1 Department of Reproductive Medicine, The Second Affiliated Hospital of Soochow University, 215004 Suzhou, Jiangsu, China
2 Department of Reproductive Medicine, Huai’an Maternity and Child Health Care Hospital Affiliated to Yangzhou University, 223002 Huai’an, Jiangsu, China
3 The Digestive and Reproductive System Cancers Precise Prevention Engineering Research Center of Jiangsu Province, Jiangsu College of Nursing, 223002 Huai’an, Jiangsu, China
Abstract
Endometriosis (EM) is a prevalent gynecological disorder in women. Although the underlying mechanisms have yet to be fully elucidated, EM may be related to oxidative stress. The current research aimed to identify possible pathways that control oxidative stress in EM, thereby providing a theoretical foundation for its clinical diagnosis and treatment.
High-throughput RNA sequencing (RNA-seq) data were integrated with GeneCards online data to screen for oxidative stress-related genes and potential targets in EM. The reverse transcription-quantitative polymerase chain reaction (RT-qPCR), Western blotting, and immunohistochemistry assays confirmed the expression of candidate genes. The in vivo and in vitro effects of CCAAT enhancer binding protein delta (CEBPD, C/EBP-delta) and DNA damage-inducible transcript 4 (DDIT4) on oxidative stress, cell proliferation, and angiogenesis in endometriotic cells were validated using loss- or gain-of-function approaches.
CEBPD was highly expressed in ectopic and eutopic endometrial tissue from patients with endometriosis. Loss- or gain-of-function experiments showed that CEBPD promoted oxidative stress, cell proliferation, and angiogenesis in vitro and in vivo. Integration of RNA-seq and online data revealed that CEBPD regulates DDIT4 expression, subsequently increasing oxidative stress, cell proliferation, and angiogenesis in endometriotic cells. Finally, CEBPD and DDIT4 were found to regulate the expression of extracellular signal-regulated kinase 1/2 (ERK1/2) proteins associated with the mitogen-activated protein kinase (MAPK) signaling pathway.
These results suggest that CEBPD may promote oxidative stress, cell proliferation, and angiogenesis in EM by activating MAPK via DDIT4. Hence, CEBPD may be a potential target for diagnosing and treating EM.
Keywords
- endometriosis
- CCAAT-enhancer-binding protein-delta
- oxidative stress
- cell proliferation
- angiogenesis
Endometriosis (EM) is characterized primarily by intense pelvic pain and infertility, and is the most prevalent gynecological condition among reproductive-aged women [1]. The pathogenesis of EM is complex and involves increased cell adhesion, degradation of the extracellular matrix, angiogenesis, proliferation, abnormal cell apoptosis, interference with cell communication, disruption of the immune system, loss of differentiation, alongside other pathophysiological processes [2, 3, 4]. However, the mechanism underlying EM remains unclear, and only a few drugs can effectively control this disease. Therefore, investigations of the pathogenic mechanism of EM and the development of novel therapeutic approaches are of great clinical significance.
Oxidative stress arises from the dysregulation of redox homeostasis, characterized by an imbalance between the excessive production of reactive oxygen species (ROS) and the compromised function of antioxidant defense mechanisms. Moreover, ROS and free radicals not only have the potential to induce cellular damage but also contribute significantly to disease progression [5]. Meanwhile, oxidative stress may be crucial in the onset and progression of EM, primarily by affecting the proliferation and damage of endometriotic cells [6]. Notably, oxidative stress is intricately linked to angiogenesis, with effective regulation of oxidative stress contributing positively to this process [7]. However, the specific genes and pathways associated with EM remain largely unidentified. Meanwhile, the advent of next-generation sequencing technology offers a powerful approach for investigating the transcriptomic, genomic, and epigenomic alterations involved in the pathogenesis of EM and for identifying novel pathogenic genes [8, 9, 10]. RNA sequencing (RNA-seq) analysis in the present study revealed that expression of CCAAT enhancer binding protein delta (CEBPD, C/EBP-delta) was significantly elevated in endometriosis tissues, suggesting a potential role in the pathogenesis of this EM. CEBPD is an intron-free protein encoded by the basic (region) leucine zipper (bZIP) transcription factors that bind to DNA through leucine zipper domains and regulate gene expression across various cell types [11]. As a transcription factor, CEBPD has been implicated in tumor growth, metastasis, and treatment resistance [12, 13, 14]. A recent study on high-grade serous ovarian carcinoma found that CEBPD enhanced tumor growth by facilitating drug resistance and cell invasion [15]. However, to our knowledge, the role and mechanism of CEBPD in EM have yet to be reported.
This study seeks to elucidate the role of CEBPD in oxidative stress, cell proliferation, and angiogenesis in EM. A thorough analysis of the pathogenesis of EM should help to identify potential diagnostic markers for this disease.
Eutopic endometrium (EU) and ectopic endometrium (EC) samples were obtained via hysterolaparoscopy from 30 patients diagnosed with EM ovarian cysts combined with infertility. Inclusion criteria for the EM group: (1) aged between 20 and 49 years; (2) regular menstrual cycles with sex hormone tests indicating the follicular phase; (3) confirmed EM diagnosis by laparoscopy and histopathology; (4) application of the revised American Fertility Society (r-AFS) scoring system for laparoscopic diagnosis of EM, with the intraoperative score classified as stage Ⅲ or Ⅳ. During surgery, specimens from endometriotic cyst walls were collected and categorized into the EC group; in situ endometrial tissues were collected and categorized into the EU group (n = 30). Normal endometrial (NE) samples were obtained from 30 patients who underwent hysterolaparoscopic surgery for tubal obstruction combined with infertility. Inclusion criteria for the NE group: (1) aged between 15 and 49 years; (2) regular menstrual cycles with sex hormone tests indicating the follicular phase. Exclusion criteria: (1) patients who received hormone therapy within 6 months before surgery; (2) history of thyroid disorders or other metabolic diseases; (3) history of pregnancy or lactation within 6 months before surgery; (4) presence of acute or chronic pelvic inflammatory disease; (5) concurrent gynecological conditions such as uterine fibroids, endometrial polyps, intrauterine adhesions, submucosal fibroids, or gynecological malignancies; (6) history of chronic diseases including cardiovascular disease, hypertension, diabetes mellitus, or other systemic conditions.
After collection, tissue samples were immediately frozen in liquid nitrogen and stored at –80 °C for subsequent analyses using high-throughput RNA-seq, reverse transcription-quantitative polymerase chain reaction (RT-qPCR), Western blotting, and immunohistochemistry.
All tissue samples were stored at –80 °C before RNA extraction. Three samples from each group (EU, EC, NE; 9 in total) were chosen for RNA-seq analysis (Majorbio Bio-Pharm Technology Co., Ltd., Shanghai, China). After extracting total RNA, DNase I (2270A, Takara, Shiga, Japan) was used to remove genomic DNA. Subsequently, 1 µg of RNA was used to prepare a transcriptome library for RNA-seq using the TruSeqTM RNA sample preparation kit (Illumina, San Diego, CA, USA). Following mRNA isolation and fragmentation, double-stranded cDNA was synthesized using the SuperScript kit (Invitrogen, Carlsbad, CA, USA) and random hexamer primers (Illumina, San Diego, CA, USA). The cDNA subsequently underwent end-repair, phosphorylation, and the addition of an ‘A’ base, as per the Illumina library construction protocol. Libraries were sizes elected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA poly merase (NEB, Ipswich, MA, USA) for 15 PCR cycles. After Quantified by Qubit 4.0 (Q32854, Thermo Fisher Scientific, Waltham, MA, USA), these quencing library was performed on NovaSeq X Plus platform (PE150, Illumina, San Diego, CA, USA) using NovaSeq X Plus Reagent Kit (Illumina, San Diego, CA, USA).
The human endometriotic cell line 12Z was acquired from the Institute of Biochemistry and Cell Biology (Jennio-Bio, Guangzhou, China). All cell lines were validated by short tandem repeat (STR) profiling and tested negative for mycoplasma. Cells were grown in Dulbecco’s Modified Eagle medium (DMEM)/F12 medium (Gibco, Grand Island, NY, USA) containing 15% fetal bovine serum (CLARK Bioscience, Virginia, Australia) and 1% penicillin–streptomycin (Minibio, Shanghai, China) at 37 °C in a 5% CO2 incubator.
Plasmids were constructed using ProteinBio (ProteinBio Biotechnology, Nanjing, Jiangsu, China). The full-length CEBPD cDNA was cloned into the pCDH-CMV-MCS-EF-copGFP-T2A-Puro vector using EcoRI and BamHI tags. Positive clones were obtained through overlap PCR. Briefly, the sh-CEBPD-1, sh-CEBPD-2, and scrambled non-targeting shRNA (sh-control) vectors were produced by incorporating sh-CEBPD-1, sh-CEBPD-2, and scrambled DNAs into the AgeI and EcoRI sites of the pLKO.1-puro vector. To produce lentivirus particles, HEK293T cells were co-transfected with 10 µg of sh-CEBPD-1 and sh-CEBPD-2 DNAs, 5 µg of psPAX2, and 10 µg of pMD2.G packaging plasmids using Lipofectamine 2000. Two days after transfection, the supernatants were collected and used to transduce 12Z cells, followed by selection of positive cells. The sh-CEBPD-1 sequence was CCGACCUCCUCAACAGCAAUCACAA, while the sh-CEBPD-2 sequence was GCTGTCGGCTGAGAACGAGAA.
RNA was isolated from tissue samples using an RNA Simple Total RNA kit (DP419, TIANGEN, Beijing, China), per the manufacturer’s instructions. Subsequently, RNA was reverse-transcribed into cDNA using a FastKing RT kit with gDNase (KR116, TIANGEN, Beijing, China). Then, the cDNA was subjected to a quantitative polymerase chain reaction (qPCR) using Talent qPCR PreMix (FP209, TIANGEN, Beijing, China) on a CFX96 Touch Real-Time PCR Detection System (BioRad, Herculaneum, CA, USA). The obtained Ct values were normalized to the GAPDH housekeeping gene. The forward and reverse primer sequences are listed in Supplementary Table 1.
Briefly, 1
Western blot analysis was performed according to standard procedures to evaluate
the expression of CEBPD, DNA damage-inducible transcript 4 (DDIT4), extracellular
signal-regulated kinase (ERK), phospho-ERK (p-ERK),
Tissues were fixed using 4% paraformaldehyde (P0099-3L, Beyotime Biotechnology, Nantong,
Jiangsu, China), embedded in paraffin, sectioned into 5 µm slices, and
stained with hematoxylin and eosin (H&E) according to standard protocols.
Immunohistochemical staining was performed on the tissue sections using
anti-human CEBPD (1:200, #ab245214, Abcam, Cambridge, MA, USA) and anti-human
DDIT4 (1:100, #10638-1-AP, Proteintech, Chicago, IL, USA). Stained slides were
observed by light microscopy, and the images were recorded. The immunoreactivity
scores for CEBPD and DDIT4 were determined by multiplying the score for the
percentage of positive cells (0:
Total protein was extracted from 12Z cells after harvesting. The levels of lipid peroxidation, malondialdehyde (MDA), and superoxide dismutase (SOD) activity were assessed using Mn-SOD assay kits (S0103, Beyotime Biotechnology, Nantong, Jiangsu, China) and lipid peroxidation MDA assay kits (S0131, Beyotime Biotechnology, Nantong, Jiangsu, China) according to the manufacturer’s instructions. An oxidative stress model was generated by treating 12Z cells with hydrogen peroxide (H2O2), and ROS levels were analyzed using flow cytometry.
A total of 5000 12Z cells were placed into 96-well plates and incubated for 24 h. Thereafter, 10 µL of Cell Counting kit-8 (CCK-8) solution (C0038, Beyotime Biotechnology, Nantong, Jiangsu, China) was added to each well and the plates incubated for the specified period. Cell viability was evaluated at specific time points, and the absorbance was measured at 450 nm using an enzyme immunoassay device.
Fresh fertilized eggs weighing approximately 50 to 60 grams were obtained for this study (n = 24). Chick embryos were randomly allocated into four groups: sh-control, sh-CEBPD, vector control, and OE-CEBPD (n = 6 in each group). Following disinfection and fenestration, the shell membrane was removed, and the eggs were positioned upright in an incubator. Subsequently, 2 million 12Z cells were suspended in 500 µL of serum-free medium and applied onto gelatin sponges, which were then transplanted into the avascular region of the chorioallantoic membrane of 7-day-old chick embryos. A control group was concurrently established to assess the effects of sh-CEBPD-12Z cells and OE-CEBPD-12Z cells on angiogenesis. After 72 h, the sealing tape was carefully removed, and the chick embryo was gently excised circularly to expose the chorioallantoic membrane fully. High-resolution images were subsequently captured using a Canon camera (EOS 5D Mark IV, Canon EF 100 mm f/2.8L Macro IS USM, Ohta-ku, Tokyo, Japan), and the area of angiogenesis in the chick embryo allantoic membrane was quantified using Image-Pro Plus Image analysis software (version 7.0, Media Cybernetics, Rockville, MD, USA).
An EdU kit (C0075S, Beyotime Biotechnology, Nantong, Jiangsu, China) was employed for EdU
cell proliferation staining. Different groups of cells were collected and
suspended, and the density was adjusted after counting. A total of 5
The colony formation assay involved inoculating 1000 cells into 6-well plates
and incubating at 37 °C in a 5% CO2 environment for two weeks.
After fixing using methanol for 30 minutes, the cells were stained with a 0.2%
crystal violet solution (C0121, Beyotime Biotechnology, Nantong, Jiangsu, China). A
Bio-Rad chemiluminescence imager (Bio-Rad ChemiDoc MP Imaging System, version
6.1, Hercules, CA, USA) was used to capture images, and colonies with
SPSS 22.0 (IBM, Armonk, NY, USA) and GraphPad Prism8 (GraphPad Software, San
Diego, CA, USA) software were employed for all statistical analyses and graphical
images, respectively. Data are presented as the mean
A total of 60 patients were enrolled in this study, comprising 30 in the NE and
30 in the EM groups. Table 1 presents a comparison of the baseline
characteristics between the two groups. No statistically significant differences
in age, body mass index (BMI), or sex hormone levels were noted between the two
groups. However, cancer antigen 125 (CA125) levels were significantly higher in
the EM group than in the NE group (p
| Characteristic | NE group (n = 30) | EM group (n = 30) | p-value |
| Age (years) | 31.87 |
33.57 |
0.125 |
| BMI (kg/m2) | 20.52 |
22.97 |
0.233 |
| FSH (mIU/mL) | 7.17 |
6.77 |
0.408 |
| LH (mIU/mL) | 5.37 |
4.81 |
0.321 |
| E2 (pmol/mL) | 165.99 |
131.98 |
0.740 |
| CA125 (IU/L) | 16.84 |
40.41 |
NE, normal endometrial; EM, endometriosis; BMI, body mass index; FSH, follicle-stimulating hormone; LH, luteinizing hormone; E2, serum estradiol; CA125, cancer antigen 125.
RNA-seq data were obtained from the NE, EU, and EC samples. Genes exhibiting significantly different mRNA expression levels between these tissues were identified by DESeq2 analysis and are represented by volcano plots in Fig. 1. Among the 3756 differentially expressed mRNA transcripts between NE and EC, 2111 were upregulated and 1645 were downregulated (Fig. 1A). In addition, 3334 mRNA transcripts were differentially expressed (1848 upregulated and 1486 downregulated) between EU and EC (Fig. 1B). However, only eight differentially expressed mRNA transcripts were found between NE and EU, of which six were upregulated, meaning two were downregulated (Fig. 1C).
Fig. 1.
CEBPD upregulation in human EM tissues. (A) Volcano plot of RNA
expression in NE vs. EC dataset (n = 6). (B) Volcano plot of RNA expression in EU
vs. EC dataset (n = 6). (C) Volcano plot of RNA expression in NE vs. EU dataset
(n = 6). (D) Venn diagram of the commonly expressed RNAs in NE vs. EC, EU vs. EC,
and NE vs. EU datasets. (E) Relative CEBPD, SLC5A1, and
RXFP1 expression levels in NE, EU, and EC tissues as detected by RT-qPCR and
normalized to GAPDH levels (Log2-transformed value = log2
(original value + 1); values shown for CEBPD are (M (P25, P75)) from the
Kruskal-Wallis test. For SLC5A1: NE vs. EU, p = 0.017; NE vs.
EC, p = 0.745. For RXFP1: NE vs. EU, p = 0.026; NE vs.
EC, p = 0.001. Values shown for RXFP1 and SLC5A1 are
(M (P25, P75)) from the Kruskal-Wallis test; n = 30). (F) CEBPD expression in NE,
EU, and EC tissues following Western blotting (NE vs. EU,
p = 0.02; NE vs. EC, p
Five genes were differentially expressed in all three group comparisons (NE vs.
EC; EU vs. EC; NE vs. EU): CEBPD, solute carrier family 5 member 1
(SLC5A1), relaxin family peptide receptor 1 (RXFP1), LINC03026,
and C2 calcium-dependent domain-containing 4B (C2CD4B) (Fig. 1D). An
intersection analysis of the above genes with the oxidative stress-related gene
sets (https://www.genecards.org) revealed that CEBPD, SLC5A1,
and RXFP1 were the only common genes. RT-qPCR results confirmed the
reliability of high-throughput RNA-seq findings by showing that CEBPD expression
was significantly elevated in EC tissue compared to NE (NE vs. EC, p
To gain more insight into the involvement of CEBPD in the onset and progression
of endometriotic lesions, we next evaluated the effects of CEBPD expression on
oxidative stress, proliferation and angiogenesis in the 12Z endometriosis cell
line (Fig. 2A). Compared with the sh-control group, the MDA levels were
significantly reduced in both the sh-CEBPD-1 group (2.43
Fig. 2.
CEBPD knockdown inhibits oxidative stress, proliferation, and
angiogenesis in 12Z cells. (A) Negative control or shRNA (sh-CEBPD #1, #2) was
transfected into 12Z cells (sh-control group vs. sh-CEBPD-1 group, p
We successfully constructed a CEBPD overexpression vector and transfected 12Z
cells (Fig. 3A). Compared with the vector group, MDA levels were significantly
increased in the OE-CEBPD group (2.70
Fig. 3.
CEBPD overexpression promotes oxidative stress, proliferation,
and angiogenesis in 12Z cells. (A) Western blot results confirmed successful
construction of the CEBPD overexpression vector (p
To further investigate the regulatory mechanism of CEBPD in oxidative stress,
proliferation, and angiogenesis related to EM, we employed shRNA technology to
knock down CEBPD expression in 12Z cells and subsequently conducted RNA-seq
analysis. Differentially expressed genes (DEGs) were analyzed to compare the
sh-control and sh-CEBPD-1 groups. This analysis revealed 78
DEGs (│log2FC│
Fig. 4.
CEBPD promotes DDIT4 expression in 12Z cells. (A) Differential
expression volcano map. Blue dots indicate significantly downregulated genes
following shRNA-mediated CEBPD knockdown, whereas red dots represent
significantly upregulated genes. X-axis: log2-fold change of gene expression;
Y-axis: statistical significance of the differential expression in log10. (B)
RT-qPCR analysis was performed to validate DDIT4 mRNA expression in NE,
EU, and EC (NE vs. EC, p
To further confirm the relationship between CEBPD and DDIT4 in EM, related vectors were constructed as shown in Fig. 5A. Inhibition of CEBPD expression was found to reduce the levels of ROS and MDA significantly, increase SOD activity (Fig. 5B–D), and decrease the proliferation of 12Z cells (Fig. 5E–G). These effects were reversed by DDIT4 supplementation, indicating that CEBPD promotes ectopic endometrial cell oxidative stress and proliferation in EM by activating DDIT4.
Fig. 5.
CEBPD promotes oxidative stress and
proliferation by targeting DDIT4 in 12Z cells. (A) The expression levels of
CEBPD and DDIT4 in different groups were analyzed by Western blot (the
p-values for CEBPD and DDIT4 in other groups: sh-control group vs.
sh-CEBPD group, p
In patients with non-alcoholic steatohepatitis (NASH), DDIT4 may facilitate the assembly of the p38-mitogen-activated protein kinase (MAPK) signaling complex in a S-nitrosylation-dependent manner, thereby enhancing ROS production [17]. We further explored the mechanism that underlies the promoting effect of CEBPD on ectopic endometrial cell proliferation and oxidative stress in EM. CEBPD was knocked down in 12Z cells using lentivirus shRNA, producing cell lines in which CEBPD and DDIT4 were significantly downregulated (Fig. 6A,B). Furthermore, the Western blot results indicated that the phospho-ERK (p-ERK) inhibition caused by sh-CEBPD was partially alleviated in the presence of DDIT4 overexpression (Fig. 6C). These results suggest that CEBPD may promote ectopic endometrial cell proliferation and oxidative stress by activating p-ERK activity through DDIT4.
Fig. 6.
CEBPD activates the ERK pathway in 12Z cells through DDIT4. (A)
The expression of CEBPD in different groups was analyzed by
RT-qPCR (sh-control group vs. sh-CEBPD group, p
This study aimed to investigate potential signaling pathways that regulate EM, focusing on oxidative stress pathways. RNA-seq technology was used to analyze normal endometrium from the NE group and eutopic endometrium and ectopic endometrium tissues from patients with EM. This analysis revealed that DEGs were primarily associated with oxidative stress. In combination with an analysis of an online database, CEPBD was found to be highly expressed in eutopic and ectopic tissues, and to promote the generation of ROS in ectopic endometrial cells (12Z cells). The study has reported that the occurrence and progression of EM are closely associated with oxidative stress [18]. Patients suffering severe EM exhibited significantly decreased SOD and glutathione peroxidase activities in both the blood and peritoneal fluid, with the lowest levels found in the peritoneal fluid. Moreover, the MDA level was highest in patients with severe EM [19]. In the present study, CEBPD overexpression in 12Z cells was found to increase the MDA and ROS levels significantly, and to reduce the activity of SOD. Comparatively, knockdown of CEBPD expression had the opposite effect. We searched for evidence that CEBPD was involved in regulating oxidative stress and explored the pathophysiological mechanisms of CEBPD in the development of EM. Our findings indicate that CEBPD promotes the progression of EM by regulating oxidative stress. Few studies have examined the regulation of oxidative stress by CEBPD in endometriosis. In a previous study of EM associated with hypoxia [20], the authors reported increased CEBPD expression in EM tissues compared to normal endometrium, which aligns with the results of the current study. Earlier research found that CEBPD was expressed at high levels in astrocytes, interacts directly with the promoters of NADPH oxidase subunits p47phox and p67phox, controls the transcriptional activity of NADPH oxidase, and enhances ROS production [21]. These result in a high level of oxidative stress within the cells, which is believed to be linked to the progression of Alzheimer’s disease.
Oxidative stress can lead to pathological changes such as inflammation, angiogenesis, invasive adhesion, cell proliferation, and injury [22]. The present study found that CEBPD overexpression promoted 12Z cell proliferation, alongside oxidative stress and angiogenesis. Furthermore, the loss of CEBPD expression suppressed these observed effects. CEBPD expression is typically reduced in adult tissues, and its abnormal expression has been linked to various cancer types [23]. Initially, CEBPD was observed to inhibit the proliferation of tumor cells, thereby suggesting a role in tumor suppression [24]. However, CEBPD has also been found to mediate cell proliferation in clinical models and cancer patients, and to play a role in tumorigenesis [25]. Thus, it is generally acknowledged that CEBPD fosters an inflammatory environment that encourages tumor development and the recruitment of blood vessels [26]. However, the relationship between CEBPD and EM remains unclear.
RNA-seq analysis revealed that CEBPD might promote endometriotic cell proliferation and oxidative stress by targeting DDIT4. Moreover, ChIP assay results confirmed that CEBPD combined with the DDIT4 promoter regulates DDIT4 expression. Thus, DDIT4 was predicted to be a target for CEBPD. Notably, DDIT4 overexpression significantly rescued the impact of sh-CEBPD on oxidative stress, proliferation, and angiogenesis in endometrial cells. Additionally, Western blot analysis indicated that DDIT4 may promote oxidative stress, proliferation, and angiogenesis of endometrial cells via MAPK signaling. A previous study noted that DDIT4 is a DNA repair factor that supports the rapid proliferation of cells by restoring their ability to repair DNA damage [27]. However, to our knowledge, no relevant studies have yet been conducted on DDIT4 in EM. Most studies on DDIT4 have been conducted in oncology, and numerous authors have shown that DDIT4 may predict disease development and prognosis in various tumor types [28, 29, 30]. Moreover, CEBPD has been shown to mediate the development of oxidative stress and inflammation in hypertension [31]. DDIT4 is expressed under stress conditions and regulates cancer cell growth by inhibiting mTORC1, an essential protein complex activated by nutrients and hormones [32]. Accordingly, DDIT4 regulates metabolism, oxidative stress, hypoxic survival, and apoptosis [33]. Another recent study found that DDIT4 activated the ROS–TXNIP–NLRP3 axis during oxidative stress-induced pyroptosis in rat nucleus pulposus in vitro [34]. Mitochondria are damaged during oxidative stress, and DDIT4 contributes to mitochondrial damage and ROS production. Meanwhile, TXNIP, a well-established key regulator in the cellular stress response [35], has been demonstrated to interact with DDIT4 in modulating oxidative stress pathways. This regulatory mechanism may contribute to the pathogenesis of oxidative stress in EM. However, no direct experimental evidence or clinical studies have been reported to substantiate this hypothesis in the context of EM.
Although this study provides novel insights into the potential mechanism for oxidative stress-induced EM, several limitations should be acknowledged. First, this in vitro study cannot fully simulate the in vivo biological complexity of EM; hence, studies using animal models may be more representative. In addition, the existing commercial endometriosis cell line, 12Z cells, may not fully represent EM tissues.
The results of this study suggest that CEBPD promotes oxidative stress, cell proliferation, and angiogenesis of endometriotic cells by activating the MAPK signaling pathway.
The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.
JS: Writing-original draft, Methodology, Formal analysis, Data curation. PT: Validation, Software, Formal analysis, Data curation. JZ: Validation, Software, Methodology. RZ: Formal analysis, Data curation. HX: Supervision, Investigation, Conceptualization. HZ: Research design, Methodology, Data analysis, Manuscript revision. All authors contributed to manuscript writing, critical revision, and approved the final version. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.
This study was approved by the Ethics Committee of the Huai’an Maternity and Child Health Care Hospital Affiliated to Yangzhou University (License Number: YXYLL-2023-021). The study was conducted in accordance with the Declaration of Helsinki, and all patients or their families/legal guardians were informed of the study and signed an informed consent form. According to the relevant regulations of the “Regulations on the Administration of Laboratory Animals” (revised in 2017) and the “Guidelines for Ethical Review of Animal Welfare” (GB/T 35892-2018) of China, the Chick Embryo Chorioallantoic Membrane Test does not require ethics review and approval.
We would like to express our sincere gratitude to all those who provided assistance during the research and writing of this manuscript. Special thanks go to the laboratory staff for their technical support and all the participants in our study. We are also grateful to all the peer reviewers for their valuable opinions and suggestions, which have significantly improved the quality of this manuscript.
This study was supported by Huai’an City Key Laboratory of Female Fertility Preservation (grant number: HAP202305) and Huai’an Natural Science Foundation (grant number: HAB2024041).
The authors declare no conflict of interest.
Supplementary material associated with this article can be found, in the online version, at https://doi.org/10.31083/FBL33488.
References
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.






