Fibroblast cells were cultivated from human skin following a 4-mm punch biopsy, using a procedure similar to that developed by Vangipuram et al. in 2013 [13]. A 6-well plate was coated with gelatin (0.1%, G1393, Sigma-Aldrich, Saint Louis, MO, USA) at room temperature (RT) for 60 minutes. After this time, the gelatine solution was removed and replaced with 800 µL of Dulbecco’s Modified Eagle Medium (DMEM), which contained high glucose, stable glutamine, and sodium pyruvate (Biowest, Nuaille, France), supplemented with 20% foetal bovine serum (Sigma-Aldrich, Saint Louis, MO, USA) and 100 IU/mL of streptomycin/penicillin (A5955, Sigma-Aldrich, Saint Louis, MO, USA).

The skin biopsy was then dissected into evenly sized small pieces using a scalpel. Three to five pieces of skin biopsy were placed in each well and incubated at 37 °C in a 5% CO₂ atmosphere. Daily monitoring of media evaporation was conducted, and 200 µL of DMEM was added every two days to compensate for evaporation during the first week. After one week, the volume of DMEM was increased to 2 mL. The medium was changed every 2–3 days until the fibroblasts reached confluence.

Once confluent, the plate was trypsinised, and the cells were transferred to two T75 flasks (passage 1). When the fibroblast cells became confluent in the T75 flasks, they were further transferred to three additional T75 flasks (passage 2). Finally, a 10% DMSO stock was prepared for the fibroblast cells at a concentration of 1 $\times$ 10⁶ cells/mL per vial and stored at –80 °C. The cells were characterized by morphological features such as elongated, spindle-like cell bodies, round to oval cell nuclei. Additionally, we have also characterized the fibroblast cell lines by using anti-vimentin antibodies, a marker for fibroblast cell [14]. Additionally, we have also used antibiotic and antimycotic in the media to avoid the contamination, and cell lines were tested time to time for mycoplasma contamination. The data are available in Supplementary materials.

RNA was isolated from fibroblast cells utilising RNeasy Micro Kits (Qiagen, Hilden, Germany), following the manufacturer’s instructions. To eliminate any contaminating DNA, 1 unit of DNAse per microgram of total RNA (Invitrogen, Carlsbad, CA, USA) was incorporated into the procedure. The isolated RNA was reverse-transcribed using Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) for 50 minutes at 42 °C. Two micrograms of total RNA were utilised to synthesise single-stranded cDNA. The qPCR analysis was conducted as previously outlined [15].

The primers were specifically designed to amplify target sequences corresponding to the following nucleotides: vimentin (forward: AAGACACTATTGGCCGCCTG (1507–1526), reverse: ATTCACGAAGGTGACGAGCC (1559–1578)), NPBWR1 (forward: TGACCTCGAGCCTTCTTGGA (3674–3693), reverse: CGTATGAAGGGCAACGACCT (3860–3879)), and NPBWR2 (forward: GCCAACGTCTCTCAGGACAA (360–379), reverse: TCACCGTCTTCATCTTGGGC (512–531)).

The qPCR was performed on an iCycler (Bio-Rad, Prague, Czech Republic). The final volume of each assay was 15 µL. Each reaction contained 3.5 µL of diluted cDNA, 7.5 µL of iQ SYBR Green Supermix (Bio-Rad, Prague, Czech Republic), 0.15 µL of each primer (at a concentration of 20 nmol/L), and 3.7 µL of ultrapure water. All qPCR analyses were executed in duplicate following a strict protocol: an initial denaturation step at 95 °C for 10 minutes, succeeded by 45 cycles of amplification (95 °C for 20 seconds, 60 °C for 20 seconds, and 72 °C for 20 seconds). A melting curve was subsequently generated by heating the samples from 65 °C to 95 °C, during which fluorescence was continuously monitored to confirm the specificity of each amplicon. Each pair of primers yielded a single peak in the melting curve and exhibited a single band of the expected size upon agarose gel electrophoresis.

Data quantification was performed using Optical System Software (Bio-Rad, Prague, Czech Republic), and normalisation of NPBWR1 and NPBWR2 was achieved using vimentin.

Fibroblast cells were cultured in a T75 flask until they reached confluence. Upon achieving confluence, the cells were treated with trypsin, and the resulting suspension was centrifuged to separate the pellet. The pellet was then washed twice with phosphate-buffered saline (PBS) and solubilised in lysis buffer prior to homogenisation. The lysate was centrifuged at 10,000 $\times$g for 10 minutes at 4 °C to eliminate debris and the supernatant was collected. The total protein concentration was determined using Bradford dye (Bio-Rad, Hercules, CA, USA).

A total of 25 µg of protein was loaded onto a 10% SDS-PAGE gel under reducing conditions (2% v/v $\beta$-mercaptoethanol). The gel was transferred to a nitrocellulose membrane (0.2 µm; Bio-Rad, Hercules, CA, USA) at a constant current of 220 mA at RT for 2 hours. To prevent non-specific binding, the membrane was blocked with a 5% milk powder solution in PBS-Tween (PBS pH 7.4 with 0.1% TWEEN 20) for 1 hour.

After blocking, the membrane was incubated overnight at 4 °C with either anti-NPBWR1 (1:500; bs-8618R, Bioss Antibodies Inc, Woburn, MA, USA) or anti-NPBWR2 (1:100; BP2-86659, Novus Biologicals, Centennial, CO, USA). Alternatively, it was incubated with anti-$\beta$-actin (1:250; bs0061R, Bioss Antibodies Inc, Woburn, MA, USA) for 1 hour at RT.

The membrane underwent three washes (10 minutes each) with PBS-Tween (0.1%). The blot was treated with horseradish peroxidase (HRP)-conjugated anti-IgGs (1:4000, A16116, Thermo Fisher Scientific, Frederick, MD, USA) for 45 minutes at RT. The membrane was washed three additional times with PBS-Tween (0.1%). The resulting blots were developed using the Clarity™ Western ECL kit (Bio-Rad, Hercules, CA, USA). Imaging was conducted using the ChemiDoc MP system (Bio-Rad, Hercules, CA, USA), and the data were analysed with Image Lab software (Bio-Rad, Hercules, CA, USA).

A glass slide was placed inside a sterile petri dish and 50 µL of a 1 $\times$ 10⁶ cells/mL dilution was added to the glass slide. The slide was incubated overnight at 37 °C with 5% CO₂. After incubation, the cells adhered to the glass slide. The cells were then washed with PBS at RT and fixed with ice-cold acetone for 10 minutes at RT.

For permeabilisation, the cells were treated with 0.3% Triton X-100 in PBS for 5 minutes at RT. The cells were washed three times with PBS and blocked with 5% normal goat serum in PBS at RT for 1 hour. The cells were then incubated overnight at 4 °C with anti-NPBWR1 (1:200; bs-8618R, Bioss Antibodies Inc., Woburn, MA, USA), anti-NPBWR2 (1:150; BP2-86659, Novus Biologicals, Centennial, CO, USA), or anti-vimentin (1:100; Cell Signaling Technology, Danvers, MA, USA).

Afterwards, the samples were washed three times with PBS and incubated for 1 hour at RT with FITC-conjugated anti-rabbit IgGs (1:300; F9887, Sigma, St. Louis, MO, USA). Finally, the cells were submerged in DAPI mounting medium (Sigma, St. Louis, MO, USA). Images were captured at 10$\times$ magnification using a fluorescence microscope (Olympus IX83) and analysed using ImageJ 1.53a, (Wayne Rasband, NIH, Bethesda, MD, USA).

All Fmoc-protected amino acids, Fmoc-Wang resins, N,N^′-Diisopropylcarbodiimide (DIC), Ethyl (hydroxyimino)cyanoacetate (Oxyma), and 2-(1H-Benzotriazole-1-yl)-1,1,3,3-tetramethylaminium tetrafluoroborate (TBTU) were purchased from Iris Biotech GmbH (Marktredwitz, Germany). Peptide-grade DMF was obtained from Biosolve (Dieuze, France). Triisopropylsilane (TIS), DIPEA, and diethyl ether (Et2O) were purchased from Sigma Aldrich (Milan, Italy).

Peptides hNPB (25–53) and hNPW (33–62) were synthesised in solid-phase using a microwave-assisted protocol (MW-SPPS) on a Liberty Blue™ automated peptide synthesiser (CEM Corporation, Matthews, NC, USA), following the Fmoc/tBu strategy. The syntheses were performed on preloaded Wang TG resins: Fmoc-Ala-WANG TG and Fmoc-Trp(Boc)-WANG TG (0.25 mmol/g).

Fmoc-deprotections were conducted using a solution of 20% (v/v) piperidine in DMF. Peptide assembly was carried out by repeating the standard MW-SPPS coupling cycle for each amino acid, utilising Fmoc-protected amino acids (5 equivalents, 0.2 M in DMF), OxymaPure® (5 equivalents, 1 M in DMF), and DIC (5 equivalents, 0.5 M in DMF).

Cleavage from the resin and side-chain deprotection was achieved by treatment with a TFA/TIS/water solution (95: 2.5: 2.5 v/v/v, 1 mL/100 mg of resin-bound peptide). The cleavage was carried out for approximately four hours with vigorous shaking at RT. Each resin was filtered off, and the solution was concentrated by flushing with N2. Each peptide was precipitated from cold Et2O, centrifuged, and lyophilized.

Lyophilized crude peptides were purified by a semi-preparative Waters reverse-phase high-performance liquid chromatography (RP-HPLC) (Waters Corporation, Milford, MA, USA) on a Phenomenex Jupiter C18 (10 µm, 250 mm $\times$ 10 mm) column (Phenomenex, Castel Maggiore, Italy) at 4 mL/min. The solvent systems used were 0.1% TFA in H₂O (A) and 0.1% TFA in CH3CN (B) (as shown in Table 1). All peptides obtained exhibited a purity greater than 95%.

Characterisation of the peptides was performed using analytical reverse-phase ultra-performance liquid chromatography coupled with electrospray ionisation mass spectrometry (RP-UPLC ESI-MS). The measurement was performed using a Waters Acquity UPLC connected to a Waters 3100 ESI-SQD mass spectrometer, utilising a Luna Omega PS C18 column (1.6 µm, 2.1 $\times$ 50 mm) maintained at 35 °C and operated at a flow rate of 0.5 mL/min. The solvent systems used were Solvent System A (0.1% TFA in H₂O) and Solvent System B (0.1% TFA in CH3CN). Data acquisition and processing were conducted using MassLynx software from Waters (Milford, MA, USA).

50 µL of 1 $\times$ 10⁵ cells were seeded per well onto a flat-bottom 96-well cell culture plate. Following this, 25 µL of peptide solution was added to each well. The peptide concentrations used were 0.004 µmol/L, 0.04 µmol/L, 0.4 µmol/L, and 4 µmol/L, prepared in DMEM media containing 10% FBS and 0.1% streptomycin/penicillin. An additional 25 µL of DMEM media with 10% FBS and 0.1% streptomycin/penicillin was added to each well.

This resulted in a total volume of 100 µL per well, corresponding to final peptide concentrations of 0.001 µmol/L, 0.01 µmol/L, 0.1 µmol/L, and 1 µmol/L, respectively. The cells were then incubated at 37 °C with 5% CO₂ for 48 hours.

After 48 hours, 10 µL of the cell proliferation reagent WST-1 (Roche Diagnostics GmbH, Germany) was added to each well, and the plate was incubated again at 37 °C with 5% CO₂ for four hours. The absorbance was measured at a wavelength of 450 nm using a microplate reader (Synergy H1, Agilent BioTek, Santa Clara, CA, USA).

A 12-well or 9-well plate was utilised for this experiment. 500 µL of a solution containing 1 $\times$ 10⁶ cells/mL was added to each well. The cells were initially suspended in glutamine-free DMEM media supplemented with 10% FBS and 0.1% streptomycin/penicillin. They were then incubated overnight at 37 °C in an environment with 5% CO₂.

Following incubation, the media were removed, and the cells were washed with Ca²⁺-free Tyrode solution. After washing, the cells were treated with 5 µmol/L Fura-2-AM for 30 minutes at 37 °C. The Fura-2-AM solution (F1221, Thermo Fisher Scientific Life Technology, Eugene, OR, USA) was then removed, and the cells were washed with 1 mL of Tyrode solution for 10 minutes at 37 °C. After the final wash, the cells were exposed to 1 mL of 0.1 µmol/L hNPW (33–62) or 0.1 µmol/L hNPB (25–53) in Ca²⁺-free Tyrode solution.

The intracellular calcium levels in the cells were measured using the IonOptix HyperSwitch Myocyte Calcium and Contractility System (IonOptix LLC, Westwood, CA, USA). The Tyrode solution had the following composition (in mmol/L): NaCl 137, KCl 4.5, MgCl₂ 1, CaCl₂ 2, Glucose 10, HEPES 5, with the pH adjusted to 7.4 using NaOH. All chemicals were obtained from Sigma-Aldrich (St. Louis, MO, USA). Offline analysis was conducted using IonWizard 6.5 software (IonOptix LLC, Westwood, CA, USA).

Data were presented using a box and whisker plot. Moreover, univariate analysis was done by the non-parametric Mann–Whitney U- test for 2 groups by Kruskal-Wallis test for more groups, while mutivariate analysis was done using three way ANOVA models where also an experiment number effect nested in cell line effect was included. Dunnett’s adjustment for a multiple comparison with one control group was used in the ANOVA models. Statistical analyses were conducted with GraphPad Prism 7.02 (GraphPad Software, Boston, MA, USA) or SAS 9.4M8 (TS1M8) (producer SAS Institute Inc., Cary, NC, USA) Statistical significance was set as p 0.05.

Skin fibroblasts were successfully developed from dissected human skin biopsies. We observed that keratinocytes migrated out of the biopsy tissue within the first week. The outgrowth of keratinocytes was followed by the growth of fibroblast cells within 7 to 10 days. DMEM high-glucose media supplemented with 20% FBS promoted the growth of fibroblasts over keratinocytes. Consequently, the keratinocytes were depleted after two passages. Finally, the fibroblast cells were fully developed in 30 to 40 days, as confirmed by their morphology (shown in Fig. 1). A 10% DMSO stock was prepared, and we designated these stocks as PASSAGE-0 for use in our experiments. All experiments were conducted with cell lines that had not been passaged more than four times after PASSAGE-0 to avoid any mutations [16]. Similar cell lines were also used to prepare hiPSC and astrocytes [17].

Fig. 1.

Dermal fibroblasts from human skin. Cultivation of dermal fibroblasts was done from skin biopsies. The growth of keratinocytes was observed within 3 days and full confluency of fibroblast was achieved in 33 days (scale bar 50 µm).

10% DMSO stock were prepared. We considered these stocks as PASSAGE-0 and used them for our experiments. All the experiments were done with the cell lines which were not passaged more than 4 times after PASSAGE-0 to avoid any mutations.

RT-qPCR analysis was conducted across nine different cell lines. The presence of mRNA for vimentin was confirmed in all samples, validating the accuracy of all preceding steps. The Cq value of vimentin was used to compare the expression levels of NPBWR1 and NPBWR2 in each sample. mRNA for NPBWR2 was detected in all samples, whereas mRNA for NPBWR1 was present in only 6 out of the 9 samples. Notably, the relative expression of mRNA for NPBWR2 was approximately 32 times higher than that of mRNA for NPBWR1 (as shown in Fig. 2).

Fig. 2.

Detection of mRNAs of neuropeptides B/W receptor (NPBWR1/NPBWR2) by RT-qPCR analysis. Different fibroblast cell lines were used for detection of mRNAs. We have observed the presence of NPBWR1 in 6 out of 9 samples and NPBWR2 in all the samples. (a) Data are presented as $\mathrm{\Delta }$Cq values (compared to vimentin) to indicate differences in expression between NPBWR1 and NPBWR2, represented by “*”. Relative expression of mRNA for NPBWR2 was about 32 times higher than expression of mRNA for NPBWR1. (b) Agarose gel electrophoresis of qPCR products of NPBWR1 and NPBWR2 amplified. Samp, sample; Vim, vimentin; Neg, water (negative control); M, marker.

These findings were further confirmed using proteomic approaches, including Western blotting (WB) and immunofluorescence analysis. Commercially available antibodies against vimentin, NPBWR1, and NPBWR2 were employed to detect both receptors in fibroblast cells. Our results indicated that all anti-vimentin-positive cells were also immunoreactive for both anti-NPBWR1 and anti-NPBWR2 antibodies, suggesting the presence of these receptors on the surface of all fibroblasts of mesenchymal origin.

Western blot analysis was performed on ten different cell lines. We observed a single immunogenic band for NPBWR1 at approximately 50 kDa in all ten samples (as shown in Fig. 3a). The expression level of NPBWR1 was about 0.3 times lower compared to $\beta$-actin (as shown in Fig. 3c). However, we did not detect any band corresponding to the NPBWR2 receptor at 50 kDa. This may be due to the antibodies being unable to recognise the denatured form of NPBWR2 or because the concentration of NPBWR2 in fibroblast cells was too low for detection via WB analysis (as shown in Fig. 3b). Interestingly, immunofluorescence analysis successfully detected NPBWR2 in 5 out of 5 samples, indicating that the anti-NPBWR2 antibody was able to recognise only the conformational form of NPBWR2 (as shown in Fig. 4).

Fig. 3.

Identification of NPBWR1/NPBWR2 by western blotting (WB) analysis. Different fibroblast cell lines were used to identify NPBWR1/NPBWR2. (a,c) We have observed the immunogenic band of NPBWR1 in 10 out of 10 samples (lane 1 to 10) at 50 kDa, but the expression of NPBWR1 was ~0.3 times lower than $\beta$-actin. Rat heart lysate was used as a positive control. (b) We didn’t observe any band of NPBWR2 receptor at 50 kDa, the data of five cell lines were shown. Uncropped pictures were attached to Supplementary materials.

Fig. 4.

Identification of NPBWR1/NPBWR2 by immunofluorescence analysis. Different fibroblast cell lines were used for identification of NPBWR1 (n = 6) and NPBWR2 (n = 5). The cells were incubated with anti-NPBWR1, anti-NPBWR2, vimentin (positive control), and without primary antibodies (negative control). Fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgGs (green channel) were used to detect the primary antibodies along with 4’,6-diamidino-2-phenylindole (DAPI) (blue channel) for nuclear staining (scale bar 50 µm). Images were taken using fluorescence microscope.

These results were further validated by proteomic approach through WB and immunofluorescence analysis.

We have synthesised the ligands of NPBWR1/NPBWR2, specifically hNPB (25–53) and hNPW (33–62), as detailed in Table 1. These synthetic peptides were utilised to investigate the influence of NPBWR1/2 signalling on cell proliferation and intracellular calcium levels. The viability of the treated cells was assessed using the WST-1 assay, and all experiments were conducted across 11 different experiments with 5 cell lines for NPB and 17 different experiments with 11 cell lines for NPW.

Cells were treated with four distinct concentrations of hNPB (25–53) and hNPW (33–62): 0.001 mol/L, 0.01 mol/L, 0.1 mol/L, and 1 mol/L. Overall, as illustrated in Fig. 5, we did not observe any statistically significant effects of hNPB (25–53) (p = 0.7338 Kruskal-Wallis test, p = 0.4180 ANOVA), while hNPW (33–62) shows a negative proliferative effect (p = 0.0464 Kruskal-Wallis test, p = 0.0248 ANOVA) on cell viability as analyzed by multivariate in three-way ANOVA analysis (Fig. 5) and also by univariate Kruskal-Wallis test. Post hoc power analysis of hNPW (33–62) shows the power of testing as 50.8% with used sample size per groups (n = 17) to detect observed difference of 3.5 as statistically significant.

Fig. 5.

Impact of hNPB (25–53) and hNPW (33–62) on cell proliferation. The cells were treated with different concentrations of peptide solution 0.001-µmol/L, 0.01-µmol/L, 0.1-µmol/L, 1-µmol/L in DMEM media with 10% FBS and 0.1% streptomycin/penicillin. (a,c) For NPB and NPW respectively. Distribution of % inhibition was analyzed. (b,d) NPB and NPW respectively. We did not observe any statistically significant impact of hNPB (25–53), while hNPW (33–62) shows a negative proliferative effect on human dermal fibroblast (p = 0.0464 Kruskal-Wallis test, p = 0.0248 ANOVA). The data was analyzed by multivariate three-way ANOVA analysis and univariate Kruskal-Wallis test.

Additionally, we conducted an experiment to estimate the intracellular concentration of Ca²⁺ in fibroblasts after treating the cells with 0.1 µmol/L of either hNPB (25–53) or hNPW (33–62). This part of the study involved 7 different experiments with 5 different cell lines and we used a concentration of 0.1 µmol/L for the peptides. Our findings showed that hNPW (33–62) effectively interfered with intracellular calcium signalling, resulting in a decrease in the intracellular Ca²⁺ level in fibroblasts (p = 0.0248 Mann–Whitney U-test, p = 0.0109 ANOVA for hNPW (33–62) effect).

Conversely, we did not find any significant impact of hNPB (25–53) (p = 0.1517 Mann–Whitney U-test, p = 0.1618 ANOVA for hNPB (25–53) effect) on intracellular Ca²⁺ concentration, as depicted in Fig. 6. The results were analysed by measuring dual fluorescence intensity at excitation wave lengths of 340 nm and 380 nm.

Fig. 6.

Impact of hNPB (25–53) and hNPW (33–62) on intracellular Ca²⁺. The cells were treated with peptide solution consist of 0.1-µmol/L-hNPW (33–62) or 0.1-µmol/L-hNPB (25–53) in Ca²⁺ free Tyrode solution. We have observed that hNPW (33–62) was able to inhibit the intracellular Ca²⁺of the fibroblast. The difference was statistically significant (p = 0.0248 Mann–Whitney U-test, p = 0.0109 ANOVA for hNPW (33–62)) when compared to cells without peptide treatment. However, we did not observe any significant impact of hNPB (25–53) (p = 0.1517 Mann–Whitney U-test, p = 0.1618 ANOVA). (a) Distribution of F340/380 by experiment number. (b) NTy represents “Ca²⁺ free Tyrode solution without peptides”.

In this study, we were not able to detect NPBWR2 in human dermal fibroblast through western blot, while similar antibodies were able to detect NPBWR2 in immunofluorescence analysis. This may relate to antibody specificity or receptor denaturation during western blot. To overcome this problem, one can use different methodology such as complete gel blot or mass spectrometry analysis for further validation of the results.