Eutopic endometrium (EU) and ectopic endometrium (EC) samples were obtained via hysterolaparoscopy from 30 patients diagnosed with EM ovarian cysts combined with infertility. Inclusion criteria for the EM group: (1) aged between 20 and 49 years; (2) regular menstrual cycles with sex hormone tests indicating the follicular phase; (3) confirmed EM diagnosis by laparoscopy and histopathology; (4) application of the revised American Fertility Society (r-AFS) scoring system for laparoscopic diagnosis of EM, with the intraoperative score classified as stage Ⅲ or Ⅳ. During surgery, specimens from endometriotic cyst walls were collected and categorized into the EC group; in situ endometrial tissues were collected and categorized into the EU group (n = 30). Normal endometrial (NE) samples were obtained from 30 patients who underwent hysterolaparoscopic surgery for tubal obstruction combined with infertility. Inclusion criteria for the NE group: (1) aged between 15 and 49 years; (2) regular menstrual cycles with sex hormone tests indicating the follicular phase. Exclusion criteria: (1) patients who received hormone therapy within 6 months before surgery; (2) history of thyroid disorders or other metabolic diseases; (3) history of pregnancy or lactation within 6 months before surgery; (4) presence of acute or chronic pelvic inflammatory disease; (5) concurrent gynecological conditions such as uterine fibroids, endometrial polyps, intrauterine adhesions, submucosal fibroids, or gynecological malignancies; (6) history of chronic diseases including cardiovascular disease, hypertension, diabetes mellitus, or other systemic conditions.

After collection, tissue samples were immediately frozen in liquid nitrogen and stored at –80 °C for subsequent analyses using high-throughput RNA-seq, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), Western blotting, and immunohistochemistry.

All tissue samples were stored at –80 °C before RNA extraction. Three samples from each group (EU, EC, NE; 9 in total) were chosen for RNA-seq analysis (Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China). After extracting total RNA, DNase I (2270A, Takara, Shiga, Japan) was used to remove genomic DNA. Subsequently, 1 µg of RNA was used to prepare a transcriptome library for RNA-seq using the TruSeqTM RNA sample preparation kit (Illumina, San Diego, CA, USA). Following mRNA isolation and fragmentation, double-stranded cDNA was synthesized using the SuperScript kit (Invitrogen, Carlsbad, CA, USA) and random hexamer primers (Illumina, San Diego, CA, USA). The cDNA subsequently underwent end-repair, phosphorylation, and the addition of an ‘A’ base, as per the Illumina library construction protocol. Libraries were sizes elected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA poly merase (NEB, Ipswich, MA, USA) for 15 PCR cycles. After Quantified by Qubit 4.0 (Q32854, Thermo Fisher Scientific, Waltham, MA, USA), these quencing library was performed on NovaSeq X Plus platform (PE150, Illumina, San Diego, CA, USA) using NovaSeq X Plus Reagent Kit (Illumina, San Diego, CA, USA).

The human endometriotic cell line 12Z was acquired from the Institute of Biochemistry and Cell Biology (Jennio-Bio, Guangzhou, China). All cell lines were validated by short tandem repeat (STR) profiling and tested negative for mycoplasma. Cells were grown in Dulbecco’s Modified Eagle medium (DMEM)/F12 medium (Gibco, Grand Island, NY, USA) containing 15% fetal bovine serum (CLARK Bioscience, Virginia, Australia) and 1% penicillin–streptomycin (Minibio, Shanghai, China) at 37 °C in a 5% CO₂ incubator.

Plasmids were constructed using ProteinBio (ProteinBio Biotechnology, Nanjing, Jiangsu, China). The full-length CEBPD cDNA was cloned into the pCDH-CMV-MCS-EF-copGFP-T2A-Puro vector using EcoRI and BamHI tags. Positive clones were obtained through overlap PCR. Briefly, the sh-CEBPD-1, sh-CEBPD-2, and scrambled non-targeting shRNA (sh-control) vectors were produced by incorporating sh-CEBPD-1, sh-CEBPD-2, and scrambled DNAs into the AgeI and EcoRI sites of the pLKO.1-puro vector. To produce lentivirus particles, HEK293T cells were co-transfected with 10 µg of sh-CEBPD-1 and sh-CEBPD-2 DNAs, 5 µg of psPAX2, and 10 µg of pMD2.G packaging plasmids using Lipofectamine 2000. Two days after transfection, the supernatants were collected and used to transduce 12Z cells, followed by selection of positive cells. The sh-CEBPD-1 sequence was CCGACCUCCUCAACAGCAAUCACAA, while the sh-CEBPD-2 sequence was GCTGTCGGCTGAGAACGAGAA.

RNA was isolated from tissue samples using an RNA Simple Total RNA kit (DP419, TIANGEN, Beijing, China), per the manufacturer’s instructions. Subsequently, RNA was reverse-transcribed into cDNA using a FastKing RT kit with gDNase (KR116, TIANGEN, Beijing, China). Then, the cDNA was subjected to a quantitative polymerase chain reaction (qPCR) using Talent qPCR PreMix (FP209, TIANGEN, Beijing, China) on a CFX96 Touch Real-Time PCR Detection System (BioRad, Herculaneum, CA, USA). The obtained Ct values were normalized to the GAPDH housekeeping gene. The forward and reverse primer sequences are listed in Supplementary Table 1.

Briefly, 1 $\times$ 10⁶ cells were washed twice with cold PBS, cross-linked using 1% formaldehyde at room temperature for 10 minutes, and subsequently quenched with glycine (G7126, Sigma-Aldrich, St. Louis, MO, USA) at a final concentration of 125 mmol/L. Chromatin was released following lysis of the cells on ice. The samples were then sonicated, and soluble sheared chromatin was collected. The average DNA length was between 200 and 500 bp. Chromatin samples (20 µL) were stored at –20 °C for input DNA, while 100 µL was used for immunoprecipitation with 10 µg of anti-CEBPD antibody (1:30, #ab245214, Abcam, Cambridge, MA, USA) or IgG antibody (1:50, #2729S, CST, Boston, MA, USA) at 4 °C overnight. The following day, 30 µL of protein beads was added, and the samples were incubated for an additional 3 h. Afterward, the DNA obtained from immunoprecipitation was amplified by PCR using the specific primers shown in Supplementary Table 1. The ChamQ SYBR Color qPCR Master Mix (Q411-02, Vazyme Biotech, Nanjing, Jiangsu, China) was used for PCR. Enrichment values were normalized to the input sample and calculated using the 2^{-Δ⁢Δ⁢Ct} method [16].

Western blot analysis was performed according to standard procedures to evaluate the expression of CEBPD, DNA damage-inducible transcript 4 (DDIT4), extracellular signal-regulated kinase (ERK), phospho-ERK (p-ERK), $\beta$-actin and HSP90. After blocking with a buffer, the membranes were incubated with the following primary antibodies overnight at 4 °C: CEBPD (1:1000, #ab245214, Abcam, Cambridge, MA, USA), DDIT4 (1:600, 10638-1-AP, Proteintech, Chicago, IL, USA), ERK (1:1000, #ab184699, Abcam, Cambridge, MA, USA), p-ERK (1:1000, #ab229912, Abcam, Cambridge, MA, USA), $\beta$-actin (1:1000, #ab8226, Abcam, Cambridge, MA, USA), and HSP90 (1:1000, #ab203085, Abcam, Cambridge, MA, USA). Upon completion of the primary antibody incubation, the membrane was washed three times with an adequate volume of 1$\times$ TBST on a shaker. Subsequently, the membrane was incubated with horseradish peroxidase-conjugated secondary antibody (1:4000, #32460, Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C for 1 hour. Finally, the membrane was placed flat in the imaging system, and images were captured using the C400 visible chemiluminescence imaging system (Azure Biosystems, Dublin, OH, USA). The grayscale ratio of the target band to the internal reference was analyzed using ImageJ software (version 1.53t, National Institutes of Health, Bethesda, MD, USA).

Tissues were fixed using 4% paraformaldehyde (P0099-3L, Beyotime Biotechnology, Nantong, Jiangsu, China), embedded in paraffin, sectioned into 5 µm slices, and stained with hematoxylin and eosin (H&E) according to standard protocols. Immunohistochemical staining was performed on the tissue sections using anti-human CEBPD (1:200, #ab245214, Abcam, Cambridge, MA, USA) and anti-human DDIT4 (1:100, #10638-1-AP, Proteintech, Chicago, IL, USA). Stained slides were observed by light microscopy, and the images were recorded. The immunoreactivity scores for CEBPD and DDIT4 were determined by multiplying the score for the percentage of positive cells (0: 1%, 1: 1–25%, 2: 26–50%, 3: 51–75%, 4: $>$75%) by the score for staining intensity (0: negative, 1: weak, 2: moderate, 3: strong), thus providing a range from 0 to 12.

Total protein was extracted from 12Z cells after harvesting. The levels of lipid peroxidation, malondialdehyde (MDA), and superoxide dismutase (SOD) activity were assessed using Mn-SOD assay kits (S0103, Beyotime Biotechnology, Nantong, Jiangsu, China) and lipid peroxidation MDA assay kits (S0131, Beyotime Biotechnology, Nantong, Jiangsu, China) according to the manufacturer’s instructions. An oxidative stress model was generated by treating 12Z cells with hydrogen peroxide (H₂O₂), and ROS levels were analyzed using flow cytometry.

A total of 5000 12Z cells were placed into 96-well plates and incubated for 24 h. Thereafter, 10 µL of Cell Counting kit-8 (CCK-8) solution (C0038, Beyotime Biotechnology, Nantong, Jiangsu, China) was added to each well and the plates incubated for the specified period. Cell viability was evaluated at specific time points, and the absorbance was measured at 450 nm using an enzyme immunoassay device.

Fresh fertilized eggs weighing approximately 50 to 60 grams were obtained for this study (n = 24). Chick embryos were randomly allocated into four groups: sh-control, sh-CEBPD, vector control, and OE-CEBPD (n = 6 in each group). Following disinfection and fenestration, the shell membrane was removed, and the eggs were positioned upright in an incubator. Subsequently, 2 million 12Z cells were suspended in 500 µL of serum-free medium and applied onto gelatin sponges, which were then transplanted into the avascular region of the chorioallantoic membrane of 7-day-old chick embryos. A control group was concurrently established to assess the effects of sh-CEBPD-12Z cells and OE-CEBPD-12Z cells on angiogenesis. After 72 h, the sealing tape was carefully removed, and the chick embryo was gently excised circularly to expose the chorioallantoic membrane fully. High-resolution images were subsequently captured using a Canon camera (EOS 5D Mark IV, Canon EF 100 mm f/2.8L Macro IS USM, Ohta-ku, Tokyo, Japan), and the area of angiogenesis in the chick embryo allantoic membrane was quantified using Image-Pro Plus Image analysis software (version 7.0, Media Cybernetics, Rockville, MD, USA).

An EdU kit (C0075S, Beyotime Biotechnology, Nantong, Jiangsu, China) was employed for EdU cell proliferation staining. Different groups of cells were collected and suspended, and the density was adjusted after counting. A total of 5 $\times$ 10⁴ cells/well were then inoculated into 24-well plates and grown for 48 h. This was followed by incubation with EdU for 2 h, fixation with 4% paraformaldehyde for 15 minutes, and permeabilization using 0.3% Triton X-100 (A600198, Sangon Biotech, Shanghai, China) for 15 minutes. The cells were then incubated with Click Additive Solution for 30 min and finally incubated with Hoechst 33342 for 10 min before image capturing.

The colony formation assay involved inoculating 1000 cells into 6-well plates and incubating at 37 °C in a 5% CO₂ environment for two weeks. After fixing using methanol for 30 minutes, the cells were stained with a 0.2% crystal violet solution (C0121, Beyotime Biotechnology, Nantong, Jiangsu, China). A Bio-Rad chemiluminescence imager (Bio-Rad ChemiDoc MP Imaging System, version 6.1, Hercules, CA, USA) was used to capture images, and colonies with $>$50 cells were counted. Each assay was performed in triplicate.

SPSS 22.0 (IBM, Armonk, NY, USA) and GraphPad Prism8 (GraphPad Software, San Diego, CA, USA) software were employed for all statistical analyses and graphical images, respectively. Data are presented as the mean $\pm$ standard deviation (SD) or mean $\pm$ standard error of the mean (SEM). For data conforming to a normal distribution, the expression levels between two groups were compared using Student’s t-test (two-tailed). In contrast, one-way analysis of variance (ANOVA) was employed to assess the null hypothesis concerning differences between groups, with Tukey’s test used for multiple comparisons. Data that were not normally distributed are presented as the median (interquartile range) [M (P25, P75)], with the groups compared using non-parametric tests. Results were considered statistically significant at a value of p 0.05.

A total of 60 patients were enrolled in this study, comprising 30 in the NE and 30 in the EM groups. Table 1 presents a comparison of the baseline characteristics between the two groups. No statistically significant differences in age, body mass index (BMI), or sex hormone levels were noted between the two groups. However, cancer antigen 125 (CA125) levels were significantly higher in the EM group than in the NE group (p 0.001).

RNA-seq data were obtained from the NE, EU, and EC samples. Genes exhibiting significantly different mRNA expression levels between these tissues were identified by DESeq2 analysis and are represented by volcano plots in Fig. 1. Among the 3756 differentially expressed mRNA transcripts between NE and EC, 2111 were upregulated and 1645 were downregulated (Fig. 1A). In addition, 3334 mRNA transcripts were differentially expressed (1848 upregulated and 1486 downregulated) between EU and EC (Fig. 1B). However, only eight differentially expressed mRNA transcripts were found between NE and EU, of which six were upregulated, meaning two were downregulated (Fig. 1C).

Fig. 1.

CEBPD upregulation in human EM tissues. (A) Volcano plot of RNA expression in NE vs. EC dataset (n = 6). (B) Volcano plot of RNA expression in EU vs. EC dataset (n = 6). (C) Volcano plot of RNA expression in NE vs. EU dataset (n = 6). (D) Venn diagram of the commonly expressed RNAs in NE vs. EC, EU vs. EC, and NE vs. EU datasets. (E) Relative CEBPD, SLC5A1, and RXFP1 expression levels in NE, EU, and EC tissues as detected by RT-qPCR and normalized to GAPDH levels (Log₂-transformed value = log₂ (original value + 1); values shown for CEBPD are (M (P25, P75)) from the Kruskal-Wallis test. For SLC5A1: NE vs. EU, p = 0.017; NE vs. EC, p = 0.745. For RXFP1: NE vs. EU, p = 0.026; NE vs. EC, p = 0.001. Values shown for RXFP1 and SLC5A1 are (M (P25, P75)) from the Kruskal-Wallis test; n = 30). (F) CEBPD expression in NE, EU, and EC tissues following Western blotting (NE vs. EU, p = 0.02; NE vs. EC, p 0.001; EU vs. EC, p 0.001; values are the mean $\pm$ SD from one-way ANOVA; n = 3). (G) Immunohistochemistry revealed CEBPD upregulation in EC tissues compared with EU and NE tissues. CEBPD is detected in both epithelial and stromal cells. Scale bar = 50 µm. NE, normal endometrium; EU, eutopic endometrium; EC, ectopic endometrium; EU-neg, EU stained without antibody; CEBPD, CCAAT enhancer binding protein delta; SLC5A1, solute carrier family 5 member 1; RXFP1, relaxin family peptide receptor 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; ANOVA, one-way analysis of variance. ***p 0.001; **p 0.01; *p 0.05; ns, not significant.

Five genes were differentially expressed in all three group comparisons (NE vs. EC; EU vs. EC; NE vs. EU): CEBPD, solute carrier family 5 member 1 (SLC5A1), relaxin family peptide receptor 1 (RXFP1), LINC03026, and C2 calcium-dependent domain-containing 4B (C2CD4B) (Fig. 1D). An intersection analysis of the above genes with the oxidative stress-related gene sets (https://www.genecards.org) revealed that CEBPD, SLC5A1, and RXFP1 were the only common genes. RT-qPCR results confirmed the reliability of high-throughput RNA-seq findings by showing that CEBPD expression was significantly elevated in EC tissue compared to NE (NE vs. EC, p 0.001) and EU (EU vs. EC, p 0.001) tissues (Fig. 1E). Furthermore, Western blotting analysis showed that CEBPD was highly expressed in endometriotic tissues (Fig. 1F). Immunohistochemical analysis demonstrated that CEBPD expression was minimal in normal endometrium. In contrast, immunohistochemical analysis exhibited positive immunoreactivity in both eutopic and ectopic endometria, with significantly enhanced signal intensity observed in the ectopic endometria. Furthermore, immunohistochemical analysis revealed that CEBPD exhibited positive expression in both the nuclei of epithelial and stromal cells (Fig. 1G).

To gain more insight into the involvement of CEBPD in the onset and progression of endometriotic lesions, we next evaluated the effects of CEBPD expression on oxidative stress, proliferation and angiogenesis in the 12Z endometriosis cell line (Fig. 2A). Compared with the sh-control group, the MDA levels were significantly reduced in both the sh-CEBPD-1 group (2.43 $\pm$ 0.37 vs. 1.28 $\pm$ 0.48, p 0.001) and the sh-CEBPD-2 group (2.43 $\pm$ 0.37 vs. 1.22 $\pm$ 0.51, p 0.001). In contrast, compared with the sh-control group, SOD levels were significantly increased in both the sh-CEBPD-1 group (2.45 $\pm$ 0.24 vs. 5.32 $\pm$ 0.30, p = 0.005) and the sh-CEBPD-2 group (2.45 $\pm$ 0.24 vs. 6.50 $\pm$ 1.37, p = 0.001). Compared with the sh-control group, ROS levels in the oxidative stress cell model were significantly reduced in both the sh-CEBPD-1 group (44.65 $\pm$ 3.68 vs. 24.26 $\pm$ 1.30, p 0.001) and the sh-CEBPD-2 group (44.65 $\pm$ 3.68 vs. 27.67 $\pm$ 1.34, p 0.001). These results indicate that CEBPD expression suppression significantly decreased the levels of MDA and ROS in 12Z cells, while concurrently increasing SOD levels (Fig. 2B–D). EdU incorporation, the CCK-8 viability assay, and the colony formation assay all showed that inhibiting CEBPD expression markedly reduced the proliferative capacity of 12Z cells (Fig. 2E,F; Supplementary Fig. 1A). In the chick chorioallantoic membrane (CAM) assay, implantation of sh-CEBPD-12Z cells into the avascular region significantly reduced neovascularization due to suppressed CEBPD expression (p = 0.024; Fig. 2G).

Fig. 2.

CEBPD knockdown inhibits oxidative stress, proliferation, and angiogenesis in 12Z cells. (A) Negative control or shRNA (sh-CEBPD #1, #2) was transfected into 12Z cells (sh-control group vs. sh-CEBPD-1 group, p 0.001; sh-control group vs. sh-CEBPD-2 group, p = 0.01; values are presented as the mean $\pm$ SD from a one-way ANOVA test; n = 3). (B,C) CEBPD expression in 12Z cells was inhibited to evaluate changes in MDA and SOD levels (values are presented as the mean $\pm$ SD from one-way ANOVA test; n = 3). (D) The oxidative stress model was constructed using hydrogen peroxide (H₂O₂), and the effect of CEPBD inhibition on ROS levels in 12Z cells was detected by flow cytometry (values are presented as the mean $\pm$ SD from a one-way ANOVA test; n = 3). (E) The proliferative capacity of 12Z cells was assessed using the CCK-8 assay, and the results are presented as a line chart (sh-control group vs. sh-CEBPD-1 group, p 0.001; sh-control group vs. sh-CEBPD-2 group, p 0.001; values are shown as the mean $\pm$ SD following a one-way ANOVA test; n = 3). (F) The proliferative capacity of 12Z cells was assessed using the clone formation assay, with the bar graphs showing the number of colonies (sh-control group vs. sh-CEBPD-1 group, p = 0.013; sh-control group vs. sh-CEBPD-2 group, p = 0.001; values are presented as the mean $\pm$ SD after a one-way ANOVA test; n = 3). Scale bar = 5 mm. (G) The effects of CEBPD inhibition on angiogenesis were analyzed using the chick embryo chorioallantoic membrane test. Red arrows indicate new blood vessels (values are the mean $\pm$ SD following the Student’s t-test; n = 3). Scale bar = 2 mm. MDA, malondialdehyde; SOD, superoxide dismutase; CCK-8, Cell Counting kit-8. ***p 0.001; **p 0.01; *p 0.05.

We successfully constructed a CEBPD overexpression vector and transfected 12Z cells (Fig. 3A). Compared with the vector group, MDA levels were significantly increased in the OE-CEBPD group (2.70 $\pm$ 0.61 vs. 3.80 $\pm$ 0.74, p = 0.013). In contrast, SOD levels were significantly reduced (2.74 $\pm$ 0.67 vs. 1.35 $\pm$ 0.20, p = 0.026). Additionally, ROS levels in the oxidative stress cell model were significantly increased in the OE-CEBPD group compared with the vector group (36.50 $\pm$ 2.54 vs. 64.82 $\pm$ 3.30, p 0.001). CEBPD overexpression resulted in significantly increased MDA and ROS levels (Fig. 3B,C), and reduced SOD (Fig. 3D). CEBPD overexpression also promoted cell proliferation (Fig. 3E,F; Supplementary Fig. 1B) and angiogenesis (p = 0.034; Fig. 3G).

Fig. 3.

CEBPD overexpression promotes oxidative stress, proliferation, and angiogenesis in 12Z cells. (A) Western blot results confirmed successful construction of the CEBPD overexpression vector (p 0.001; values are presented as the mean $\pm$ SD from a Student’s t-test; n = 3). (B,C) CEBPD overexpression in 12Z cells to assess changes in MDA and SOD levels (values are shown as the mean $\pm$ SD following Student’s t-test; n = 3). (D) The oxidative stress model was established using hydrogen peroxide (H₂O₂), and the impact of CEPBD overexpression on reactive oxygen species (ROS) levels in 12Z cells was assessed by flow cytometry. (E) The proliferative capacity of 12Z cells was assessed by CCK-8 assay, with the results presented as a line chart (p 0.001; values are presented as the mean $\pm$ SD after Student’s t-test; n = 3). (F) The proliferative capacity was assessed using the clone formation assay, with the bar graphs showing the number of colonies (p 0.001; values are the mean $\pm$ SD from a Student’s t-test; n = 3). Scale bar = 5 mm. (G) The effects of CEBPD overexpression on angiogenesis were analyzed using the chick embryo chorioallantoic membrane (CAM) assay. Red arrows indicate newly formed blood vessels (p = 0.034; values represent the mean $\pm$ SD from a Student’s t-test; n = 3). Scale bar = 2 mm. ***p 0.001; *p 0.05.

To further investigate the regulatory mechanism of CEBPD in oxidative stress, proliferation, and angiogenesis related to EM, we employed shRNA technology to knock down CEBPD expression in 12Z cells and subsequently conducted RNA-seq analysis. Differentially expressed genes (DEGs) were analyzed to compare the sh-control and sh-CEBPD-1 groups. This analysis revealed 78 DEGs (│log₂FC│ $\ge$4), of which 39 were upregulated and 39 were downregulated (Fig. 4A). Furthermore, intersection of the above genes with oxidative stress-related genes with relevance scores $\ge$6 (https://www.genecards.org, Supplementary Table 2) identified 10 genes: brain-derived neurotrophic factor (BDNF), c-c motif chemokine ligand 5 (CCL5), collagen type IV alpha 1 chain (COL4A1), DNA damage inducible transcript 4 (DDIT4), gamma-glutamyltransferase 1 (GGT1), n-myc downstream regulated 1 (NDRG1), neurotrophin 3 (NTF3), nuclear protein 1, transcriptional regulator (NUPR1), S100 calcium binding protein A9 (S100A9), and serpin family E member 1 (SERPINE1). DDIT4 gene was selected for further study. RT-qPCR, Western blot, and immunohistochemistry results confirmed that DDIT4 expression was upregulated in the EU and EC tissues. Furthermore, immunohistochemical analysis revealed that DDIT4 exhibited positive expression in both the nucleus and cytoplasm of epithelial and stromal cells (Fig. 4B–D). Primer 5.0 (version 5.0, Premier Biosoft International, Palo Alto, CA, USA) was used to predict the binding site and to design primers to determine whether CEBPD can bind to the DDIT4 promoter sequence, and three binding sites (D1, D2, D3) were predicted. ChIP-qPCR analysis of the 12Z cell line showed that significantly more DDIT4 was precipitated when using CEBPD antibodies than with IgG antibodies. Moreover, the ChIP assay in 12Z cells confirmed that CEBPD was directly correlated with DDIT4 promoters within D1 and D2, with the most significant binding observed in D2 (Fig. 4E). These data for the D3 region did not meet our stringent quality control criteria and were, therefore, excluded from further analysis. Inhibition of CEBPD expression significantly reduced the DDIT4 mRNA and protein levels in 12Z cells, whereas CEBPD overexpression promoted DDIT4 expression (Fig. 4F–H).

Fig. 4.

CEBPD promotes DDIT4 expression in 12Z cells. (A) Differential expression volcano map. Blue dots indicate significantly downregulated genes following shRNA-mediated CEBPD knockdown, whereas red dots represent significantly upregulated genes. X-axis: log2-fold change of gene expression; Y-axis: statistical significance of the differential expression in log10. (B) RT-qPCR analysis was performed to validate DDIT4 mRNA expression in NE, EU, and EC (NE vs. EC, p 0.001; NE vs. EU, p 0.001; EU vs. EC, p = 0.02; Values for DDIT4 are shown as (M (P25, P75)) following the Kruskal-Wallis test; n = 30). (C) Western blot analysis of DDIT4 expression in EU and EC tissues, and paired NE tissue (NE vs. EC, p 0.001; NE vs. EU, p = 0.001; EU vs. EC, p = 0.007). Values are presented as the mean $\pm$ SD from a one-way ANOVA test; n = 3. (D) Immunohistochemistry showed that DDIT4 was upregulated in EU and EC tissues compared to NE. DDIT4 is detected in both epithelial cells and stromal cells. Scale bar = 50 µm. (E) ChIP-qPCR assay in 12Z cells confirmed that CEBPD was directly correlated with DDIT4 promoters within D1, D2 (D1 p = 0.011; D2 p = 0.002; values are presented as the mean $\pm$ SD from a Student’s t-test; n = 3). (F) CEBPD was first overexpressed in 12Z cells, and then the impact on DDIT4 mRNA expression was assessed (p = 0.020; values are presented as the mean $\pm$ SD from a Student’s t-test; n = 3). (G) Following CEBPD knockdown in 12Z cells, the relative expression of DDIT4 mRNA was quantified by RT-qPCR (sh-control group vs. sh-CEBPD-1 group, p 0.001; sh-control group vs. sh-CEBPD-2 group, p 0.001; values are presented as the mean $\pm$ SD from a one-way ANOVA test; n = 3). (H) CEBPD was overexpressed or knocked down in 12Z cells, and the impact on DDIT4 protein levels was assessed (vector vs. OE-CEBPD, p 0.001; values are presented as the mean $\pm$ SD from a Student’s t-test. sh-control group vs. sh-CEBPD-1 group, p 0.001; sh-control group vs. sh-CEBPD-2 group, p 0.001; values are presented as the mean $\pm$ SD from a one-way ANOVA test; n = 3). DDIT4, DNA damage-inducible transcript 4; DEGs, differentially expressed genes; FC, fold change. *p 0.05, **p 0.01, and ***p 0.001.

To further confirm the relationship between CEBPD and DDIT4 in EM, related vectors were constructed as shown in Fig. 5A. Inhibition of CEBPD expression was found to reduce the levels of ROS and MDA significantly, increase SOD activity (Fig. 5B–D), and decrease the proliferation of 12Z cells (Fig. 5E–G). These effects were reversed by DDIT4 supplementation, indicating that CEBPD promotes ectopic endometrial cell oxidative stress and proliferation in EM by activating DDIT4.

Fig. 5.

CEBPD promotes oxidative stress and proliferation by targeting DDIT4 in 12Z cells. (A) The expression levels of CEBPD and DDIT4 in different groups were analyzed by Western blot (the p-values for CEBPD and DDIT4 in other groups: sh-control group vs. sh-CEBPD group, p 0.001 and p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.825 and p = 0.002; values represent the mean $\pm$ SD following one-way ANOVA; n = 3). (B) In the rescue experiment, the level of MDA was assessed in 12Z cells (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.016; values represent the mean $\pm$ SD following one-way ANOVA; n = 6). (C) In the rescue experiment, SOD activity was assessed in 12Z cells (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p 0.001; values are presented as the mean $\pm$ SD following one-way ANOVA; n = 3). (D) The oxidative stress model was constructed in 12Z cells using H₂O₂, and the effect of CEBPD and DDIT4 expression on ROS levels was determined by flow cytometry (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.023; values represent the mean $\pm$ SD after one-way ANOVA; n = 3). (E) The proliferative ability of 12Z cells in different groups was analyzed by CKK-8 (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.030; values are presented as the mean $\pm$ SD from one-way ANOVA; n = 3). (F) The proliferative ability of 12Z cells in different groups was analyzed with the colony formation assay, with bar charts showing the colony numbers (sh-control group vs. sh-CEBPD group, p = 0.017; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.109; values represent the mean $\pm$ SD from one-way ANOVA; n = 3). Scale bars = 5 mm. (G) The proliferative ability of 12Z cells in different groups was analyzed using the EdU assay (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.029; values represent the mean $\pm$ SD from one-way ANOVA; n = 3). Scale bars = 100 µm. EdU, 5-Ethynyl-2^′-deoxyuridine. *p 0.05, **p 0.01, and ***p 0.001; ns, not significant.

In patients with non-alcoholic steatohepatitis (NASH), DDIT4 may facilitate the assembly of the p38-mitogen-activated protein kinase (MAPK) signaling complex in a S-nitrosylation-dependent manner, thereby enhancing ROS production [17]. We further explored the mechanism that underlies the promoting effect of CEBPD on ectopic endometrial cell proliferation and oxidative stress in EM. CEBPD was knocked down in 12Z cells using lentivirus shRNA, producing cell lines in which CEBPD and DDIT4 were significantly downregulated (Fig. 6A,B). Furthermore, the Western blot results indicated that the phospho-ERK (p-ERK) inhibition caused by sh-CEBPD was partially alleviated in the presence of DDIT4 overexpression (Fig. 6C). These results suggest that CEBPD may promote ectopic endometrial cell proliferation and oxidative stress by activating p-ERK activity through DDIT4.

Fig. 6.

CEBPD activates the ERK pathway in 12Z cells through DDIT4. (A) The expression of CEBPD in different groups was analyzed by RT-qPCR (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.742; values shown are the mean $\pm$ SD following one-way ANOVA; n = 3). (B) The expression of DDIT4 in different groups was analyzed by RT-qPCR (sh-control group vs. sh-CEBPD group, p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.005; values shown are the mean $\pm$ SD after one-way ANOVA; n = 3). (C) The expression of CEBPD, DDIT4, ERK1/2, and p-ERK in different groups was determined by Western blot analysis (the p-values for ERK and p-ERK in other groups, sh-control group vs. sh-CEBPD group, p = 0.874 and p 0.001; sh-CEBPD group vs. sh-CEBPD + OE-DDIT4 group, p = 0.993 and p = 0.016; values represent the mean $\pm$ SD following one-way ANOVA; n = 3). ERK, extracellular signal-regulated kinase; p-ERK, phospho-ERK. ***p 0.001; **p 0.01; *p 0.05; ns, not significant.