All of the studied compounds were obtained from Chemlight, Moscow, Russia (1) and from Selleckchem, Houston, TX, USA (2). We studied apigenin, CAS 520-36-5, Lot. 0436771-86, (1); berberine, CAS 633-65-8, Lot. S904601, (1); coumarin, CAS 91-64-5, (1); curcumin, CAS 458-37-7, (1); delphinidin, CAS 13270-61-6, Lot. 117271994, (1); EGCG, CAS 989-51-5, Lot. SLBL3516V, (1); fisetin, CAS 528-48-3, Lot. 477164536, (1); genistein, CAS 446-72-0, Lot. S134201, (1); ginsenoside, Rb1, CAS 41753-43-9, Lot S392401, (1); kaempferol, CAS 520-18-3, Lot. S231406, (1); naringenin, CAS 480-41-1, (1); quercetin, CAS 117-39-5, Lot. LRAB3054, (1); resveratrol, CAS 501-36-0, Lot. 139609, (1); sanguinarine chloride hydrat, CAS 5578-73-4, Lot. S903202, (1); thymoquinone, CAS 490-91-5, Lot. S476101, (1). Curaxin CBL0137 was provided by Incuron, Inc., Russia. Triton X-100 (CAS 9002-93-1, Lot. 19H2156267) was purchased from BioInnlabs, Rostov-on-Don, Russia. Phenol – chloroform – isoamyl alcohol mixture (CAS 136112-00-0), TopVision Low Melting Point Agarose (CAS 39346-81-1, Lot. 91339087), cOmplete™, Mini Protease Inhibitor Cocktail (cat. 11836153001, Lot. 33576300), Laemmli Sample Buffer x2 (CAS 53123-88-9, Lot. S3401), Phosphate-buffered saline (PBS, P4417, Lot. M8254), DAPI (CAS 28718-90-3, Lot. 378275275), thymidine (50-89-5, Lot. WXBD3213V), 5-Ethynyl-2${}^{\prime }$-deoxyuridine (EdU, 61135-33-9, Lot. 2161886), 4% paraformaldehyde (CAS 30525-89-4), bovine serum albumin (CAS 9048-46-8), Resazurin sodium salt (CAS 62758-13-8, Lot. MKCG9800) and G418 disulfate salt solution (CAS 108321-42-2) were purchased from Sigma Aldrich (Merck), Bengaluru, Karnataka, India. Micrococcal nuclease derived from Staphylococcus aureus (CAS 9013-53-0, Lot. 00473368), Q5® High-Fidelity DNA Polymerase (M0491L, Lot. 509DR50200), T4 Polynucleotide Kinase (M0201L) and T4 DNA ligase (M0202T) were obtained from NEB, USA. DC™ Protein Assay Kit I (5000111EDU) was purchased from Bio-Rad (Moscow, Russia). Clarity Max™ Western ECL Substrate for Chemiluminescent Detection of Horseradish Peroxidase (HPR) Conjugates (cat. 1705062, Lot. 102031834) was purchased from Helicon, Moscow, Russia. Click-iT™ EdU Cell Proliferation Kit (C10337, Lot. 2161886), TRIzol™ Reagent (15596026, Lot. 03211240170), TurboFect Transfection Reagent (R0531), M-MLV Reverse Transcriptase Buffer (18057018, Lot. EA029021173) and FastAP alkaline phosphatase (EF0651) were purchased from Thermo Scientific (Invitrogen), Waltham, MA, USA. Nuclear Marker and ChIP Grade (ab1791, Lot. 00211074) was purchased from Abcam (Cambridge, UK). Hexanucleotides (6-random, Random Hexa Primer, D0300) was purchased from Sileks (Moscow, Russia). 2.5x Reaction mixture for quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR) in the presence of SYBR Green I dye (M-427, Lot. SA001021272) was purchased from Syntol (Moscow, Russia). Plasmid pCMV(CAT)T7-SB100 (34879) was obtained from Addgene (Watertown, MA, USA).

Human cervical cancer cells (HeLa) was obtained from the Blokhin Cancer Research Center (CRC) cell collection, HeLa_SSRP1-GFP_H2B-mCherry were obtained from the Department of Cell Stress Biology at Roswell Park (Buffalo, NY, USA). HeLa_H1.5-mCherry cells were constructed as described below. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with L-glutamine (0.584 mg/mL), penicillin (50 U/mL), and streptomycin (50 µg/mL) (PanEco, Moscow, Russia) and 10% fetal bovine serum (PanEco). Cell lines were incubated at 37 °C and 5% CO${}_2$. All cell lines were validated by STR profiling and tested negative for mycoplasma.

Vector pSB/IR-TRE3G-H1-mCherry was constructed in order to provide expression of fluorescent linker histone H1.5 in HeLa cells. This plasmid includes the gene of H1-mCherry fusion protein and inverted repeats that are crucial for transposition (via “sleeping beauty” mechanism).

The sequence of H1-mCherry gene and the gene of resistance to geneticin was amplified from pReceiver-M55 plasmid provided by the laboratory of Katerina Gurova. Amplification was carried out with Q5 polymerase (NEB, Ipswich, MA, USA) and the following primers:

forward: 5${}^{\prime }$-GAGATATCTAAGATACATTGATGAGTTTGGAC-3${}^{\prime }$

reverse: 5${}^{\prime }$-CGCCACCATGGTGAGCAAGGGCG-3${}^{\prime }$

Blunt ends of the product were kinated with T4 Polynucleotide Kinase (NEB, Ipswich, MA, USA).

Plasmid pSB-IR-TRE3G-5.1, which contains inverted repeats for transposition and TRE3G promotor (with the tetracycline controlled transcriptional activation), was hydrolyzed with EvoRV restrictase resulting in DNA fragment with blunt ends. Linear DNA fragment was incubated with FastAP alkaline phosphatase (ThermoScientific, Waltham, MA, USA) in order to avoid circularization of the fragment during ligation.

Two fragments were ligated with T4 DNA ligase (SibEnzyme, Novosibirsk, Russia). Bacterial colonies with the proper construction were selected in PCR with the following primers:

forward: 5${}^{\prime }$-CTGAGCTAGCTTACTTGTACAGCTCGTCC-3${}^{\prime }$

reverse: 5${}^{\prime }$- CGATTTTTGTGATGCTCGTCAGG-3${}^{\prime }$

PCR with proper construction resulted in the DNA product of 1773 bp. Plasmid sequence was confirmed by sequencing.

Final plasmid pSB/IR-TRE3G-H1-mCherry was transfected into HeLa cells in 60 mm dishes using TurboFect Transfection Reagent (ThermoScientific, Waltham, MA, USA) according to the manufacturer’s protocol. It was transfected with plasmid pCMV(CAT)T7-SB100 (Addgene, 34879) in the ratio of 4 to 1. pCMV(CAT)T7-SB100 encodes sleeping beauty SB100X transposase, which inserts the construction into cell genome. Cells containing the construction in their genome were selected with geneticin (G418).

The nontoxic concentrations of phytonutrients for Hela cells were measured using the resazurin test based on the fluorescent determination of the metabolic activity of viable cells. For analysis, HeLa cancer cells were seeded in 96-well plates (10,000 cells per well in 180 µL of DMEM). Cells were treated with phytonutrients of various concentrations for 24 hours. Then, 20 µL of resazurin reagent solution (0.18 mg/mL) was added to each well and incubated for 4 h at 37 °C. The plates were read on a Fluoroscan FL (Thermo Scientific, Waltham, MA, USA) using a test wavelength of 530 nm. IC50 and IC20 values and nontoxic concentrations were derived from aproximate logistic function of resorufin fluorescence intensity at 592 nm. Maximum non-toxic concentrations were confirmed using propidium iodide (PI)/annexin cell staining and subsequent flow cytometric analysis. All experiments were carried out in parallel and in triplicate.

Micrococcal nuclease digestion assay was performed as previously described [35] with some modifications. HeLa cells were trypsinized, harvested, and washed once with 1$\times$ RSB buffer (10 mM Tris, pH7.6, 15 mM NaCl and 1.5 mM MgCl${}_2$). After centrifugation, the cell pellet was resuspended in 1$\times$ RSB buffer with 1% Triton X-100 and homogenized by five strokes with a loose-fitting pestle to release nuclei. Nuclei were collected by centrifugation (2000 g, 5 min) and washed twice with 1 mL of fresh buffer A (15 mM Tris, pH 7.5, 15 mM NaCl, 60 mM KCl, 0.34 M sucrose, 0.5 mM spermidine, 0.15 mM spermine, 0.25 mM PMSF and 0.1%-mercaptoethanol). Finally, nuclei (from 20 $\times$ 106 cells) were resuspended in 1.5 mL of buffer A, and 15 µL of 0.1 M CaCl${}_2$ was added. Concentrated solutions of all analyzed compounds were prepared in dimethyl sulfoxide (DMSO) or ethanol, and the concentration of solvents in the incubation medium of cell nuclei after the addition of compounds was 0.4%, which had no significant effect on either the epigenetic regulation of transcription or transcription activity in HeLa TI cells. HeLa cell nuclei were treated at first with CBL0137 or PSMs for 30 min at 37 °C and then with NEB micrococcal endonuclease for 15 min. To control the quality of the untreated chromatin used in the experiment, nuclease digestion was stopped immediately after the enzyme addition to the nuclei untreated with PSMs. For digestion, 1 µL of 200 U/mL micrococcal nuclease (NEB, Ipswich, MA, USA) was added to 0.5 mL nuclei suspension at 37 °C. Aliquots (60 µL) were taken after 15 min, and 1.5 µL 0.5 M EDTA was added to stop the reaction (final concentration: 12.5 mM). Subsequently, 18 µL H${}_2$O, 12 µL of 10% SDS and 24 µL of 5 M NaCl were added to each tube. The mixtures were extracted with phenol–chloroform followed by ethanol-based precipitation. DNA was analyzed on a 1.5% agarose gel, stained with 0.5 g/mL ethidium bromide in 1$\times$ TAE for 30 min, destained for 2 $\times$ 15 min in ddH${}_2$O, and imaged as described above.

To visualize the localization of core histone H2B and linker histone H1.5 cells HeLa_SSRP1-GFP_H2B-mCherry or HeLa_H1.5-mCherry were seeded in 6-well plates (150,000 cells per well) with cover glass 22 $\times$ 22 mm for microscopy. After 24 hours, cells were incubated with CBL0137 (positive control) for 1 hour or with phytonutrients for 1 hour or 24 hours. After the treatment, cells were washed twice with PBS and fixed in 4% paraformaldehyde at room temperature for 15 min. After three washes, the nuclei were stained with DAPI. The coverslips were mounted on the glass slides using Mowiol mounting medium. Images were obtained with a Zeiss Axio Observer A1 inverted microscope (Carl Zeiss, Munich, Germany) with N-Achroplan 100$\times$/1.25 oil lens (Carl Zeiss, Munich, Germany), Zeiss MRC5 camera (Carl Zeiss, Munich, Germany), and AxioVision Rel.4.8 software (Carl Zeiss Microscopy, LLC, White Plains, NY, USA). Experiments were performed three times. 200 cells were analized for each point. Image analyses was done using ImageJ (version 1.48; National Institute of Health, Bethesda, MD, USA).

For isolation of total protein, cells were incubated with RIPA buffer (50 mM Tris–HCl, pH 7.4, 1% NP-40, 0.5% Na-deoxycholate, 450 mM NaCl, 1 mM EDTA, 1 mM EGTA), with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) on ice for 30 min. For chromatin and nucleoplasmic fraction extraction 10 million cells were resuspended in 1 mL of Buffer A (10 mM HEPES-KOH, pH 7.9, 1.5 mM MgCl${}_2$, 10 mM KCl, 0.5 mM DTT) with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and incubated for 10 min on ice. Then the cell pellet was homogenized by 50 strokes with a loose-fitting pestle. The homogenized suspension was centrifuged at 600 g for 5 min at 4 °C. The remaining pellet was resuspended in High Salt Buffer-1 (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 1.5 mM MgCl${}_2$, 0.42 M NaCl, 0.2 mM EDTA) with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and was incubated 90 min at 4 °C gently mixing on a shaker. Then it was centrifuged at 16,000 g for 30 min at 4 °C and the supernatant was taken as the nucleoplasmic fraction. The pellet was resuspended in High Salt Buffer-2 (20 mM HEPES-KOH, pH 7.9, 25% glycerol, 1.5 mM MgCl${}_2$, 0.75 M NaCl, 0.2 mM EDTA) with Complete Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and boiled 5 min at 95 °C. Then it was centrifuged at maximum velocity for 15 min at 4 °C and the supernatant was collected as the chromatin-bound fraction of proteins [38].

Protein concentrations were determined with the BioRad DC protein assay kit (Hercules, CA, USA). Samples were mixed with Laemmli Gel Loading buffer and boiled for 5 min at 95 °C.

Samples were exposed to polyacrylamide gel with sodium dodecyl sulfate (SDS-PAGE) (10%), transferred to a Polyvinylidene fluoride (PVDF) membrane, blocked with 5% non-fat milk for 1 hour, incubated with primary antibodies over night at 4 °C and secondary antibodies conjugated to peroxidase for 1 hour at room temperature. Bands were detected using Clarity Western substrate for enhanced chemiluminescence (ECL) visualization reagent (1705061, Bio-Rad, Hercules, CA, USA) and ImageQuant LAS 4000 digital imaging system (GE Healthcare, Chicago, IL, USA). Densitometric analysis of the blots was performed using ImageJ software. Experiments were performed minimum three times.

We used the following pimary antibodies: SSRP1, mouse monoclonal 10D1 (BioLegend, cat# 609702, San Diego, CA, USA); SPT16, mouse monoclonal 8D2 (BioLegend, cat# 607002, San Diego, CA, USA); $\beta$ -actin (Santa Cruz Biotechnology cat# sc-47778; 1:20,000, Dallas, TX, USA); H3 (abcam cat# 1791, Cambridge, UK); H1.2 (abcam cat#17677, Cambridge, UK); H1.4 (abcam cat#105522, Cambridge, UK); PARP1 (Cell Signaling cat#9532S, Danvers, MA, USA) and secondary antibodies: mIG-HRP (Santa Cruz Biotechnology cat#sc-516102, Dallas, TX, USA).

The effect of phytonutrients on H1 genes expression was evaluated in cell line HeLa using the RT-qPCR assay. Cells were incubated for 24 h in the medium with various phytonutrients using concentration IC20 in 6-well plates. Then, total RNA was extracted with TRIzol reagent (ThermoScientific, Waltham, MA, USA) according to the manufacturer’s protocol. For cDNA synthesis, total RNA (1 µg from both untreated and phytonutrient-treated cells) was reverse transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) reverse transcriptase and random hexanucleotide primers in 25 µL of the reaction mixture according to the manufacturer’s protocol (Syntol). Each PCR was based on 5 ng of DNA, 1$\times$ PCR Buffer, 0.3 mM dNTPs, 3 mM MgCl${}_2$, 0.2 U Syn Taq DNA polymerase, and 0.2 µM forward and reverse primers in a 25-µL reaction volume. RT-qPCR was carried out with a CFX96 Touch™ Real-Time PCR detection system from Bio-Rad Laboratories (Moscow, Russia). Real-time RT-qPCR was performed using the following thermal cycling conditions: initial denaturation step by heating at 95 °C for 5 min, followed by 40 cycles of 15 s denaturation (at 95 °C), 20 s at the appropriate temperature (depending on the Tm values of the primer used) and 25 s of extension at 72 °C. Expression of the gene of interest was normalized to the constitutively expressed housekeeping gene RPL27. The relative expression level was calculated for each sample using the 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{Ct}}$ method.

The sequences of the gene-specific primers used for RT-qPCR were as follows:

• RPL27 F: 5${}^{\prime }$ACCGTCACCCCCGCAAAGTG 3${}^{\prime }$

• RPL27 R: 5${}^{\prime }$CCCGTCGGGCCTTGCGTTTA 3${}^{\prime }$

• H1-0 F: 5${}^{\prime }$CCTGCGGCCAAGCCCAAGCG 3${}^{\prime }$

• H1-0 R: 5${}^{\prime }$AACTTGATCTGCGAGTCAGC 3${}^{\prime }$

• H1-1 F: 5${}^{\prime }$CTCCTCTAAGGAGCGTGGTG 3${}^{\prime }$

• H1-1 R: 5${}^{\prime }$GAGGACGCCTTCTTGTTGAG 3${}^{\prime }$

• H1-2 F: 5${}^{\prime }$GGCTGGGGGTACGCCT 3${}^{\prime }$

• H1-2 R: 5${}^{\prime }$TTAGGTTTGGTTCCGCCC 3${}^{\prime }$

• H1-3 F: 5${}^{\prime }$CTGCTCCACTTGCTCCTACC 3${}^{\prime }$

• H1-3 R: 5${}^{\prime }$GCAAGCGCTTTCTTAAGC 3${}^{\prime }$

• H1-4 F: 5${}^{\prime }$GTCGGGTTCCTTCAAACTCA 3${}^{\prime }$

• H1-4 R: 5${}^{\prime }$CTTCTTCGCCTTCTTTGGG 3${}^{\prime }$

• H1-5 F: 5${}^{\prime }$CATTAAGCTGGGCCTCAAGA 3${}^{\prime }$

• H1-5 R: 5${}^{\prime }$TCACTGCCTTTTTCGCCCC 3${}^{\prime }$

For Analysis of cell cycle phase distribution HeLa_H1.5-mCherry was seeded in 6-well plates (100,000 cells per well). After 24 hours, cells were treated with compounds of interest at IC20 concentrations for 1 hour. Next, the cells were incubated for 20 min with EdU (20 µM) and removed from the substrate with trypsin.

For monitoring of cell cycle synchronization HeLa_H1.5-mCherry was seeded in 6-well plates (50,000 cells per well). After 24 hours to synchronize cells in S phase, cells were treated with thymidine (final concentration 2 µM), incubated for 14–16 hours, then cells were washed twice with PBS, culture medium was added and incubated for 6–10 hours. Cells were then washed twice with PBS and treated again with thymidine. Cells were incubated for 20 min with EdU (20 µM) and removed from the substrate with trypsin: for S-phase fixation after 15 hours, for G2/M-phase fixation after 21 hours, for G1-phase fixation after 29 hours.

After the above treatments, cell lines were washed several times with PBS and fixed in cold 4% paraformaldehyde for 15 min. After three washes, they were permeabilized with cold Triton-X100 for 7 min and blocked with bovine serum albumin for 1 hour. Then S-phase labeling was carried out in a fast, highly-specific click reaction (Invitrogen™Click-iT™ EdU Cell Proliferation Kit, Waltham, MA, USA). To mark the G2/M phase, immunofluorescent staining of cells with antibodies to cyclin B1 (Invitrogen cat#MA5-13128, Waltham, MA, USA) and subsequent binding with secondary antibodies AlexaFluor647 (Abcam cat#150115, Cambridge, UK) were performed in darkness. Cells were washed with PBS and analyzed on a FACS Canto-2 flow cytometer. Thus, a cell in S-phase had a phenotype (EdU+, cyclin B1–), and in a cell in G2/M-phase it had a phenotype (EdU–, cyclin B1+). The absence of both markers (EdU–, cyclin B1–) is a sign of cell identification in the G1/G0 phase.

Also cell cycle analysis was carried out according to PI staining protocol (Invitrogen, Waltham, MA, USA). Cells were collected, washed twice with ice-cold PBS and fixed with 70% ethanol at 4 °C 30 min. Then cells were stored at –20 °C for 24 h, then washed with PBS and stained with 0.02 mg/mL PI, 0.1% v/v Triton X-100 and 0.2 mg/mL DNase-free RNase A in PBS. After 30 min incubation at room temperature in the dark, cells were analyzed by flow cytometer FACS Canto-2. Percent of cells in each cell cycle phase was analyzed and calculated using kaluza software, version 2.2.1 (https://www.beckman.co.il/ru/flow-cytometry/software/kaluza).

Synchronization of the cell cycle of the HeLa H1.5-mCherry line was carried out using a double thymidine block with subsequent analysis of the distribution of the cell population over the phases of the cell cycle at different time points after the removal of the thymidine block by analyzing immunofluorescently stained cells on a flow cytometer.

HeLa_H1.5-mCherry was seeded in 6-well plates (50,000 cells per well) with a 22 $\times$ 22 mm coverslip for microscopy. After 24 hours, to synchronize the cells in the S phase, the cells were treated with thymidine (final concentration 2 µM), incubated for 14–16 hours, then the cells were washed twice with PBS, culture medium was added, and incubated for 6–10 hours. Cells were then washed twice with PBS and treated again with thymidine. Cells were treated with compounds of interest for 1 hour and then incubated for 20 minutes with EdU (20 µM): for S-phase fixation after 15 hours, for G2/M-phase fixation after 21 hours, for G1-phase fixation after 29 hours.

To identify cells in certain cell phases after the above cell line treatments cells were washed twice with PBS and fixed in 4% paraformaldehyde at room temperature for 15 min. After three washes, they were permeabilized with Triton-100 for 7 min at room temperature and blocked with bovine serum albumin for 1 h. Then S-phase labeling was carried out in a fast, highly-specific click reaction (Invitrogen™Click-iT™ EdU Cell Proliferation Kit, Waltham, MA, USA). To mark the G2/M phase, immunofluorescent staining of cells with antibodies to cyclin B1 (Invitrogen cat#MA5-13128, Waltham, MA, USA) and subsequent binding with secondary antibodies AlexaFluor647 (Abcam cat#150115, Cambridge, UK) were performed in darkness. Thus, cells in S-phase had a phenotype (EdU+, cyclin B1–), cells in G2/M-phase had a phenotype (EdU–, cyclin B1+). The absence of both markers (EdU–, cyclin B1–) made it possible to identify cells in the G1/G0 phase. The nucleus was stained with DAPI. The coverslips were mounted on the glass slides using Mowiol mounting medium. Images were obtained with a Zeiss Axio Observer A1 inverted microscope with N-Achroplan 100$\times$/1.25 oil lens, Zeiss MRC5 camera, and AxioVision Rel.4.8 software. Experiments were performed three times. 200 cells were analized for each point. Image analyses and quantitification was done using ImageJ.

We compared data of the treatments and controls using one-way analysis of variance (ANOVA) and Dunnett’s post hoc test. Differences between groups were considered to be significant at a p value of 0.05. Statistically significance of the differences of the histone contents in nucleoli and intermediate position in cell nucleos was by Pearson’s chi-squared test. Statistical analyses were performed using GraphPad Prism 8.3.0 (GraphPad Software Inc., San Diego, CA, USA).

We wanted to use non-toxic concentration of PSMs, and before studying the effects of PSMs on the chromatin structure we measured their cytotoxicity using resazurin assay. IC50 and IC20 were determined from the fit curves to dose-response data (Table 1, Supplementary Fig. 1). IC0 was determined as a maximal non-toxic concentration, at which an alive cell proportion was higher than 95% that was controlled by flow cytometry using PI/annexin staining and trypan blue dye exclusion test. Fluorescent activity of all the PSMs was checked not to have any interference with signals of proteins or antibodies tagged by fluorophores (Supplementary Table 1, Supplementary Fig. 2). All the studied PSMs are DNA-binding compounds, and taking into account the cultural medium volume to calculate the amount of the compound added and the number of cultured cells to calculate the amount of nuclear DNA in the sample, we estimated maximal achievable compound per base ratio (CPBR), however, interactions of PSMs with different proteins were ignored in the calculations. Among 15 PSMs analyzed in our study delphinidin is the only one to demonstrate good solubility in water solutions (Supplementary Fig. 3). The rest 14 PSMs were dissolved in organic solvents (DMSO or ethanol) and added to the reaction mixture or cultural medium of HeLa cells at the concentrations not affecting the studied processes. Final concentrations of the solvents in the cultural medium are also provided in Table 1.

Thus, we demonstrated that all PSMs studied may cause cytotoxic effect and determined maximal non-toxic and IC20 concentrations, which were used in our further study of PSM effects on chromatin structure in cultured HeLa cells.

The study of molecular effects caused by PSMs on nucleosome stability was performed using three alternative approaches: (1) analysis of DNA cleavage products of chromatin treatment with micrococcal endonuclease; (2) microscopy of cells with fluorescently labeled H2B histone using HeLa SSRP1-GFP H2B-mCherry cells; (3) measurement of the content changes of the FACT histone chaperone subunits in the nucleoplasm and chromatin-bound protein fractions of HeLa cells using Western blotting.

Linker histones H1.2 and H1.4 are involved in the regulation of the cell cycle. In particular, linker histone H1.2 depletion induced in T47D cells by shRNA-mediated knockdown was shown to cause cell arrest in the G1 phase and inhibit cell proliferation [41]. In addition, in CBL0137 treatment of the cells of breast cancer and hematological malignancies showed significant changes in cell cycle progression [42, 43].

PSM influence on cell cycle in HeLa cells was studied for the compounds berberine, naringenin, curcumin, which produced the most significant redistribution of the linker histones H1.5, H1.2 and H1.4. HeLa cells were treated with PSMs at the concentrations IC20 (for 24-hour treatment, Table 1) for 1-hour and then cell populations were analyzed by flow cytometry. Modified thymidine analogue EdU efficiently incorporated into DNA was fluorescently labeled with the bright, photostable dye Alexa Fluor488 in a fast, highly-specific, mild click reaction to detect cells with active DNA synthesis. To mark the G2/M phase, we performed immunofluorescent staining of cells with antibodies to cyclin B1 and then the secondary antibodies AlexaFluor647. Treatment of HeLa cells with CBL0137 caused a significant decrease of the cell proportions (EdU+, cyclin B1–) and (EdU+, cyclin B1+), correspondingly to 0.79% and 0.15% versus 42.10% and 11.95% in the control and increase of the cell proportion (EdU–, cyclin B1–) and (EdU–, cyclin B1+) to 79.20% and 20.53% versus 37.27 $\pm$ 4% and 8.57% in the control (Fig. 4A, Supplementary Fig. 5).

Cell treatment with curcumin leads to less intensive but also significant reduction in proportions of the cells incorporating EdU, both cyclin B1– and cyclin B1+, and enlargement of proportions of the cells not incorporating EdU also cyclin B1– and cyclin B1+. Proportions of cells which did not incorporate EdU and both expressing and not expressing cyclin B1 significantly changed ubder influence of all PSMs analysed in this experiment. In particular, after the cell treatment with berberine proportion of cells (EdU–, cyclin B1–) was 42.67%, with curcumin—50.33%, and with naringenin—43.67% against 37.27% in the control cell population. In the untreated cell population, the proportion of cells (EdU–, cyclin B1+) was 8.57%, and it increased after the treatment with with berberine, curcumin, and naringenin up to 15.17%, 12.93% and 12.67%, correspondingly (Fig. 4A, Supplementary Fig. 5).

Significant changes in the proportion of cells incorporting EdU within just 1-hour PSM treatment revealed a decrease in DNA synthesis, and PSM effects were similar to those of CBL0137, although less pronounced.

Analyzing the cell cycle distribution after 1-hour treatment with CBL0137 using PI staining, we observed a statistically significant increase in the proportion of cells in the G1 phase: (55.04%) relative to control (48.73%), and a statistically significant decrease in the proportion of cells in G2/M: phase: (23.18%) compared to control (31.59%). Under naringenin treatment we observed a statistically significant increase in the proportion of cells in S phase (16.75%) relative to control (13.28%) and decrease in G2/M (25.10%) compared to control (31.59%) (Fig. 4B, Supplementary Fig. 6).

Analysis of cell cycle distribution after 24 hours cell treatment with compounds in non-toxic and IC20 concentration using PI staining showed a statistically significant reduction in the proportion of cells in the G1 phase after the treatment with CBL0137 at concentrations of 0.5 µM (28.77%) and 0.75 µM (18.77%) and after the treatment with curcumin at the IC20 concentration (34.18%) relative to control (48.73%). We demonstrated a statistically significant decrease in the proportion of cells in S phase (7.75%) after the treatment with CBL0137 at the concentrations of 0.5 µM (7.00%), 0.75 µM (7.63%) and PSMs: curcumin IC20 (7.74%), berberine IC0 (8.45%), berberine IC20 (6.10%) relative to untreated cells (13.28%) and a statistically significant increase in the proportion of cells in G2/M phase after the treatment with 0.5 µM CBL0137 (54.70%), 0.75 µM CBL0137 (56.81%), berberine IC20 (43.25%) and curcumin IC20 (49.72%) compared to control (31.59%) (Fig. 4C, Supplementary Figs. 5,7).

Causing linker histone depletion from chromatin, PSMs should influence the degree of DNA packaging. The process of DNA packaging depends on the phase of the cell cycle, and we propose that the effect of PSMs may be different depending on the stage of the cell cycle, at which the treatment occurs. To clarify it, we analyzed the effect of berberine, one of the most active PSM, which induced linker histone H1.5 depletion up to 85% after the only 1-hour treatment, and it also influences proportions of the cells in other cell cycle phases. Immunostaining of the cells and the result interpretation were performed analogous to the analysis at the previous part of the study on the PSM influence on cell cycle progression. Synchronization of the cell cycle of the HeLa H1.5-mCherry cells was performed using a double thymidine block. Since the double thymidine block should lead to cell cycle arrest before S-phase, its removal should be followed by an increase in the number of cells in S-phase compared to the unsynchronized population. Subsequent flow cytometry analysis of the cell population distribution by cell cycle phases after the different periods following the removal of the thymidine block confirmed the enrichment of cell proportions at the different cell cycle phases. Cell cycle distributions were analyzed using EdU-based S-phase detection and cyclin B1-based G2/M-phases detection. The cells without both markers (EdU–, cyclin B1–) were attributed to the G1/G0 phases. According to the data obtained, a significant increase in the proportion of cells in the corresponding phases of the cell cycle was obtained compared to the unsynchronized culture. In particular, after removal of the double thymidine block, the proportion of cells in the S-phase was up to 91 $\pm$ 7%, which is more than 2 times higher than that of the unsynchronized culture (42 $\pm$ 5%). 6 hours after the removal of the double thymidine block, the cells should pass into the G2/M phase, and indeed, their proportion was up to 48 $\pm$ 4%, in contrast to the corresponding cell portion of the unsynchronized culture—7.5 $\pm$ 1.2%. And finally, 14 hours after the removal of the double thymidine block, mitosis should already occur and the cells should go into the G1/G0 phase. In the synchronized cell culture, 14 hours after the removal of the thymidine block, the proportion of cells in the G1/G0 phase was up to 79 $\pm$ 9%, while in the unsynchronized culture it was 37 $\pm$ 3% (Fig. 5A–C).

We have shown that linker histone H1.5 translocation to the nucleoli after the treatment with berberine for occurred at each of the cell cycle phases: G1/G0, S, G2/M, and G2. Thus, no significant changes of berberine effect on the linker histone H1.5 localization depending on the cell cycle phase were found (Fig. 5D).