All animal experiments were conducted in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals (NIH Publication No. 80-23; revised 1978). The protocol for all animal experiments was approved by the Animal Experimental Ethical Inspection Form at Guizhou Medical University (No. 12403436). Seven-week-old female C57BL/6 mice of were obtained from GemPharmatech Co., Ltd. (Nanjing, Jiangsu, China) and allowed to acclimate to the new environment for one week, with free access to standard chow and water throughout the acclimation period. Female mice were housed in a specific pathogen-free (SPF) facility, maintained under a 12-hour light/dark cycle, humidity 10–70%, temperature of 20–25 ℃, and free access to standard chow and water.

The animals were randomly divided into four groups (n = 10 per group): (1) Sham + Vehicle group, (2) Sham + Irisolidone group, (3) POI + Vehicle group, and (4) POI + Irisolidone group. Female mice in the POI group (Groups 3 and 4) received a single intraperitoneal injection of cyclophosphamide (CTX, 100 mg/kg, Selleck, Cat. NO. S1217, CAS No: 50-18-0) to induce a POI model. Female in the control group (Groups 1 and 2) received an equivalent volume of vehicle solution via intraperitoneal injection. Subsequently, female mice in the Irisolidone-treated groups (Groups 2 and 4) received daily intraperitoneal injections of Irisolidone (50 mg/kg, BioBioPha, BBP No: BBP06887, CAS No: 2345-17-7) for three consecutive weeks.

At the end of the treatment period, female mice were anesthetized with 3% pentobarbital sodium (60 mg/kg) via intraperitoneal injection, followed by cardiac blood collection. After transcardial perfusion with physiological saline, ovaries were harvested. Ovarian tissues and serum samples (separated from collected blood) were stored appropriately for subsequent experimental analyses.

The ovarian RNA sequencing data for the CTX-induced POI mouse model were obtained from the Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/gds/) database under accession number GSE128240 [16]. The inflammation-related gene datasets were retrieved from the “Inflammatory Response” pathway within the Gene Ontology (GO) database. To identify candidate genes, GO enrichment analysis was performed using Metascape (https://metascape.org/), a comprehensive tool for functional annotation and gene lists analysis. For pathway analysis, the Database for Annotation, Visualization, and Integrated Discovery (DAVID, https://davidbioinformatics.nih.gov/) is utilized to conduct Kyoto Encyclopedia of Genes and Genomes (KEGG, https://www.genome.jp/kegg/) functional enrichment analysis. The candidate genes were subjected to Protein-Protein Interaction (PPI) analysis using Cytoscape software (National Resource for Network Biology, San Diego, CA, USA) to identify core proteins. Additionally, the conservation of interleukin 1$\beta$ (IL1$\beta$) protein motif sites across species was performed to use Gene Set Enrichment Analysis (GSEA, https://www.gsea-msigdb.org/gsea/index.jsp).

Natural compounds with anti-inflammatory properties were initially screened using the Traditional Chinese Medicine Systems Pharmacology (TCMSP, https://www.tcmsp-e.com/load_intro.php?id=43) database [17, 18]. Subsequently, the compound library was further refined based on drug-like properties, including absorption, distribution, metabolism, and excretion (ADME), molecular weight, oral bioavailability, drug half-life, and other pharmacokinetic parameters. This refinement process identified potential drug candidates with favorable pharmaceutical properties. Finally, Molecular Operating Environment (MOE, Chemical Computing Group, Montreal, Canada) software was utilized to perform molecular docking simulations of these druggable compounds, aiming to evaluate their binding affinity to the target protein IL1$\beta$. This comprehensive screening strategy enabled the identification of promising natural compounds.

Following collecting, ovarian tissues were immediately fixed in 4% paraformaldehyde at room temperature overnight. The fixed tissues were then processed for paraffin embedding, followed by sectioning into 5 µm-thick slices. Hematoxylin and Eosin (H&E) staining was performed on these sections to assess histological structure. Subsequently, based on established ovarian cell classification criteria, follicles at different developmental stages-including primordial, primary, secondary, antral, and atretic follicles-were identified and quantified [19].

The Immunohistochemistry (IHC) staining procedure is as follows: Ovarian tissue sections were dewaxed and subjected to antigen retrieval. After cooling, the sections were incubated with 3% hydrogen peroxide for 10–15 minutes to block endogenous peroxidase activity, followed by blocking with 5% BSA for 30 minutes. phosphorylated nuclear factor kappa B (p-NF$\kappa$B; 1:200, Proteintech, Cat. No. 10745-1-AP, Wuhan, Hubei, China), NOD-like receptor pyrin domain-containing 3 (NLRP3; 1:200, ABclonal, Cat. No. A5652, Wuhan, Hubei, China), and Caspase1 (1:200, Proteintech, Cat No. 22915-1-AP, Wuhan, China) were added, and the sections were incubated overnight at 4 °C. Subsequent to this, the sections were incubated with the polymer HRP-goat anti-rabbit recombinant secondary antibody (H+L) (Cat: RGAR011, Proteintech, Wuhan, China) at room temperature for 60 minutes. 3,3^′-Diaminobenzidine tetrahydrochloride staining (DAB, Cat number G1212, Servicebio, Wuhan, Hubei, China) chromogenic solution was then added; once positive signals were observed under a microscope, the reaction was terminated with distilled water. The cell nuclei were counterstained with hematoxylin for 3–5 minutes. After mounting, images were captured under a microscope.

Blood was obtained from anesthetized mice, and the whole blood samples were centrifuged at 3000 rpm at 4 °C for 15 minutes to isolated serum. Serum samples were then used to determine the concentrations of anti-Müllerian hormone (AMH; JONLNBIO, Cat. No. JL16387, Shanghai, China), estradiol (E2; Solarbio Life Sciences, Cat. No. SEKM-0286, Beijing, China), and follicle-stimulating hormone (FSH; JONLNBIO, Cat. No. JL10239, Shanghai, China) using enzyme-linked immunosorbent assay (ELISA) kits, in strict accordance with the manufacturers’ instructions.

Total proteins were extracted from ovarian tissue samples using RIPA lysis buffer (Beyotime, Cat. No. P0013B, Shanghai, China), and protein concentrations were determined via a bicinchoninic acid (BCA) assay (Beyotime, Cat. No. P0009, Shanghai, China). Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% non-fat milk in Tris-buffered saline with Tween® 20 (TBST) for 2 hours at room temperature. This was followed by overnight incubation at 4 °C with primary antibodies against the following targets: glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:10,000, ABclonal, Cat. No. AC002, Wuhan, China), phosphorylated nuclear factor kappa B (p-NF$\kappa$B; 1:1000, Proteintech, Cat. No. 10745-1-AP, Wuhan, China), NOD-like receptor pyrin domain-containing 3 (NLRP3; 1:1000, ABclonal, Cat. No. A5652, Wuhan, China), interleukin-1$\beta$ (IL1$\beta$; 1:1000, ABclonal, Cat. No. A16288, Wuhan, China), and Caspase1 (1:1000, Proteintech, Cat No. 22915-1-AP, Wuhan, China). After three washing with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 2 hours at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system. Densitometric analysis was subsequently performed to quantify the relative expression levels of the target proteins.

Total RNA was extracted from ovarian tissue samples using TRIzol® reagent (Beyotime, Cat No. R0016), and RNA concentration and purity were evaluated using a NanoDrop™ spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Complementary DNA (cDNA) was synthesized from 1 µg of total RNA using a HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Cat No. R212-01, Nanjing, Jiangsu, China), in strict accordance with the manufacturer’s instructions. The relative mRNA expression levels of target genes were detected via quantitative reverse transcription-polymerase chain reaction (qRT-PCR) using SYBR® Green PCR Master Mix (Vazyme, Cat. No. Q511-02, Nanjing, Jiangsu, China).

The primer sequences are as following:

IL1$\beta$: Interleukin 1 beta (NM_008361.4)

Forward primer: TGCCACCTTTTGACAGTGATG

Reverse primer: AAGGTCCACGGGAAAGACAC

IL18: Interleukin 18 (NM_008360.2)

Forward primer: TACAAGCATCCAGGCACAGC

Reverse primer: CTGATGCTGGAGGTTGCAGA

NLRP3: NLR family, pyrin domain containing 3 (NM_145827.4)

Forward primer: GTCACCATGGGTTCTGGTCA

Reverse primer: GGGCTTAGGTCCACACAGAA

Caspase1: caspase 1 (NM_009807.2)

Forward primer: AACGCCATGGCTGACAAGA

Reverse primer: TGATCACATAGGTCCCGTGC

Actin: Actin beta (NM_007393.5)

Forward primer: TATAAAACCCGGCGGCGCA

Reverse primer: TCATCCATGGCGAACTGGTG

Data were analyzed using GraphPad Prism software (GraphPad Software Inc., San Diego, CA, USA) and presented as mean $\pm$ standard error of the mean (SEM). All data were subjected to two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test, with a p-value 0.05 considered statistically significant. All experiments were performed with at least four biological replicates to ensure the reproducibility of results.

To characterize changes in ovarian tissue gene expression following CTX treatment, the RNA sequencing dataset (GSE128240) from CTX-induced POI mouse models was analyzed. Differential gene expression analysis identified 1040 differentially expressed genes (DEGs) in CTX-induced POI, comprising 388 upregulated genes and 652 downregulated genes (Fig. 1A,B). CTX treatment disrupts the balance of ovarian inflammation, which contributes to the onset and progression of POI. To further identify aberrantly expressed inflammatory genes in ovarian tissue, inflammation-related genes were retrieved from the GO database. Subsequent intersection analysis between these inflammation response genes and the DEGs from GSE128240 yielded 25 key inflammatory genes (Fig. 1C). Of these 25 genes, 7 were upregulated and 18 were downregulated (Fig. 1D), and a heatmap was generated to visualize the expression profiles of these key DEGs (Fig. 1E). In conclusion, integrated analysis of GEO dataset (GSE128240) and GO-derived inflammatory genes enabled the identification of 25 inflammation-associated candidate genes in POI.

To elucidate the regulatory pathways associated with the 25 candidate genes, GO and KEGG enrichment analyses were performed (Fig. 2A,B). The results showed that these candidate genes are significantly enriched in inflammation-related biological processes and signaling pathways, including “Inflammatory Response”, “Neutrophil Chemotaxis”, “Cytokine Activity”, “Cytokine-Cytokine Receptor Interaction”, and the “IL-17 Signaling Pathway” (Fig. 2A,B). To further identify core inflammatory genes with this set, PPI network analysis was conducted for the 25 candidate genes using Cytoscape software (Fig. 2C). This analysis identified IL1$\beta$ as a hub protein, emphasizing its central role in mediating the inflammatory network (Fig. 2C). Furthermore, motif analysis of IL1$\beta$ revealed a high level of conservation across species, which underscores its evolutionary significance (Fig. 2D). In summary, through comprehensive functional enrichment and PPI network analyses, we identified IL1$\beta$ as a core inflammatory cytokine among the 25 candidate genes. These results reveal that IL1$\beta$ may play a critical role in CTX-induced ovarian inflammation and could be implicated in the pathogenesis of POI.

To identify natural compound inhibitors of IL1$\beta$, a comprehensive search was conducted in the Traditional Chinese Medicine Systems Pharmacology (TCMSP) database, yielding 23 candidate compounds (Fig. 3A). Subsequently, these 23 compounds underwent drug-likeness assessment, which included evaluation of parameters such as “Molecular Weight”, “Distribution Coefficient”, “ADME” (Absorption, Distribution, Metabolism, and Excretion), “Toxicity”, and molecular docking performance. This rigorous screening process ultimately identified Irisolidone as a promising IL1$\beta$ inhibitor (Fig. 3A). Two-dimensional (2D) molecular docking results revealed that Irisolidone forms hydrogen bonds with specific amino acid residues of IL1$\beta$. Specifically, nitrogen atoms at positions 9 and 11 of Irisolidone spontaneously interact with the Tyr24 residue of IL1$\beta$, with a binding energy of –3.3 kcal/mol (Fig. 3B). Additionally, oxygen atom at position 15 of Irisolidone interacts with the Glu25 and Leu26 residues of IL1$\beta$, with respective binding energies of –0.9 kcal/mol and –2.5 kcal/mol (Fig. 3B). Three-dimensional (3D) molecular docking further demonstrated that Irisolidone can penetrate deep into the IL1$\beta$ binding pocket, where it interacts effectively with key residues to inhibit IL1$\beta$ activity (Fig. 3C). In conclusion, systematic screening and molecular docking analyses identified Irisolidone as a natural IL1$\beta$ inhibitor. These findings reveal that Irisolidone may inhibit IL1$\beta$ through stable interactions with critical amino acid residues within its binding pocket. Further in vivo studies using mouse models are planned to explore the function of Irisolidone in inflammatory diseases.

To establish a POI model, 8-week-old female mice were intraperitoneally injected with CTX at 100 mg/kg (Fig. 4A). Mice in the treatment group obtained daily oral administration of Irisolidone (50 mg/kg) for three weeks, after which samples were collected for subsequent analyses (Fig. 4A). Control mice received vehicle treatment only (Fig. 4A). Compared to untreated controls, the control group receiving Irisolidone showed no significant changes in body weight or ovarian weight (Fig. 4B–D). In contrast, the POI group exhibited an obviously reduction in both body weight and ovarian weight relative to the group. However, Irisolidone treatment significantly improved these parameters, restoring body weight, ovarian weight, and the ovarian index (ratio of ovarian weight to body weight) to near-normal levels (Fig. 4B–D). H&E staining of ovarian tissues revealed abnormal morphology and a reduced number of healthy follicles in the CTX-induced group (Fig. 4E). Irisolidone treatment obviously ameliorated histological damage, preserving ovarian structure and function. We quantified follicles at different developmental stages: primordial, primary, secondary, antral, and atretic follicles. The POI group showed a marked reduction in primordial, primary, secondary, and antral follicles, accompanied by a significantly increased in atretic follicles (Fig. 4F–J). These findings indicate that CTX treatment severely impaired ovarian tissue, leading to abnormal folliculogenesis and reduced fertility. Notably, Irisolidone treatment rescued the number of developing follicles, promoting normal follicular development and reducing the number of atretic follicles (Fig. 4F–J). In summary, experiments in vivo demonstrate that Irisolidone treatment significantly mitigates CTX-induced POI-related damage. Irisolidone improves body weight and ovarian weight, and restores ovarian function by promoting normal follicular development and reducing follicular atresia.

Structural abnormalities in ovarian tissue can exert a significantly impact ovarian function and fertility. Follicle-stimulating hormone (FSH), anti-mullerian hormone (AMH), and estradiol (E2) are critical biomarkers for assessing ovarian function, reflecting ovarian reserve, follicular development, and ovulation, respectively. The combination of these three markers enables a comprehensive evaluation of ovarian health. For the purpose of assessing how CTX-induced POI affects ovarian function, we determined the serum levels of FSH, AMH, and E2 in mice through the application of ELISA. Additionally, we evaluated the pregnancy and fertility rates of female mice post-POI induction. In comparison with the control group, administration of CTX led to a significant reduction in serum AMH and E2 levels, whereas serum FSH levels were markedly elevated—findings that are indicative of a substantial decline in ovarian function (Fig. 5A–C). However, Irisolidone treatment significantly reversed these hormonal changes, restoring AMH, E2, and FSH levels to near-normal ranges, thereby improving ovarian function (Fig. 5A–C). To further characterize the effects of POI on reproductive, we assessed pregnancy and fertility in female mice after induction. Relative to controls, CTX treatment resulted in an obvious fall in pregnancy mice, with the count of pups born per pregnant mouse also being markedly decreased (Fig. 5D–F). In contrast, Irisolidone treatment significantly enhanced pregnancy incidence among female mice and elevated the count of pups born per litter (Fig. 5D–F). In summary, our findings demonstrate that Irisolidone possessed therapeutic potential for treating POI, and could provide a promising approach to reinstate ovarian physiological function and improve reproductive capacity in affected individuals.

Previous pharmacological analysis identified IL1$\beta$ as a core inflammatory cytokine induced by CTX (Fig. 2C), and Irisolidone was selected as a natural inhibitor of IL1$\beta$ (Fig. 3). For the purpose of further investigating how Irisolidone exerts its inhibitory effect on IL1$\beta$, we assessed the expression levels of two key inflammatory cytokines IL1$\beta$ and IL18 in ovarian tissues and serum. The results showed that CTX significantly increased the expression of IL1$\beta$ and IL18 in both ovarian tissues and circulation in the POI group, and Irisolidone treatment markedly reversed this upregulation (Fig. 6A–D). In addition, we conducted a further examination of IL1$\beta$ expression at the protein level. Our findings revealed a marked upregulation of IL1$\beta$ in ovarian tissues of CTX-induced POI, which serves to validate the reliability of the GSE128240 dataset (Fig. 6E,F). IL1$\beta$ and IL18 are regulated by the inflammasome pathway, which involves NF$\kappa$B, NLRP3, and Caspase1. We first assessed the phosphorylation status of NF$\kappa$B, a key regulator of inflammation. The findings demonstrated that CTX significantly led to a notable elevation of p-NF$\kappa$B, while Irisolidone treatment effectively inhibited this increase (Fig. 6E,G). It is well established that p-NF$\kappa$B translocates into the nuclear compartment, and once localized there, it promotes the transcriptional activity of NLRP3, pro-IL1$\beta$, and pro-IL18 [20]. Increased NLRP3 expression facilitates the assembly of the NLRP3 inflammasome complex within cytoplasm, thereby triggering the conversion of pro-Caspase1 to its mature functional form [21]. This mature Caspase1 mediates the cleavage of pro-IL1$\beta$ and pro-IL18 into their biologically active isoforms, resulting in elevated levels of IL1$\beta$ and IL18 [22]. The data show that CTX induced an obviously upregulated NLRP3 and Caspase1 expression. In contrast, administration of Irisolidone exerted a notable inhibitory effect on the expression of these two proteins (NLRP3 and Caspase1), bringing their levels back to a state close to normal (Fig. 6E,H,I). In addition, it was found that Irisolide downregulated the mRNA expression of Nlrp3 and Caspase1, which reveals its inhibitory effect on inflammation (Fig. 6J,K). Additionally, IHC staining of p-NF$\kappa$B, NLRP3, and Caspase1 showed that the expression of the inflammatory pathway in the ovarian tissues of mice with POI was significantly increased compared with the control group, while treatment with Irisolidone significantly inhibited the activation of this inflammatory pathway (Fig. 6L). To summarize, the results illustrate that Irisolidone significantly inhibits aberrant regulation of p-NF$\kappa$B/NLRP3/Caspase1 pathway induced by CTX. By suppressing this pathway, Irisolidone reduces the expression of downstream inflammatory cytokines IL1$\beta$ and IL18, thereby restoring the inflammatory balance in ovarian tissue. This mechanistic insight highlights the therapeutic potential of Irisolidone in mitigating CTX-induced POI and preserving ovarian function.