Sigma-Aldrich (Shanghai, China) provided paraformaldehyde and puromycin, while Roche Pharmaceuticals Consulting (Shanghai, China) supplied TriPure isolation reagent. Sangon Biotech (Shanghai, China) provided reagents such as ethanol, chloroform, xylene, neutral resin, and isopropanol. Takara Biomedical Technology (Beijing, China) provided the PrimeScript™ PLUS RT-PCR Kit. Cell culturing medium was acquired from HyClone, Thermo Fisher Scientific (Shanghai, China). Penicillin-streptomycin and foetal bovine serum were purchased from Gibco, Thermo Fisher Scientific (Shanghai, China). Antibodies were purchased from Abcam (Shanghai, China), and Prof. Jinke Cheng generously provided the plasmids.

A chemiluminescence imaging analyzer (las-4000) from Fujifilm (Shanghai, China) was used. An inverted microscope and a paraffin sectioning machine were obtained from Leica (Beijing, China). Thermo Fisher Scientific (Shanghai, China) provided the NanoDrop 2000, CO₂ cell incubator and biosafety cabinet. Eppendorf (Oldenburg, Germany) supplied the conventional PCR instrument and a 4 °C high-speed freezing centrifuge. The electrophoresis apparatus was from Tianneng Technology (Shanghai, China), and the fluorescence quantitative PCR instrument (LC480) was from Roche.

Unrelated Chinese Han individuals were recruited for this study. ESCC patients who were diagnosed from January 2015 to January 2019 and underwent surgical resection at Zhongshan Hospital were included. Prior to surgery, each patient underwent a positron emission tomography-computed tomography (PET-CT) (uMI 780, United Imaging, Shanghai, China) scan. Tissue microarrays were generated from 200 ESCC samples, none of which were subjected to neoadjuvant treatment. The clinical profiles of these patients are provided in Table 1. This retrospective study was approved by the Ethics Committee of Zhongshan Hospital, Fudan University (B2022-271R), and patients or their families/legal guardians provided written informed consent. Additionally, we obtained the cancer genome atlas-esophageal carcinoma (TCGA-ESCA) data from the UCSC Xena platform (https://xenabrowser.net/) from 11 normal tissue samples and 94 ESCC samples.

C57BL/6 wild-type mice were purchased from SLAC Laboratory Animals (Shanghai, China). Senp5 flox/flox mice were genetically modified by BRL Medicine (Science&Technology Park, Shanghai, China), while ED-L2-Cre mice were created by GemPharmatech Co. (Shanghai, China), Ltd. By breeding Senp5 flox/flox mice with ED-L2-Cre mice, we produced knockout mice specifically targeting the oesophageal squamous epithelium. All the mice were kept under specific pathogen-free (SPF) conditions and provided with sterile water and food. The experimental protocols for the animals complied with the guidelines of the Shanghai Jiaotong University School of Medicine (approval number: A-2022-082). To establish an ESCC mouse model, 4-nitroquinoline N-oxide (catalogue no. N8141, Sigma-Aldrich, Shanghai, China) was added to the drinking water of six-week-old male mice for 16 weeks at a concentration of 100 µg/mL. After receiving normal water for an additional 8 weeks, the oesophageal tissues of the mice were harvested for analysis. The mice were anaesthetized via 3% isoflurane inhalation as needed and euthanized via cervical dislocation after the experiments.

Bulk RNA sequencing was conducted by Sangon Biotech (Shanghai, China). Briefly, oesophageal tissues were collected from the mice, the squamous epithelium was isolated, and the samples were quickly frozen in liquid nitrogen. A Geo-seq protocol was used to extract RNA and prepare cDNA for sequencing. The sequencing libraries were subsequently established and evaluated with an mRNA Library Prep Kit (Sangon Biotech, Shanghai, China). Trim Galore version 0.4.4 (https://biodockerfiles.github.io/trim-galore-0-4-4/) was used to eliminate low-quality reads and adaptor sequences. Clean reads were aligned to the mm10 genome using Bowtie2 version 2.5.4 (https://bowtie-bio.sourceforge.net/bowtie2/index.shtml) with default settings (Langmead and Salzberg, 2012), and uniquely mapped reads were summarized with featureCounts from the Subread package. The RNA-seq data were aligned to the GRCm39 mouse genome and the GRCh38 human genome with HISAT2 version2.1.0 (https://bioweb.pasteur.fr/packages/pack@hisat2@2.1.0) with the default settings. The gene expression matrix, which was based on raw read counts, was analysed with DESeq2. Genes were classified as differentially expressed genes (DEGs) if they exhibited at least a twofold change and had a false discovery rate-adjusted p value of 0.05. Bioinformatics analyses, including heatmap generation with the “pheatmap” package, colour palette customization with “ggsci”, and gene ontology (GO) enrichment analysis with “enrichGO”, were performed using R software version 4.3.0.

We stored patient tumour and control tissues in preservation solution and sent them to Beijing SeekGene Biosciences Co., Ltd (Beijing, China). The company performed oil‒water separation and assessed cell viability and clustering rates. If the standards were met, the samples were sequenced via the 10$\times$Genomics 3’ v.3 protocol on the Illumina platform. CellRanger 3.0 (https://www.10xgenomics.com/cn/support/software/cell-ranger/latest) was used to calculate the abundance of each gene in different cells within the matrix. R (4.2.2) was subsequently employed to extract and analyse the matrix data. Quality control (QC) was performed according to the following criteria: 200 nFeature 6000, mitochondrial gene percentage below 5%, and removal of doublets. After dimensionality reduction and clustering, epithelial cells were isolated to analyse the differential gene expression between oesophageal cancer tissues and control tissues. The results were visualized using violin plots (VlnPlot) and dot plots (DotPlot).

Tissue samples from ESCC patients and healthy controls were collected at Zhongshan Hospital. The institution’s ethics committee approved this study, and all patients provided written informed consent. Samples were also collected from Senp5 flox/flox; Edl2-Cre genotype mice. All the samples were preserved in 4% paraformaldehyde (Sigma-Aldrich, Shanghai, China) for 24 hours and then dehydrated via a series of alcohol and xylene solutions (Sangon Biotech, Shanghai, China) before being embedded in paraffin blocks. A microtome was used to cut the paraffin blocks into 5-micron-thick slices, which were placed onto glass slides. These slides were dewaxed with xylene, treated with an alcohol gradient, rinsed in phosphate buffered saline (PBS) (Sangon Biotech, Shanghai, China), and treated with 3% hydrogen peroxide methanol (Sangon Biotech, Shanghai, China) to block endogenous peroxidase activity. After further rinsing with PBS, antigen retrieval was performed by heating the slides in citrate buffer (Sangon Biotech, Shanghai, China) at 95 °C, followed by another wash with PBS. After 30 minutes of blocking with 10% goat serum (Gibco, Thermo Fisher Scientific, Shanghai, China) at room temperature, the slides were incubated with diluted SENP5 antibody (1:500, Proteintech, Wuhan, Hubei, China, 19529-1-AP) or Ki67 antibody (1:500, Abcam, Shanghai, China, ab15580) overnight at 4 °C. After being washed with PBS, the slides were incubated with a biotin-labelled anti-rabbit secondary antibody (1:1000, Abcam, Shanghai, China) for half an hour at 37 °C, followed by another PBS wash and the addition of biotin-conjugated horseradish peroxidase (Sangon Biotech, Shanghai, China). The slides were incubated again at 37 °C for 30 minutes, washed with PBS, and stained with diaminobenzidine (DAB) (Sangon Biotech, Shanghai, China) for 2 minutes. Next, the slides were rinsed with tap water, counterstained with haematoxylin (Sangon Biotech, Shanghai, China), dehydrated through an alcohol and xylene gradient, and finally sealed with neutral resin (Sangon Biotech, Shanghai, China). A tissue microarray was prepared, and SENP5 staining was carried out by Runnerbio Technology (Shanghai, China). The images were analysed with the TissueFAXS Plus system (version 7.1, TissueGnostics, Beijing, China). According to the results of the tissue microarray analysis, the 200 patient samples were classified into SENP5-high and SENP5-low groups (100 patients per group).

Briefly, subcutaneous injections were administered on the right side of the backs of 8-week-old male athymic nude mice. After three weeks of regular feeding, the subcutaneous tumours on the backs of the mice were completely excised. The experimental procedures for the animals complied with the guidelines set forth by the Shanghai Jiaotong University School of Medicine (approval number: A-2022-082).

The human oesophageal squamous cell lines KYSE30, KYSE150, KYSE180, TE1, TE10, and EC109 were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China) in February 2023. RPMI 1640 medium (HyClone, Thermo Fisher Scientific, Shanghai, China) supplemented with 10% foetal bovine serum and 1% penicillin‒streptomycin was used for cell culture. The cells were cultured at 37 °C in a humidified incubator with 5% CO₂. All the cell lines were validated via short tandem repeat (STR) profiling and tested negative for mycoplasma. Cell authentication was performed via the following methods: an Axygen genomic extraction kit (Corning Incorporated, Shanghai, China) was used to extract DNA, and a 20-STR amplification protocol was used for amplification. The STR loci and sex gene amelogenin were detected on an ABI 3730XL genetic analyser (Thermo Fisher Scientific, Shanghai, China). The typing results of the tested cells were compared with the STR data of 2455 cell lines recorded in the ExPASy (https://www.expasy.org/), ATCC (https://www.atcc.org/), DSMZ (https://www.dsmz.de/), JCRB (https://cellbank.nibiohn.go.jp/english), and RIKEN (https://www.riken.jp/en/) databases. The DNA typing results of the six cell lines were completely matched in the cell line search, and no multiallelic genes were identified in any of the six cell lines. The last time the cell lines were tested was in December 2022.

The VectorBuilder Company (Guangzhou, China) provided the interfering RNA lentivirus of SENP5 and the control lentivirus (shSENP5 #1: CAGAAACTGAAAGAGAAATTA; shSENP5 #2: AGAAGTCCTTGGAAGATTAAA). Transfections were conducted according to the virus infection instructions, and the cell lines were screened with 1 µg/mL puromycin (Sigma-Aldrich, Shanghai, China) after 48 hours of infection.

Yeasen Biotech (Shanghai, China) provided the Cell Counting Kit-8, and cell proliferation was measured every 24 hours according to the manufacturer’s instructions. For the colony formation assay, an appropriate number of cells were cultured in 6-well plates. After 2 weeks of incubation in a humidified incubator at 37 °C and 5% CO₂, the cells were stained with crystal violet and scored under an inverted microscope (Leica, Beijing, China).

A sterile 10-µL pipette tip (Beyotime, Shanghai, China) was used to scratch the monolayer surface to create wounds, and images of the wound closure and gaps were taken after 24 hours. For the migration assay, 200 µL of single-cell suspension in serum-free medium was added to the upper chamber of a 24-well plate. The lower chamber was filled with 600 µL of RPMI-1640 medium (HyClone, Thermo Fisher Scientific, Shanghai, China) containing 10% fetal bovine serum (FBS) (HyClone, Thermo Fisher Scientific, Shanghai, China) per well. The cells in the upper chamber were removed after 24 hours, and the remaining cells were fixed and stained with crystal violet (Beyotime, Shanghai, China).

Glutamic acid, aspartic acid, and ATP levels were measured via the following assay kits: glutamic acid (Elabscience, Houston, TX, USA, E-BC-K903-M), aspartic acid (Amplite, Pleasanton, CA, USA, 13828), and ATP (Beyotime, Shanghai, China, S0026). Briefly, the cells were treated with lysis buffer (Beyotime, Shanghai, China). After centrifugation to remove cell debris, the supernatant was added to the substrate mixture. The luminescence of ATP was recorded in an illuminometer with an integration time of 10 s per well. The optical densities of glutamic acid and aspartic acid were recorded with a colorimetric microplate reader (Tecan, Shanghai, China) at OD450 nm.

The cells were harvested, lysed in immunoprecipitation (IP) lysis buffer (Beyotime, Shanghai, China) and centrifuged at 13,000 $\times$g for 10 minutes at 4 °C. The supernatants were subsequently harvested to measure protein concentrations. The lysates were incubated overnight at 4 °C with protein A/G beads conjugated to the appropriate IP antibody. Then, the beads were washed with IP lysis buffer, boiled in 1$\times$ SDS gel loading buffer (Beyotime, Shanghai, China), and subjected to electrophoresis. The components of the lysis buffer were as follows: 50 mM Tris-HCl [pH 7.4], 125 mM NaCl, 0.1% Triton X-100, and 1 mM EDTA.

For Western blot analysis, the cells were harvested after treatment, washed with phosphate-buffered saline (PBS) and lysed in lysis buffer containing 1% SDS. After loading buffer was added, the samples were heated at 95 °C for 10 minutes. A 10 µL sample was loaded onto a sodium dodecyl sulfate (SDS)-polyacrylamide gel for electrophoresis and then electrotransferred to polyvinylidene difluoride membranes. The membranes were blocked in 5% milk for 1 hour at room temperature and incubated overnight at 4 °C with gentle agitation in dilution buffer containing antibodies for the following proteins: SENP5 (1:1000, Proteintech, 19529-1-AP), SUMO1 (1:1000, Abcam, ab32058), $\beta$-tubulin (1:1000, Proteintech, 10094-1-AP), NF-$\kappa$B (1:1000, Abcam, ab32536), I$\kappa$B$\alpha$ (1:1000, Abcam, ab32518), EAAT1 (1:1000, Abcam, ab181036) and $\beta$-actin (1:1000, Proteintech, 81115-1-RR). Afterwards, the membrane was incubated for 1 h at room temperature with horseradish peroxidase (HRP) linked anti-rabbit IgG (1:5000, Abcam, ab6721). Then after incubated with enhanced chemiluminescence (ECL) western blotting (WB) substrate (tanon, 180-506, Shanghai, China) for 1 min. A Tanon 5200 imaging system (Shanghai, China) was used to collect images.

All the experiments were performed three times independently, and representative results are presented. The results are summarized as the means with standard deviations (means $\pm$ S.D.s) and were analysed via GraphPad Prism software (version 9.0, GraphPad Software, LLC, San Diego, CA, USA). p values less than 0.05 were considered statistically significant. Overall survival curves and relapse-free survival curves were analysed via the Kaplan‑Meier method.

We obtained the sequencing data of 94 ESCC tissues and 11 normal tissues from the TCGA-ESCA database to analyse the differentially expressed genes in oesophageal cancer. The results revealed a greater SENP5 expression level in oesophageal cancer tissue than in normal oesophageal tissue (Fig. 1A). RNA-seq analysis revealed that Senp5 expression was significantly increased in the oesophageal cancer tissues of ESCC mice (Fig. 1B). The scRNA-seq results also revealed that the SENP5 expression level was increased in ESCC cells (Fig. 1C,D). Then, we further collected human and mouse ESCC specimens (Supplemental Fig. 1A) and performed WB experiments and found the protein levels of SENP5 also increased in the ESCC tissues of both mice and humans. The protein levels of SENP5 also increased in the ESCC tissues of both mice and humans (Fig. 1E,F). In addition, immunohistochemical analysis revealed a greater level of SENP5 expression in oesophageal cancer tissues than in normal tissues (Fig. 1G). These results demonstrate that SENP5 is highly expressed in ESCC tissues and may play a role in the development of ESCC.

Fig. 1.

SUMO-specific Peptidase 5 (SENP5) is more highly expressed in oesophageal squamous cell carcinoma (ESCC) tissue than in normal tissue. All experiments were performed at least three times on cells. (A) SENP5 expression in normal oesophageal tissues (n = 11) and ESCC tissues (n = 94) from the the cancer genome atlas (TCGA) RNA-seq dataset. (B) Bulk RNA-seq transcriptome analysis showing the expression of Senp5 in mouse normal and oesophageal cancer tissues. The data are presented as the means $\pm$ SEMs; n = 5 mice/group. (C) Dot plots (DotPlot) showing SENP5 expression in oesophageal cells of ESCC patients. The dot size represents the percentage of cells, and the colour represents the average expression level. A total of 45,010 cells were retained in the two groups. (D) Violin plots (VlnPlot) showing SENP5 expression in normal and cancerous human epithelial cells. A total of 2110 epithelial cells were retained in the two groups. (E) Western blot analysis of SENP5 protein levels in normal and ESCC mouse tissues. (F) Western blot analysis of SENP5 protein levels in normal and tumour tissues from patients with ESCC. (G) Representative images of immunohistochemical analysis of SENP5 protein expression in normal and tumour tissues from humans. Scale bars of 4$\times$ images are 500 µm and scale bars of 20$\times$ images are 100 µm. The significance level is represented by **p 0.01.

To verify the role of SENP5 in ESCC, we analysed the expression of SENP5 in different ESCC cell lines and found that KYSE150 and EC109 cells presented relatively high expression (Fig. 2A). We subsequently established stable SENP5 knockdown (KD) in these two cell lines and verified the knockdown efficiency via Western blotting (Fig. 2B). CCK8 and colony formation assays revealed that the proliferation ability of shSENP5 oesophageal cancer cells was significantly inhibited (Fig. 2C,D). Wound-healing and Transwell invasion assays revealed that the cell migration/invasion ability of the shSENP5 group was also significantly decreased (Fig. 2E,F). These results demonstrate that SENP5 knockdown can inhibit the proliferation, migration and invasion of ESCCs in vitro.

Fig. 2.

SENP5 knockdown inhibits the proliferation and migration of ESCC cells. All experiments were performed at least three times on cells. (A) Western blot analysis of SENP5 protein levels in seven ESCC cell lines. (B) Western blot analysis of SENP5 protein levels in SENP5-knockdown or negative control (NC) EC109 and KYSE150 cells. (C) CCK8, (D) colony formation, (E) wound healing (scale bar = 100 µm), and (F) Transwell migration assays were performed in EC109 and KYSE150 cells with SENP5 knockdown, scale bar = 50 µm. The data are presented as the means $\pm$ SDs from three independent experiments. The significance level is represented by *p 0.05 and **p 0.01. NC, negative control; sh, short hairpin.

To investigate whether SENP5 influences ESCC growth in vivo, nude mice were subcutaneously injected with shNC- or shSENP5-transfected cells. The results revealed that SENP5 knockdown decreased tumour size and weight in vivo (Fig. 3A,B). In Senp5 conditional knockout (cKO) mice, we also observed fewer tumours in an ESCC model established using 4-nitroquinoline N-oxide (Fig. 3C–E). We subsequently conducted immunohistochemical Ki-67 staining of oesophageal tissue from Senp5 cKO mice and Senp5 flox/flox mice. Ki-67 is an antigen that is expressed in the nucleus and is closely related to cell proliferation. The results revealed that Senp5 knockout decreased Ki-67 expression in primary oesophageal cancer tissues from mice (Fig. 3F,G). These results suggest that targeting SENP5 in vivo inhibits the development of ESCC.

Fig. 3.

SENP5 deficiency inhibits tumour growth in vivo. (A,B) Tumour volume and weight of shNC- and shSENP5-transfected xenografts of EC109 cells are shown (n = 6 mice/group). (C) Genotype validation and Western blotting of oesophageal squamous epithelium-specific Senp5 conditional knockout mice. (D,E) Senp5 conditional knockout (cKO) mice had a lower incidence of oesophageal tumours than Senp5 fl/fl mice did. The red arrows in the plot indicate oesophageal tumours. The number of oesophageal tumours per mouse in Senp5 fl/fl mice was compared to that in cKO mice (n = 6 mice/group). (F) Senp5 cKO mice presented decreased Ki67 expression in tumour tissues compared with Senp5 fl/fl mice. Scale bar: 200 µm (left), 100 µm (right). (G) The percentage of Ki67-positive cells was plotted for both Senp5 cKO and Senp5 fl/fl mice (n = 6 mice/group). The significance level is represented by *p 0.05 and **p 0.01.

To validate the association between SENP5 expression and the prognosis of ESCC patients, we constructed a tissue chip using oesophageal cancer samples collected from Zhongshan Hospital. All patients underwent radical oesophageal cancer surgery and had not received other treatments. SENP5 expression in oesophageal cancer tissues was analysed via software, and samples were categorized into high SENP5 expression and low SENP5 expression groups in a bifurcated manner (n = 100 patients/group) based on expression intensity (Fig. 4A,B). We subsequently conducted a correlation analysis between SENP5 expression in oesophageal cancer tissues and the clinical characteristics and prognosis of 200 patients. The characteristics included sex, age, lymph node metastasis, pathological T stage, pathological N stage, differentiation, standardized uptake value max (SUVmax), surgical approach, Ki-67 expression level, and tumour location. The results revealed that patients in the high SENP5 expression group presented a higher pathological T stage (p 0.001) and a greater Ki-67 positivity rate than the low-expression group (p = 0.035). Additionally, statistical analysis revealed a greater SUVmax of the primary lesion in the high SENP5 expression group (SUVmax $>$8 = 87%) than in the low SENP5 expression group (SUVmax $>$8 = 51%) (Table 1). Furthermore, survival analysis revealed that patients in the high SENP5 expression group had significantly lower overall survival rates (p = 0.014) and relapse-free survival rates (p = 0.012) than those in the low SENP5 expression group did (Fig. 4C,D). Forest plot analysis revealed that the low SENP5 expression group had lower hazard ratios for both overall survival (hazard ratio (HR) = 0.539, p = 0.016) and relapse-free survival (HR = 0.584, p = 0.013) (Fig. 4E,F). Since SENP5 expression was correlated with the pathological Ki-67 positivity rate and SUVmax, we subsequently conducted a multivariate analysis. After incorporating Ki-67 and SUVmax into the multivariate analysis, the low SENP5 expression group still had a lower hazard ratio for relapse-free survival (HR = 0.592, p = 0.034) (Fig. 4G). However, there was no statistically significant difference in overall survival (OS) (HR = 0.586, p = 0.062) (Fig. 4H), which may be due to the numerous factors influencing OS. These findings suggest a close association between high SENP5 expression and poor prognosis in oesophageal cancer patients.

Fig. 4.

SENP5 expression is correlated with the pathological stage and prognosis of oesophageal cancer patients. (A) Patients were divided into high and low groups according to SENP5 expression level in tissue microarrays in a bifurcated manner (n = 100 patients/group), scale bar = 500 µm. (B) Density of SENP5 in high-expression and low-expression groups determined via ImageJ software (version 1.53t, National Institutes of Health (NIH), Bethesda, MA, USA). (C,D) Kaplan‒Meier survival curves were generated based on SENP5 expression. (E) Forest plot analysis of overall survival rates. (F) Forest plot analysis of relapse-free survival rates. (G) Forest plot analysis of relapse-free survival rates after incorporating Ki-67 and SUVmax into the multivariate analysis. (H) Forest plot analysis of overall survival rates after incorporating Ki-67 and SUVmax into the multivariate analysis. The significance level is represented by **p 0.01. HR, hazard ratio; CI, confidence interval.

To explore the mechanisms underlying SENP5 involvement in ESCC, we performed RNA-Seq analysis on shNC and shSENP5 in both the KYSE150 and EC109 cell lines. GO enrichment analysis revealed that SENP5 knockdown inhibited the amino acid transport pathway in oesophageal cells (Fig. 5A). We subsequently conducted a heatmap analysis and volcano plot analysis of the differentially expressed genes in the amino acid transport pathway and found that SLC1A3 exhibited the most significant changes (Fig. 5B,C; Supplemental Fig. 1B,C). RT‒qPCR and Western blotting confirmed that SENP5 knockdown inhibited SLC1A3 expression in ESCC cells (Fig. 5D,E). Excitatory amino acid transporter 1 (EAAT1) facilitates the transport of acidic amino acids within cells [25]. Moreover, EAAT1 plays a vital role in shuttling glutamic acid (Glu) and aspartic acid (Asp) between the cytoplasm and mitochondria, thereby sustaining the tricarboxylic acid (TCA) cycle and ATP synthesis within mitochondria, which is essential for cellular energy metabolism [25]. We assessed the levels of Glu, Asp and ATP and found a significant reduction in these levels after SENP5 knockdown (Fig. 5F–H), whereas EAAT1 overexpression restored the levels of Glu, Asp, and ATP in shSENP5 ESCC cells (Fig. 6A,C–E). Furthermore, the CCK8 results revealed that overexpression of EAAT1 could restore the proliferation ability of shSENP5 ESCC cells (Fig. 6B). These results indicate that SENP5 knockdown can inhibit amino acid and energy metabolism by suppressing the expression of SLC1A3, thereby inhibiting ESCC development.

Fig. 5.

SENP5 knockdown inhibits amino acid and energy metabolism in ESCC via the downregulation of SLC1A3. All experiments were performed at least three times on cells. (A) Gene Ontology (GO) enrichment analysis of the different pathways. (B) Heatmap of representative amino acid transport pathway-related genes differentially expressed between shNC- and shSENP5-transfected KYSE150 cells. (C) Volcano plot analysis of differentially expressed genes between shNC- and shSENP5-transfected KYSE150 cells. (D) Real time-quantitative polymerase chain reaction (RT‒qPCR) analysis and (E) Western blotting of SLC1A3 expression levels in shNC- and shSENP5-transfected EC109 and KYSE150 cells. (F,G) Colorimetric analysis of glutamate and aspartic acid levels in shNC- and shSENP5-transfected EC109 and KYSE150 cells. (H) Colorimetric analysis of ATP levels in shNC- and shSENP5-transfected EC109 and KYSE150 cells. The significance level is represented by **p 0.01.

Fig. 6.

Inhibition of SENP5 suppresses the NF-$\kappa$B‒SLC1A3 axis by enhancing SUMO1-mediated SUMOylation of I$\kappa$B$\alpha$. All experiments were performed at least three times on cells. (A) Western blot analysis results validated the overexpression of SLC1A3/EAAT1 in the shSENP5-transfected EC109 cell line. (B) CCK8 was performed in EC109 cells with SENP5 knockdown and SLC1A3 overexpression. (C,D) Colorimetric analysis of glutamate and aspartic acid levels in shNC-transfected, shSENP5-transfected and shSENP5+SLC1A3-overexpressing EC109 cell lines. (E) Colorimetric analysis of ATP levels in shNC-transfected, shSENP5-transfected and shSENP5+SLC1A3-overexpressing EC109 cell lines. (F) Western blot analysis of NF-$\kappa$B and p-NF-$\kappa$B protein levels in shNC- and shSENP5-transfected EC109 and KYSE150 cells. (G) Western blot analysis of I$\kappa$B$\alpha$ protein levels in shNC- and shSENP5-transfected EC109 and KYSE150 cells. (H) shNC- and shSENP5-transfected KYSE150 cells were treated as indicated and immunoprecipitated with anti-SUMO1 IP followed by immunoblotting with SUMO1 or I$\kappa$B$\alpha$ antibodies. (I) Western blot analysis of I$\kappa$B$\alpha$ and EAAT1 levels in shNC-, shSENP5- and shSENP5+siI$\kappa$B$\alpha$-transfected EC109 cells. The data are presented as the means $\pm$ SDs from three independent experiments. The significance level is represented by *p 0.05 and **p 0.01. “ns” indicates no statistical significance. EAAT1, excitatory amino acid transporter 1; NC, negative control; OE, overexpression; NF-$\kappa$B, nuclear factor kappa B; p-NF-$\kappa$B, phosphorylated nuclear factor kappa B; I$\kappa$B$\alpha$, NF-kappa-B inhibitor alpha; IP, immunoprecipitation; IB, immunoblotting.

ChIP-Atlas database analysis revealed that NF-$\kappa$B regulates the expression of SLC1A3. Consequently, we conducted Western blotting to assess the activity of NF-$\kappa$B in shNC- and shSENP5-transfected ESCC cell lines. The results indicated that SENP5 knockdown significantly suppressed the activation of NF-$\kappa$B in oesophageal cancer (Fig. 6F), whereas I$\kappa$B$\alpha$, an inhibitory component of NF-$\kappa$B, was markedly upregulated (Fig. 6G). A previous study has shown that SUMO1-mediated SUMOylation can inhibit the degradation of I$\kappa$B$\alpha$, thereby suppressing the activation of NF-$\kappa$B [20]. Accordingly, we found that SENP5 knockdown increased SUMO1-mediated SUMOylation of I$\kappa$B$\alpha$ in ESCC cells (Fig. 6H). To verify whether SENP5 regulates the expression of SLC1A3 by affecting the SUMOylation of I$\kappa$B$\alpha$ and thereby modulating the NF-$\kappa$B‒SLC1A3 axis, we knocked down I$\kappa$B$\alpha$ in shSENP5 EC109 cell lines via siI$\kappa$B$\alpha$ (Fig. 6I). Our results subsequently revealed that SENP5 knockdown inhibited EAAT1 expression in ESCC cells, whereas knocking down I$\kappa$B$\alpha$ restored EAAT1 expression (Fig. 6I). These findings suggest that SENP5 knockdown leads to increased SUMO1-mediated SUMOylation of I$\kappa$B$\alpha$, thereby attenuating the activation of the NF-$\kappa$B–SLC1A3 axis and subsequently inhibiting amino acid and energy metabolism in ESCC.