroxidase (HRP)-conjugated secondary antibodies were applied before electrochemiluminescence (ECL) detection. Multi-spectral images of the stained slides were captured using the Vectra 3 System (PerkinElmer, MA), ensuring consistent exposure times for each scan.
The process of mIHC staining on tissue sections was conducted using the PANO
5-plex immunohistochemistry kit (Catalog #10080100100, Panovue, Beijing, China),
following the manufacturer’s instructions. The procedure began with the treatment
of paraffin slices in a microwave, followed by incubation with one primary
antibody. These slices were then incubated with horseradish peroxidase (HRP)
conjugated secondary antibodies and subjected to aminide signal amplification.
The antibodies utilized included anti-METTL3 (1:50, 15073-1-AP, Proteintech,
Rosemont, IL, USA), anti-CD68 (1:200, 25747-1-AP, Proteintech), anti-iNOS (1:100,
22226-1-AP, Proteintech), anti-CPT1A (1:100, 15184-1-AP, Proteintech), and
anti-
Liver tissues from the normal diet and high-fat diet mice were fixed, dehydrated by gradient ethanol and xylene, and then immersed in wax. The processed tissues were then sliced at 5 µm, followed by dewaxing and hydration by xylene and gradient ethanol. The slides were then stained with hematoxylin and eosin (Cat. A3429, Sigma-Aldrich, St. Louis, MO, USA).
Macrophages were harvested, washed twice, and fixed with 4% paraformaldehyde for 30 minutes. They were then stained with Oil Red O (Cat. Ab223796, Abcam, Cambridge, UK). After a 10-minute incubation, the cells were washed five times with double-distilled water and immediately examined under a microscope. The Oil Red O dye was extracted from the macrophages using isopropanol (563935, Sigma-Aldrich, St. Louis, MO, USA).
Total RNA was isolated from infiltrated macrophages from the normal diet and high-fat diet using TRIzol Reagent. RNA sequencing (RNA-seq) analysis was performed at LC Biotech Inc. (Guangzhou, China).
Metabolite analyses were performed using Gas Chromatography-Mass Spectrometry (GC-MS). For the examination of intracellular metabolites in THP-1 and THP-1-METTL3 cells, samples containing 10 million cells each were initially quenched. The metabolites were then derivatized using methoxyamine (15 mg/mL in pyridine) for 90 minutes at a temperature of 37 °C. Following this, the derivatives underwent further treatment with Bis(trimethylsilyl) trifluoroacetamide, including 1% chlorotrimethylsilane, and 20 µL of n-hexane, for a duration of 60 minutes at 70 °C.
The metabolomics instrumental analysis was carried out using an Agilent 7890A gas chromatography system linked to an Agilent 5975 C inert Mass Selective Detector (MSD) system (Agilent Technologies, Inc., Santa Clara, CA, USA). For the separation of these derivatives, an HP-5ms fused-silica capillary column measuring 30 m in length, 0.25 mm in diameter, and with a film thickness of 0.25 µm, from Agilent J&W Scientific was utilized. Mass spectra were collected within an m/z range of 50–600, under the selected reaction monitoring mode.
To interpret the metabolic variations among the different experimental groups, Partial Least Squares-Discriminant Analysis (PLS-DA) was applied to the data of intracellular metabolites. The Variable Importance in the Projection (VIP) scoring method was employed to determine the overall impact of each variable on the PLS-DA model. Metabolites that showed significant differences were identified based on two criteria: a p-value less than 0.05 obtained from t-tests and a VIP score exceeding 1 in the PLS-DA analysis.
The RNA Immunoprecipitation (RIP) assay was executed in line with the protocol of the RIP Kit (Geneseed Guangzhou, China). Briefly, first, cells are harvested, washed, and resuspended in a lysis buffer containing RNase inhibitors, followed by incubation on ice to facilitate lysis. The lysate is then pre-cleared with protein A beads to minimize non-specific binding before anti-mettl3 antibodies (1:50, Cat. ab195352, Abcam) are added for overnight incubation at 4 °C. After this, pre-washed beads are added to capture the antibody-antigen complexes, which are subsequently washed multiple times to remove unbound materials. After the washing phase, the complexes were eluted from the beads, followed by a purification process. The final step involved analyzing these purified complexes through RT-qPCR (TaKaRa, Dalian, China, Cat. No. RR036A). To determine the level of RNA enrichment, the quantities of precipitated RNAs were normalized against the input controls used in the experiment.
Cells were initially plated in 6-well culture dishes (Cat.140685, Thermo Fisher, Waltham, MA, USA). Following seeding, they
were treated with actinomycin D (Sigma, Cat. No. A9415) at a concentration of 5
µg/mL for three distinct durations: 0 hours, 3 hours, and 6 hours. This
treatment was conducted as a preparatory step before RNA extraction. After
extraction, the focus was on determining the stability of CPT1A mRNA by measuring
its half-life. For accurate quantification, CPT1A mRNA levels were normalized to
Statistical analyses in the study were carried out using two different software tools: R language (version 3.5.2, https://www.r-project.org/) and GraphPad Prism (version 9.0.0, GraphPad Software, Inc., San Diego, CA, USA). The embedded Kolmogorov-Smirnov (KS) test was used to test the normality of all data before comparison. For the purpose of comparing two distinct groups, a normality test was performed and followed by two-tailed Student’s t-tests. In contrast, the chi-square test was applied to evaluate categorical data.
For survival analysis, the Kaplan-Meier method was employed to generate survival curves. To further assess survival data, both univariate and multivariate Cox regression analyses were conducted. Additionally, comprehensive gene analysis was performed using R language (version 3.5.2), which included Gene Ontology (GO) analysis (https://www.geneontology.org/), Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis (https://www.genome.jp/kegg/), and gene set enrichment analysis (GSEA) (https://www.gsea-msigdb.org/gsea/index.jsp). In these analyses, a p-value of less than 0.05 was considered statistically significant, guiding the determination of the significance of the results obtained.
A high-fat diet has been implicated in the facilitation of lipid metabolism
alterations and the potential advancement of hepatocellular carcinoma through
metabolic reprogramming within macrophages associated with liver tumors. This
hypothesis was explored using an orthotopic liver cancer model and a
non-alcoholic fatty liver disease (NAFLD) model induced by a high-fat diet.
Observational data indicated that a high-fat diet markedly augmented the
proliferation of hepatic carcinoma. The tumor size of the normal diet mice was
significantly smaller than the high-fat diet (HFD) mice, and so was the tumor
weight (p
Fig. 1.
Effects of high-fat diet on liver cancer growth and M2-type
macrophage prevalence. (A) Construction of liver cancer models in mice through
in-situ implantation, comparing normal diet and high-fat diet groups (n
= 6). (B) Quantitative comparison of liver cancer tissue weights in both
diet-based liver cancer models (n = 6). (C) Morphological analysis of
in-situ liver cancer in mice (the area outlined by the black coil),
comparing those on high-fat versus normal diets, as visualized by hematoxylin and
eosin (H&E) staining (
We conducted a comparative transcriptomic analysis via RNA sequencing to
delineate the transcriptional modifications in macrophages of 79 patients who
adopted two dietary regimens. The analysis revealed that dietary composition
precipitated marked transcriptional disparities in macrophages. Applying an
adjusted p-value threshold of
Fig. 2.
Impact of high-fat diet on gene expression and metabolic
pathways in liver cancer tumor-associated macrophages. (A) Heat maps
illustrating the transcriptional effects on hepatoma tumor-associated macrophages
under high-fat versus normal diet conditions. (B) Volcano plots highlighting the
most significantly altered genes in hepatocellular carcinoma-associated
macrophages, comparing high-fat and normal diets. (C) Kyoto Encyclopedia of Genes
and Genomes (KEGG) pathway enrichment analysis of differentially expressed genes.
(D) Gene Ontology (GO) enrichment analysis of differentially expressed genes. (E)
Comparative presentation of differentially expressed genes in the “RNA
Modification” and “Fatty Acid Metabolism” pathways, across the two diet
groups. (F) Validation of Mettl3 (p
Subsequent to RNA sequencing (RNA-seq) analysis, we verified the co-expression
pattern of Mettl3 and Cpt1a in tumor-associated macrophages
across diverse experimental conditions. This validation ascertained a direct
proportionality in the expression levels of Mettl3 and Cpt1a.
Employing both human macrophage cell line THP-1 and murine macrophage cell line
Raw 264.7, we engineered cellular models to either overexpress Mettl3 or
to possess knockdown constructs of Mettl3 with concurrent Cpt1a
suppression (Supplementary Fig. 1). The mRNA and protein expression of
METTL3 was upregulated in Mettl3 overexpressing cells, which were
diminished by Cpt1a knockdown (Fig. 3A,B, p
Fig. 3.
Role of methyltransferase-like 3 (METTL3) in regulating fatty
acid metabolism in macrophages. (A) Real-time PCR analysis for the transcription
of relevant genes in various macrophage cell lines subjected to treatments as
depicted (n = 6, p
Upon differentiation into M2 macrophages under canonical M2-polarizing
conditions (interleukin-4 (IL-4) and interleukin-13 (IL-13) stimulation), we
observed a pronounced augmentation in M2 phenotype specification in cells with
heightened Mettl3 expression. Conversely, cells with Cpt1a
ablation did not exhibit a significantly different percentage of M2 macrophages
than the wild type, indicating a substantial reduction in M2 differentiation
propensity (p
Fig. 4.
Mechanism of METTL3 in enhancing macrophage fatty acid
metabolism through N6-methyladenosine (m6A) modification of Cpt1a gene.
(A) Flow cytometry analysis demonstrating the impact of various treatments on
the proportion of M2-type macrophages (n = 6). (B) Investigation of the influence
of different macrophage treatments on liver cancer growth, utilizing adoptive
cell transfer and in-situ implantation models (n = 6). (C) Flow
cytometry assessment of M2-type macrophage ratios in the liver cancer models
described in part B (n = 6). (D) Real-time PCR analysis showing expression levels
of Mettl3 and m6A RIP-Seq enrichment of CPT1A/Cpt1a
gene mRNAs (n = 6, p
Given the role of METTL3 as an N6-methyladenosine (m6A) methyltransferase, it
was hypothesized that METTL3 may mediate m6A modifications on Cpt1a
mRNA. To investigate this, m6A and Mettl3 RNA immunoprecipitation
sequencing (RIP-Seq) were employed to analyze macrophage transcripts. The results
indicated effective binding and subsequent m6A modification of Cpt1a
mRNA by Mettl3. Complementary RIP assays confirmed the specificity of
the CPT1A-METTL3 interaction (Fig. 4D, p
At last, we utilized a tissue array comprising 79 pairs of cancerous and
adjacent non-cancerous cells to investigate m6A modifications in liver
cancer-associated macrophages and their impact on macrophage fatty acids
metabolism and differentiation. This was assessed using multispectral staining
for CD68, iNOS, METTL3, CPT1A, and CD163 (Fig. 5A). Initially, we compared the expression levels of METTL3 and CPT1A in macrophages between tumor and adjacent tissues, finding no significant differences (Fig. 5B,C). Subsequent examination of the correlation between METTL3 expression and M1/M2 macrophage polarization revealed that macrophages expressing high levels of METTL3 exhibited a reduced M1 phenotype compared to those with low METTL3 expression. Conversely, the proportion of M2 macrophages was markedly elevated in the high METTL3 expression group relative to the low expression group, a trend consistent in both cancerous and adjacent non-cancerous tissues (Fig. 5D,E). Further studies indicated a
significant positive correlation between the expression of Mettl3 and
Cpt1a in macrophages, both in tumor tissues and adjacent non-tumor
tissues (p
Fig. 5.
Correlation between Mettl3 expression in macrophages
and M1/M2 ratio with prognostic implications in human hepatocellular carcinoma.
(A) Multicolor immunostaining displaying the protein expression levels of CD68,
iNOS, METTL3, CPT1A, and CD163 in human liver cancer (METTL3 high and low) and
adjacent tissues (Scale bar = 100 µm, upper panel, Scale bar = 200
µm). (B) Comparative analysis of METTL3 and CPT1A expression in hepatoma
tumor-associated macrophages within cancerous versus adjacent non-cancerous
tissues. (C) Differential expression of METTL3 and CPT1A in NAFLD-associated
hepatocellular carcinoma tumor-associated macrophages, contrasting cancerous with
adjacent non-cancerous tissues. (D,E) Evaluation of the proportion of M1 and M2
macrophages in relation to varying levels of METTL3 expression in macrophages,
compared between cancerous and adjacent non-cancerous tissues. (F) Linear
correlation assessment between METTL3 and CPT1A expressions in tumor-associated
macrophages in both cancerous and adjacent non-cancerous tissues. (G) Survival
analysis of patients stratified by different levels of macrophage METTL3
expression. (H) Correlation analysis between macrophage METTL3 expression and
clinical parameters, utilizing Cox regression. All experiments were performed in
triplicate, and statistical significance was considered at p
The impact of a high-fat diet on tumor immunity is multifaceted, encompassing a range of mechanisms and outcomes. A high-fat diet may modulate immune cell functions, such as those of T cells and macrophages, altering their metabolic states and potentially affecting their efficacy and reactivity [15]. This diet could induce a pro-inflammatory tilt in immune cells, possibly enhancing anti-tumor responses or, conversely, fostering immunosuppression that benefits tumor proliferation [16]. It is also associated with heightened chronic inflammation, a condition conducive to tumor progression and dissemination. Moreover, a high-fat diet could reshape the immune cellular makeup of the tumor microenvironment, influencing, for instance, the polarization of tumor-associated macrophages, thereby facilitating tumor expansion and immune evasion [14, 17]. Additionally, the expression of immune checkpoints like PD-1 and CTLA-4, crucial for T cell regulation and immune evasion, may be altered by such a diet. By activating specific metabolic pathways, including fatty acid oxidation, a high-fat diet can simultaneously influence the functions of both immune and tumor cells [15, 17]. Nutritional competition within the tumor milieu, where immune and tumor cells vie for resources, can be skewed by a high-fat diet, impacting the availability and allocation of nutrients essential for immunological responses. The dichotomous nature of a high-fat diet’s impact on tumor immunity—either promoting tumor growth or stimulating the immune system’s tumor-fighting capabilities—varies with the diet’s specifics, fat types, and consumption duration. Understanding these dynamics is vital for grasping tumor biology and advancing cancer therapeutics [18].
The intricate interplay between a high-fat diet and RNA modification in immune cells is an emerging scientific domain. Such a diet can perturb the balance of intracellular metabolites, potentially altering RNA modifications, including N6-methyladenosine (m6A), by serving as donors or cofactors [19]. This dietary pattern is known to provoke an inflammatory response, modulating the expression and activity of RNA-modifying enzymes, thereby reshaping the RNA modification landscape. In the present study, a high-fat diet significantly promotes liver cancer growth and induces type II differentiation of tumor-associated macrophages, particularly increasing M2 macrophages in NAFLD-afflicted mice. Transcriptomic analysis revealed that high-fat diet upregulates 546 genes and downregulates 561 genes in macrophages, with significant modifications in fatty acid oxidation and RNA modification pathways. Lipid-derived signaling molecules, like prostaglandins and leukotrienes, may be bolstered by a high-fat diet, influencing RNA-modifying enzymes through various signaling cascades [20]. High-fat intake can also trigger cellular stress responses, such as endoplasmic reticulum stress, which can interfere with the functions of RNA-binding proteins and modifiers [18]. Furthermore, it can impact macrophage polarization and potentially other immune cells by shifting their metabolic state, which could be linked to specific RNA modifications. These modifications, particularly m6A, are crucial in regulating differentiation and functions of T cells and B cells [21]. A high-fat diet, therefore, might indirectly modulate these pivotal immunological processes. The ramifications of such a diet on RNA modification extend to affecting immune system functionality and disease pathogenesis. Unraveling these mechanisms may illuminate the pathways through which high-fat diets influence immune regulation and disease, paving the way for novel therapeutic interventions [22]. Our current research revealed that a high-fat diet induces epigenetic alterations in macrophages via the up-regulation of Mettl3. These modifications are advantageous in augmenting the fatty acid metabolism capabilities of macrophages.
Methyltransferase-like 3 (METTL3) serves as a pivotal epigenetic regulator within macrophages, orchestrating N6-methyladenosine (m6A) mRNA modifications, the most prevalent internal modification in mRNA [23]. These modifications are vital for mRNA stability, post-transcriptional processing, and translation efficiency. METTL3’s roles in macrophages encompass Inflammatory Response Regulation: By modulating m6A modifications of inflammation-related genes, METTL3 influences macrophage activity and the subsequent inflammatory response [24]. Immune Response [25], signal Transduction and disease Progression [25, 26]. In this study, we identified the up-regulation of Mettl3 in macrophages induced by a high-fat diet. While this up-regulation might influence a spectrum of metabolism-related genes, our experimental data primarily indicate that the elevation of Mettl3 enhances lipid metabolism in macrophages. This enhancement is achieved through the stabilization of the Cpt1a gene, thereby exerting an immunosuppressive effect.
Fatty acid oxidation (FAO) in macrophages is pivotal for their functionality in health and disease [26]. Essential for energy production, particularly during prolonged immune responses, FAO involves the mitochondrial breakdown of long-chain fatty acids. This process not only fuels macrophages but also influences their polarization into M1 (pro-inflammatory) and M2 (anti-inflammatory) phenotypes. M2 macrophages, which show enhanced FAO, play a key role in inflammation resolution and tissue repair [27, 28]. Moreover, FAO regulates macrophage-mediated immune responses, affecting antigen presentation and cytokine secretion. In tumor environments, macrophage FAO status is crucial, with increased FAO linked to tumoricidal activity. Additionally, in metabolic disorders like obesity and diabetes, alterations in macrophage FAO can impact disease progression and inflammatory responses, underscoring FAO’s comprehensive role in macrophage physiology.
Carnitine palmitoyltransferase 1A (CPT1A) is an integral enzyme in lipid
metabolism, primarily facilitating the
In this investigation, we developed an in-situ mouse liver cancer implantation model conditioned by a high-fat diet to examine its effects on macrophage gene expression. Our findings indicate that the high-fat diet induces an elevation in the m6A modification of the Cpt1a gene within macrophages, potentially due to increased Mettl3 expression triggered by the diet. Although the exact mechanism by which the high-fat diet upregulates Mettl3 remains undetermined and warrants further study, our research opens new avenues for macrophage-targeted therapies. Specifically, modulating the m6A modification level of CPT1A in macrophages could downregulate its mRNA and protein expression, thereby reversing the macrophages’ metabolic profile. Such insights offer promising therapeutic strategies to counteract the metabolic reprogramming of macrophages in the context of elevated lipid levels, enhancing the efficacy of immunotherapies.
The datasets used during the current study are available from the corresponding author on reasonable request.
LZ was responsible for conception, design and manuscript writing. XL was responsible for collection and assembly of data. WW and XL were responsible for data analysis and interpretation. All authors were responsible for manuscript writing. All authors were responsible for the final approval of the manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
This study was in accordance with the Declaration of Helsinki and approved by the Ethics in Research Committee of People’s Hospital of Lianyungang (Approval No. 2021-LYG-038011). For clinical specimens, written informed consent was obtained from all participants or their families/legal guardians prior to the commencement of the study. For animal studies, all procedures involving animals were conducted in accordance with the guidelines established by Animal Welfare Act and the hospital, and approved by the ethics committee of People’s Hospital of Lianyungang (Approval No.2021LYG1387).
Not applicable.
This research received no external funding.
The authors declare no conflict of interest.
Supplementary material associated with this article can be found, in the online version, at https://doi.org/10.31083/FBL36971.
References
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.





