The House Ear Institute-Organ of Corti 1 (HEI-OC1) cell line and rat bone marrow-derived MSCs were purchased from Yaji Biological Technology Co., Ltd. (Shanghai, China) and cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 33 °C, 10% CO₂. HEI-OC1 cells were induced with hydrogen peroxide (H₂O₂) to simulate ARHL in vitro, as previously described [23]. GDF15-overexpressing lentiviral vectors, and si-GDF15 and GDF6 overexpression plasmids were obtained from Obio Technology Co., Ltd. (Shanghai, China). The lentivirus was packaged and infected HEI-OC1 cells and MSCs for 48 h, after which the supernatants were harvested. All cell lines were validated by short tandem repeat profiling and tested negative for mycoplasma.

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then RNA was reverse transcribed to synthesize cDNA. Using cDNA as a template, quantitative PCR (qPCR) was performed with 2$\times$SYBR Green qPCR Mix (Aidlab, Beijing, China) on the ABI-7500 Real-Time PCR System (Thermo Scientific, Waltham, MA, USA). Finally, the 2^{-Δ⁢Δ⁢Ct} method was applied to analyze the relative mRNA expression. The list of primer sequences (5^′-3^′) are shown as below:

GDF15-F: CCTGGTCTGGGGATACTGAG;

GDF15-R: AGCAGGAACAGCAGGAACC;

GDF6-F: CTT TGT AGA CAG AGGACT GGA CGA T;

GDF6-R: GCT CTT CTT TGTCTG AGA GTG TGG;

$\beta$-actin-F: CCACTGCCGCATCCTCTTCC;

$\beta$-actin-R: CTCGTTGCCAATAGTGATGACCTG.

Proteins were extracted with radioimmunoprecipitation assay (RIPA) buffer supplemented with PMSF (Servicebio Technology Co., Ltd., Wuhan, China) and quantified using the Bicinchoninic Acid Assay (BCA) Protein Quantification Kit (Vazyme, Nanjing, China). Then the proteins were resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis and electrotransferred to a polyvinylidene fluoride (PVDF) membrane. To block nonspecific binding, the membrane was incubated with 5% skim milk for 2 h at 25 °C. Next, the membrane was incubated at 4 °C overnight with the following primary antibodies: GDF15 (1:5000, 27455-1-AP; Proteintech, Chicago, IL, USA), sirtuin 1 (SIRT1) (1:5000, 13161-1-AP; Proteintech), B-cell lymphoma 2 (Bcl-2) (1:5000, 68103-1-Ig; Proteintech), Bcl-2-associated X (Bax) (1:10,000, 60267-1-Ig; Proteintech), cleaved caspase-3 (1:1000, #9664; Cell Signaling Technology, Danvers, MA, USA), light chain 3 (LC3)-I/II (1:2000, ab192890; Abcam, Cambridge, MA, USA), and p62 (1:1000, #23214; Cell Signaling Technology). After washing with phosphate-buffered saline (PBS), the membrane was incubated at 25 °C for 1–2 h with horseradish peroxidase-labeled IgG secondary antibodies. Finally, enhanced chemiluminescence was used to visualize the proteins. The results presented are from three independent biological replicates.

Apoptosis of HEI-OC1 cells was evaluated by flow cytometry with FITC Annexin V Apoptosis Detection Kit I (BD Biosciences Pharmingen, San Diego, CA, USA). After washing with PBS, HEI-OC1 cells (1 $\times$ 10⁵) were resuspended in binding buffer. The cells were incubated with FITC Annexin V (5 µL) and propidium iodide (5 µL) for 15 min at 25 °C in the dark. After adding 400 µL binding buffer, the apoptosis rate was analyzed using a flow cytometer (BD Biosciences, San Jose, CA, USA) within 1 h.

The analysis of autophagosome formation in HEI-OC1 cells was performed by immunofluorescence staining for LC3. In brief, HEI-OC1 cells in each group were successively fixed in 4% paraformaldehyde at room temperature for 30 min, and then blocked in 5% bovine serum albumin at 37 °C for 2 h. Next, HEI-OC1 cells were incubated overnight with LC3B antibody (Abcam) at 4 °C, followed by incubation with Cy3-labeled IgG secondary antibody at 37 °C for 1 h in the dark. After staining with Hoechst for 10 min, the photographs were taken by confocal microscopy (IX83; Olympus, Tokyo, Japan).

All procedures involving animals were performed in compliance with our institutional animal care guidelines and approved by the Institutional Animal Care and Use Committee (IACUC) of Nanchang University (Approval No. 20221031014). A total of 36 male Sprague Dawley rats were purchased from Charles River (Beijing, China). Mice were randomly divided into six groups (n = 6/group): Normal, Model, Model + adeno-associated virus-negative control (AAV-NC), Model + AAV-GDF15, Model + MSCs-NC, and Model + MSCs-GDF6. Rats in the Model groups were intraperitoneally injected with D-galactose (150 mg/kg/d) for 60 days. AAV-GDF15/NC (Obio Technology) or MSCs-NC/MSCs-GDF6 (1 $\times$ 10⁵) were retroauricularly injected into the scala media or tympani of the cochlea on Days 0 and 30, respectively. At the end of the experiments, all rats were euthanized with 100% compressed CO₂ gas.

Rats in each group were anesthetized with pentobarbital sodium (2%, 40 mg/kg, Sigma-Aldrich, St. Louis, MO, USA) by intraperitoneal injection. A metal recording electrode was placed under the skin at the top of the skull, the reference electrode was placed under the earlobe on the acoustic side, and the ground electrode was placed under the skin behind the auricle on the opposite side. Different frequencies of tone burst (8, 12, 24 kHz) were given from the recording system. The stimulus intensity started from 100 dB sound pressure level (SPL) and decreased successively with 5 dB; the lowest stimulus intensity that could distinguish wave shape Ⅰ or Ⅱ was determined as the auditory brainstem response (ABR) threshold.

Cochlear tissues were isolated from rats and placed under a dissecting microscope after repeated rinsing with pure water. The round window membranes were opened and a small hole was drilled in the tip of the cochlea with the needle of a 1 mL syringe. Silver nitrate solution (0.5%) was immediately perfused until outflowing from the oval foramen at the bottom of the cochlea. After fixing in 10% formaldehyde, the specimens were exposed to sunlight for about 2 h. Finally, morphological changes of the outer HCs (OHCs) in the basement membrane were observed under an optical microscope.

The Cell Counting Kit-8 (CCK-8) assay was performed to evaluate MSC proliferation. MSCs were inoculated in 96-well plates. After the cell density reached 60–70%, MSCs were co-cultured with 10 µL CCK-8 (Beyotime Bio., Shanghai, China) in the dark for 1–4 h. The optical density value was obtained at 450 nm using a microplate reader (SpectraMax i3x, Molecular Devices, San Jose, CA, USA).

Three replicates were set up for each experiment, and data from each experiment are expressed as the mean $\pm$ standard deviation. GraphPad Prism 8.0 (GraphPad Software, La Jolla, CA, USA) was applied for statistical analyses. The Student’s t-test and one-way analysis of variance was used for comparisons between two groups and multiple groups, respectively. p 0.05 was considered statistically significant.

HEI-OC1 cells were exposed to H₂O₂ to create an in vitro model of ARHL. The preliminary results of RT-qPCR and western blot analysis showed that the mRNA and protein expression of GDF15 was significantly decreased after exposure to H₂O₂ in HEI-OC1 cells (Fig. 1), indicating the potential role of GDF15 in ARHL. For all original western blot figures of Fig. 1B see Supplementary Material.

Fig. 1.

GDF15 expression in H₂O₂-stimulated HEI-OC1 cells. HEI-OC1 cells were exposed to H₂O₂ to create an in vitro cell of ARHL. RT-qPCR (A) and western blot analysis (B) were used to analyze the mRNA and protein expression of GDF15 in H₂O₂-stimulated HEI-OC1 cells. ^**p 0.01 vs. the Ctrl group. GDF15, growth differentiation factor 15; ARHL, age-related hearing loss; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

To assess the effects of GDF15 on H₂O₂-stimulated HEI-OC1 cells, GDF15 overexpression or knockdown plasmid was transfected into H₂O₂-stimulated HEI-OC1 cells. Fig. 2A shows the remarkable transfection efficiency. Western blot analysis (Fig. 2B) and flow cytometry (Fig. 2C) showed that H₂O₂ stimulation induced apoptosis in HEI-OC1 cells, which was evidenced by decreased anti-apoptotic protein (Bcl-2) expression, and increased pro-apoptotic protein (Bax and cleaved caspase-3) expression and apoptotic rate. For all original western blot figures of Fig. 2B see Supplementary Material. Furthermore, the results of GDF15 gain/loss-of-function studies demonstrated that GDF15 negatively regulated apoptosis in H₂O₂-induced HEI-OC1 cells. We also found that H₂O₂ treatment led to a decrease in SIRT1 expression, which was positively regulated by GDF15.

Fig. 2.

Effects of GDF15 on the apoptosis of H₂O₂-stimulated HEI-OC1 cells. GDF15 overexpression or knockdown plasmid was transfected into H₂O₂-stimulated HEI-OC1 cells. (A) RT-qPCR was used to detect the transfection efficiencies of GDF15 overexpression and GDF15 silencing. (B) Detection of SIRT1, Bax, Bcl-2 and cleaved caspase-3 protein expression by western blot analysis. (C) Analysis of apoptosis rate using flow cytometry. ^*⁣**p 0.001 vs. the Ctrl group; ^#⁢#p 0.01, ^#⁢#⁢#p 0.001 vs. the H₂O₂ + NC group; ^&&p 0.01, ^&⁣&&p 0.001 vs. the H₂O₂ + si-NC group. GDF15, growth differentiation factor 15; SIRT1, sirtuin 1; NC, negative control; si-NC, small interfering RNA- negative control; Bax, Bcl-2-associated X; Bcl-2, B-cell lymphoma 2.

Next, the relationship between GDF15 and autophagic flux was further explored. As shown in Fig. 3A,B, H₂O₂ induced an increase in the LC3 II/LC3 I ratio and number of LC3-positive autophagosomes (Red fluorescence). For all original western blot figures of Fig. 3A see Supplementary Material. Furthermore, GDF15 overexpression decreased the LC3 II/LC3 I ratio and number of LC3-positive autophagosomes, whereas GDF15 silencing had the opposite effects on H₂O₂-induced HEI-OC1 cells. These data only showed that H₂O₂ treatment and GDF15 silencing promoted the formation of autophagosomes. To monitor autophagic flux, the level of p62 protein was also detected. Fig. 3A illustrates that H₂O₂ treatment and GDF15 silencing led to p62 accumulation in HEI-OC1 cells, corresponding with inhibition of autophagy activity, which is contradictory to the finding of increased LC3 II/LC3 I ratio and autophagosomes, suggesting autophagy disruption. The above findings indicate that H₂O₂ treatment induced autophagic flux blockade in HEI-OC1 cells. Further gain/loss-of-function studies clarified that GDF15 overexpression restored autophagic flux, while GDF15 knockdown exacerbated autophagic flux blockade in H₂O₂-induced HEI-OC1 cells.

Fig. 3.

Effects of GDF15 on the autophagic flux of H₂O₂-stimulated HEI-OC1 cells. GDF15 overexpression or knockdown plasmid was transfected into H₂O₂-stimulated HEI-OC1 cells. (A) Expression of autophagy-related proteins (LC3 I, LC3 II, p62) was detected by western blot analysis. (B) Immunofluorescence of LC3-positive autophagosomes (red fluorescence). Scale bar: 20 µm. ^*⁣**p 0.001 vs. the Ctrl group; ^#⁢#p 0.01, ^#⁢#⁢#p 0.001 vs. the H₂O₂ + NC group; ^&&p 0.01, ^&⁣&&p 0.001 vs. the H₂O₂ + si-NC group. GDF15, growth differentiation factor 15; LC3, light chain 3; NC, negative control; si-NC, small interfering RNA- negative control.

In view of the regulation of apoptosis and autophagic flux by GDF15, we established a rat model of ARHL to evaluate the protective effects of AAV-GDF15 on ARHL. Consistent with the in vitro experiments, GDF15 and SIRT1 expression was also downregulated in the cochlear tissues of ARHL rats (Fig. 4A), but upregulated after treatment with AAV-GDF15. For all original western blot figures of Fig. 4A,D,E see Supplementary Material. Next, we evaluated the hearing function of rats through ABR thresholds and observed OHCs using cochlear silver nitrate staining. Compared with the Normal group, ABR thresholds (Fig. 4B) were increased and there was great loss of OHCs in ARHL rats (Fig. 4C), indicating their weakened hearing function. Notably, treatment with AAV-GDF15 reduced the ABR thresholds and the loss of OHCs in ARHL rats. In addition, we used western blotting to measure the apoptosis and autophagy-related proteins. In ARHL rats, expression of the LC3 II/LC3I ratio, p62, and pro-apoptotic-related proteins (Bax and cleaved caspase-3) was increased (Fig. 4D), but expression of the Bcl-2 anti-apoptotic-related protein was decreased (Fig. 4E). These findings demonstrated that autophagic flux was blocked and apoptosis was upregulated in the cochlear cells of ARHL rats. However, these alterations were reversed after treatment with AAV-GDF15. Overall, these data suggest the protective effects of GDF15 overexpression on ARHL.

Fig. 4.

Effects of GDF15 on a rat model of ARHL. A rat model of ARHL was established and treated with AAV-GDF15. (A) Western blotting was used to detect the protein expression of GDF15 and SIRT1. (B) ABR test. (C) Cochlear silver nitrate staining (Scale bar: 50 µm). The arrows show three rows of outer hair cells. Western blot analysis was used to detect the expression of autophagy (D) and apoptotic-related (E) proteins. ^*⁣**p 0.001 vs. the Normal group; ^#p 0.05, ^#⁢#⁢#p 0.001 vs. the Model + AAV-GDF15 group. GDF15, growth differentiation factor 15; ARHL, age-related hearing loss; AAV-GDF15, adeno-associated virus-growth differentiation factor 15; SIRT1, sirtuin 1; ABR, auditory brainstem response.

Finally, MSCs were infected with lentivirus-containing GDF6 overexpression vectors, and the significant efficiency of GDF6 overexpression is illustrated in Fig. 5A. The CCK-8 assay showed that GDF6 overexpression promoted MSC proliferation (Fig. 5B). Subsequently, ARHL rats were treated with MSCs-GDF6. Western blot analysis showed that MSC treatment increased GDF15 and SIRT1 expression in ARHL rats (Fig. 5C). As illustrated in Fig. 5D,E, MSC treatment reduced ABR thresholds, recovered the neatly arranged OHCs, and decreased the loss of OHCs in ARHL rats. In addition, autophagy-related proteins (LC3 II/LC3 I, p62) and pro-apoptotic-related proteins (Bax and cleaved caspase-3) were downregulated, while the Bcl-2 anti-apoptotic-related protein was significantly upregulated in ARHL rats treated with MSCs (Fig. 5F,G). For all original western blot figures of Fig. 5C,F,G see Supplementary Material. Interestingly, these outcomes were further enhanced after treatment with MSCs-GDF6. In general, MSCs-GDF6 prevented apoptosis and restored autophagic flux of cochlear HCs to alleviate ARHL.

Fig. 5.

Effects of MSCs-GDF6 on a rat model of ARHL. ARHL rats were treated with MSCs modified with GDF6 overexpression. (A) RT-qPCR was used to detect GDF6 overexpression efficiency. (B) The CCK-8 assay was used to analyze MSC proliferation. (C) Western blot analysis was used to detect the protein expression of GDF15 and SIRT1. (D) ABR test. (E) Cochlear silver nitrate staining (Scale bar: 50 µm). The arrows show three rows of outer hair cells. Western blotting was used to detect autophagy (F) and apoptotic-related (G) proteins. ^**p 0.01, ^*⁣**p 0.001 vs. the NC or Model group; ^#⁢#p 0.01, ^#⁢#⁢#p 0.001 vs. the Model + MSCs-NC group. GDF6, growth differentiation factor; MSCs, mesenchymal stem cells; MSCs-GDF6, GDF6 overexpression-induced mesenchymal stem cells; ARHL, age-related hearing loss; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; CCK-8, cell counting Kit-8; SIRT1, sirtuin 1; ABR, auditory brainstem response; NC, negative control; MSCs-NC, mesenchymal stem cells-negative control.