Human embryonic lung fibroblasts (HELF) (the fourth cell passage) provided by the Research Centre for Medical Genetics Biobank were used in experiments. Cell lines were validated by short tandem repeat profiling (STR) profiling and tested negative for mycoplasma.

Cells were cultured at 37 °C in Dulbecco’s Modified Eagle Medium (DMEM) medium (PanEco, Moscow, Russia) with 10% (v/v) fetal calf serum (PAA, Vienna, Austria), 2 mM L-glutamine (PanEco, Moscow, Russia). The medium contained 100 µg/mL of streptomycin, 100 units/mL of penicillin and 10 mg/mL of gentamicin (all reagents were obtained from Sigma-Aldrich, St. Louis, MO, USA). Cells were grown in a humidified atmosphere containing 5% CO₂ at 37 °C. After the functionalized fullerenes were added to the medium, the cells were incubated in 96-well plates for time intervals ranging from 1 hour to 72 h.

The study has been granted ethical approval by the Institutional Review Board of the Research Center for Medical Genetics, in accordance with protocol number N.5.

For flow cytometry analyses (FCA) the cells were washed in Versene solution (Thermo Fisher Scientific, Waltham, MA, USA), and 0.25 % trypsin (Paneco, Moscow, Russia) under Axio Scope A1 microscope (Carl Zeiss, Oberkochen, Germany) observation. Cells were washed with culture media, then resuspended in Phosphate-Buffered Saline (PBS) (pH 7.4) (Paneco, Moscow, Russia) and centrifuged. Paraformaldehyde (Sigma-Aldrich, St. Louis, MO, USA) was added at a final concentration of 2% at 37 °C for 10 min to fix the cells. Then cells were washed with 0.5% Bovine Serum Albumin (BSA)-PBS (PanEco, Moscow, Russia) ($\times$3) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, St. Louis, MO, USA) in PBS for 15 min at 4 °C. Cells (~50 $\times$ 10³) were washed with 0.5% BSA-PBS and treated with conjugated antibodies (1 µg/mL) for 2 h at 20 °C, then again washed with 0.5% BSA-PBS. Finally, cells were analyzed in CyFlow Space (CytoFlex S; Beckman Coulter, Pasadena, CA, USA).

The following antibodies were used: CY5.5-NADPH oxidase 4 (NOX4) (bs-1091r-cy5-5, Bioss Inc., Woburn, MA, USA); NF-E2-related factor 2 (NRF2) pSer40 (bs2013, Bioss Inc.); PE-8OHdG (sc-393871 PE, Santa Cruz, Dallas, TX, USA); DyLight488-$\gamma$H2AX (pSer139) (nb100-78356G NovusBio, Saint Louis, CO, USA); Fluorescein Isothiocyanate (FITC)-BRCA1 (NB100-598F NovusBio, Saint Louis, CO, USA); A350-BCL2 (bs-15533r-a350, Bioss Antibodies Inc. Woburn, MA, USA); BAX (Nb120-7977, NovusBio, Saint Louis, CO, USA); secondary mouse anti-rabbit IgG-FITC (sc-2359, Santa Cruz).

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) tetrazolium reduction assay was used to assess cell viability. The details of the MTT-test are described earlier in [35].

Quantitation of ROS was assessed using 2^′,7^′-dichlorodihydrofluorescein diacetate (H2DCFH-DA) (10 µM in PBS) (Molecular Probes/Invitrogen, Carlsbad, CA, USA). After 8 $\times$ 10³ cells in 96-well plates were incubated with F1 and F2. Cells from each well were washed with phosphate-buffered saline and the total fluorescence was analyzed at $\lambda$ex = 503 nm and $\lambda$em = 524 nm (EnSpire Equipment, Turku, Finland) at 37 °C 10 times at 5 min intervals. Then the ratio ki/k0 was calculated, where ki and k0 are the rate constants of ROS formation in the presence of fullerene and in the control, respectively.

Fluorescence images were obtained using Axio Scope A1 microscope (Carl Zeiss, Oberkochen, Germany) according to the standard procedure as described earlier [35].

Expression levels of the genes BCL2, CCND1, CDKN2A, BRCA1, BAX, NFKB1, NOX4, NRF2, TBP (reference gene) were measured using real-time PCR. The following primers were used (Syntol, Moscow, Russia):

BCL2 (TTTGGAAATCCGACCACTAA; AAAGAAATGCAAGTGAATGA);

CCND1 (TTCGTGGCCTCTAAGATGAAGG; GAGCAGCTCCATTTGCAGC);

CDKN2A (ATGGAGCCTTCGGCTGACT; GTAACTATTCGGTGCGTTGGG);

BRCA1 (GGCTATCCTCTCAGAGTGACATTTTA; GCTTTATCAGGTTATGTTGCATGGT);

BAX (CCCGAGAGGTCTTTTTCCGAG, CCAGCCCATGATGGTTCTGAT);

NFKB1 (CAGATGGCCCATACCTTCAAAT; CGGAAACGAAATCCTCTCTGTT);

NOX4 (TTGGGGCTAGGATTGTGTCTA; GAGTGTTCGGCACATGGGTA);

NRF2 (TCCAGTCAGAAACCAGTGGAT; GAATGTCTGCGCCAAAAGCTG);

TBP (reference gene) (F: GCCCGAAACGCCGAATAT, R: CCGTGGTTCGTGGCTCTCTCT).

RNeasy Mini Kit (Qiagen, Hilden, Germany) was used for isolation of total mRNA. RNA samples were treated with DNase without RNase activity (Silex, Moscow, Russia) to remove the DNA contamination.

RNA concentrations were determined with the help of the dye Quant-iT RiboGreen RNA reagent (MoBiTec, Goettingen, Germany) using a plate reader (EnSpire equipment, Finland) ($\lambda$excit = 487 nm, $\lambda$flu = 524 nm). The reverse transcription reaction was carried out using reagents supplied by Silex (Moscow, Russia) according to the standard procedure. PCR was carried out using the corresponding primers (Syntol, Moscow, Russia) and the intercalating dye SybrGreen using StepOnePlus instrument (Applied Byosystems, Foster City, CA, USA).

All reported results were reproduced at least three times as independent biological replicates. All statistical analyses were performed using StatPlus2007 software (AnalystSoft Inc., Walnut, CA, USA). The significance of the observed differences was analyzed using non-parametric Mann-Whitney U-tests. All p values considered statistically significant at p 0.01 and are marked with “*” in the figures.

Cytotoxicity of the studied compounds towards the normal human cells – human embryonic lung fibroblasts (HELF) was estimated using MTT test. We studied effects of water–soluble derivatives of fullerenes F1 and F2 on HELF in concentrations 4.2 ng/mL–2.3 mg/mL. Fullerenes were added to the medium at the beginning of HELF cultivation. The duration of cultivation was 72 hours. Both compounds F1 and F2 did not produce any significant cytotoxic effect on the HELF at a concentration of 4.2 ng/mL–0.5 mg/mL, at a concentration of 0.5 mg/mL–2.3 mg/mL F1 and F2 have a damaging effect on cells, causing the death of more than 20% of cells.

As a result of the analysis of the fluorescent properties of the studied water-soluble fullerene derivatives, it was found that both compounds, F1 and F2 have their own fluorescence in aqueous solutions and cell culture medium. When scanning the excitation spectrum of aqueous solutions of fullerene derivatives (excitation wavelength in the range of 230–600 nm with an emission wavelength of 500 nm), an excitation maximum was detected for the studied compounds at a wavelength of 340 nm. When removing the fluorescence spectrum of the studied compounds at an excitation wavelength of 340 nm, a common emission maximum of 520 nm was also found for these compounds. The fluorescence of the compounds was used to analyze their penetration and localization in cultured human lung embryonic fibroblasts (HELF). Fluorescence signals in cells incubated for 1, 3, 24, and 72 hours with the addition of compounds F1 and F2 were detected during the study of fluorescence in unfixed HELF on a flow cytofluorimeter irradiated with a laser with a wavelength of 370 nm. The fullerene fluorescence signal in cells increases with increase of cultivation time in the presence of fullerene derivatives and reaches a maximum after 24 hours (Fig. 1B). Fluorescence microscopy confirms flow cytofluorometry data obtained in the study of the penetration of F1 and F2 compounds into the cells (Fig. 1B–D).

Thus, we have shown that fluorescence of compounds F1 and F2 allowing the study of their penetration into the cells. It was found that both compounds quickly penetrate through the HELF cytoplasmic membrane—the fluorescence of these compounds in the cells is detected 1–3 hours after addition, in consequent 24 hours the fluorescent signal increases and remains at high level after 72 hours (Fig. 1D).

To study the effects on embryonic fibroblasts, two concentrations of each compound were selected—low, within the range of non–toxic fullerene concentrations—18 ng/mL, and a concentration close to damaging—122 µg/mL, incubation time of cells with compounds—1, 3, 24 and 72 hours. Changes in all values are present in relative units (relative to the control cells cultured without fullerenes).

Most fullerene derivatives demonstrates antioxidant properties in solutions, however, in the living cells interaction of fullerene derivatives with reactive oxygen species (ROS) is more complex. Although most of the water-soluble fullerene compounds can bind ROS, at the same time, the process of free radical synthesis in the cell can start, neutralizing ROS level decrease by fullerene derivatives. In a living cell, ROS are formed in the cytoplasm, on the surface of the cellular membrane and in the nucleus. In addition, cells produce hydrogen peroxide molecules in the intercellular medium. ROS are involved in many cellular processes, such as proliferation, apoptosis and intercellular signaling. On the other hand, excessive ROS synthesis by the cell because of disruption of intracellular processes and/or external exposure can cause cell death or cell damage. The change in the ROS level in cells is the result of the difference in the free radical synthesis activation after exposure to fullerenes and the free radicals binding by the studied compounds.

To assess the level of ROS synthesis occurring in living cells after interaction with compounds F1 and F2 we used H2DCFH-DA (dichlorodihydrofluorescindiacetate), a dye that quickly penetrates cell membranes. In the cytosol, this dye is hydrolyzed to non-permeable 2^′,7^′-dichlorodihydrofluorescein (DCFH) by cell hydrolases. Non-fluorescent DCFH is a sensitive intracellular marker of oxidative stress, oxidized to intensely fluorescent 2^′,7^′-dichlorofluorescein (DCF) in the presence of ROS.

When fullerene derivatives F1 and F2 were added to cells at concentration 122 µg/mL, a slight ROS level decrease was observed after 1 hour, ROS level increase (by about 10–20%) after 3 hours (which remained elevated during incubation of cells with F1 and F2 compounds for 24 hours), and significant ROS level increase 72 hours after F1 and F2 additions to the cells (Fig. 2A). Probably, fullerene derivatives F1 and F2 added to the cell culture medium at high concentrations work as free radical acceptors, but over time, free radical synthesis activates in the cells, leading to the ROS level increase after 3–72 hours of cultivation in the presence of these compounds.

Fig. 2.

Reactive Oxygen Species (ROS) synthesis level and the expression of genes in HELF following the addition of fullerenes. (A) 2^′,7^′-dichlorofluorescein (DCF) fluorescence in cells during incubation with F1 (left), and F2 (right) fullerenes at concentration 122 µg/mL and 18 ng/mL (control cells were cultured without fullerenes) after 1, 3, 24, 72 hours of incubation. (*) – significant differences compared to control cells, p 0.01, nonparametric U-test. (B) NOX4 gene expression in HELF treated with F1 (left) and F2 (right) in indicated concentrations relative to the control values (for the cells cultured in the absence of fullerenes). The amount of NOX4 RNA is the average value (for three experiments) of NOX4 gene expression in the presence of fullerene derivatives relative to the control values of NOX4 gene expression. The TBP gene was used as the internal standard gene. (*) – significant differences compared to control cells, p 0.01, nonparametric U-test. (C) level of NADPH oxidase 4 (NOX4) protein in cells (HELF) incubated with F1 (left) and F2 (right) at the concentration indicated in the figure. The method of flow cytofluorimetry. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (D) NRF2 gene expression in cells (HELF) under the action of F1 (left), and F2 (right) at the concentration indicated in the figure. The amount of NRF2 RNA is the average value (three experiments) of the NRF2 gene expression in the presence of fullerene derivatives relative to the control values of NRF2 gene expression. The TBP gene was used as the internal standard gene. (*) – significant differences with control cells (cultured in the absence of fullerenes), p 0.01, nonparametric U-test. (E) level of the phosphorylated form of the NF-E2-related factor 2 (NRF2) protein in HELF under the action of F1 (left), and F2 (right) at the concentrations indicated in the figure relative to the control values. (*) – significant differences with control cells, p 0.01, nonparametric U-test. FL, fluorescence.

However, low fullerene derivatives F1 and F2 concentrations have the opposite effect on the ROS level compared to high concentrations of these compounds. When F2 is added to the cells at a concentration of 18 ng/mL, there is a tendency to increase of the ROS level by 5–12% after 1–3 hours, after 24 hours the ROS level decreases below the control level, and after 72 hours this decrease becomes significant. When F1 is added to cells at a concentration of 18 ng/mL, there is a tendency to increase of the ROS level by 5–7% after 1 hour, and after 24–72 hours ROS level significantly decreases (Fig. 2A).

Possibly ROS level increase by high fullerenes concentration can be explained by the ROS synthesis stimulation, neutralizing the free radicals binding by fullerene derivatives. The ROS generation by mitochondria occurs during ATP synthesis as a byproduct of oxidative phosphorylation. However, neither compound F1 nor F2 induced an increase in mitochondrial potential in the cells examined by flow cytofluorimetry and fluorescence microscopy.

NADPH oxidases also produce physiological amounts of ROS in the cells. NOX4 is one of NADPH oxidases expressed in fibroblasts; its expression is regulated at the gene level. We studied NOX4 expression at the level of gene and protein after exposure of the cells to F1 and F2.

When fullerene derivatives F1 and F2 are applied to the cells at a concentration of 122 µg/mL, NOX4 expression in cells increases 1.5–3.7 fold at the gene level after 1–72 hours, and at the protein level 3–24 hours after the start of incubation with compounds (Fig. 2B,C). A significant NOX4 protein expression increase during incubation of cells with the studied compounds in concentration 122 µg/mL may explain the ROS level increase in cells 24–72 hours after the addition of these compounds to the cells.

Thus, after 1–72 hours of cultivation in presence of high F1 and F2 concentrations, an increase in the NOX4 gene and protein expression is observed, leading to increased ROS synthesis and possible damaging effect development in the cells. An addition of NOX4 inhibitors to the fullerenes during incubation may possibly prolongate their antioxidant effect.

The transcription factor NRF2 participates in the regulation of the antioxidant response of cells. It was found that NRF2 gene expression increases 2–2.5 fold only 24–72 hours after F1 and F2 fullerene derivatives addition at a concentration of 18 ng/mL to the cell culture medium. When fullerene derivatives F1 and F2 are used in concentration 122 µg/mL, the expression of NRF2 gene, on the contrary, decreases after 24 hours of incubation (Fig. 2D).

The expression of phosphorylated form of NRF2 protein (phNRF2) increases 24 hours after the addition of F1 and F2 fullerene derivatives to the cell culture medium at a concentration of 18 ng/mL, apparently due to the translation amplification. We also observed a 2-fold increase in the phosphorylated NRF2 protein level already 1 hour after F1 and F2 fullerene derivatives addition to the cell culture medium at concentration 18 ng/mL (Fig. 2E). It is most likely due to the NRF2 release from NRF2 deposited in cells in association with KEAP1.

When fullerene derivatives F1 and F2 are added to the cells at a concentration of 122 µg/mL, the phosphorylated NRF2 also increases 1.5–2.5 fold after 1 hour (Fig. 2E), confirming that NRF2 factor activity in cells rapidly after fullerenes addition is most probably associated with the release from protein complexes and by phosphorylation of NRF2 deposited in cells. When fullerene derivatives F1 and F2 are added to the cells at a concentration of 122 µg/mL, NRF2 gene expression decreased after 24 hours of incubation, which is proportional to the change in the expression of the phNRF2 protein (Fig. 2D,E).

Thus, the antioxidant effect of fullerenes on cells is a result of the combined effect of the free radicals binding, ROS synthesis induction, and the transcription factor NRF2 modulation, which regulates the expression of antioxidant defense genes in cells. Observed ROS level decrease in the presence of low fullerenes concentrations 24 hours after an early ROS levels increase is most likely explained by NRF2 gene expression increase. At the same time, an increase in ROS level in the presence of high fullerene derivatives concentrations found after 24 hours incubation is associated with the absence of NRF2 gene transcription activation.

The change in the transcriptional activity of the NFR2 gene is often inversely proportional to the activation of the NFKB1 gene transcription. Transcription factor NF-$\kappa$B translocates into the nucleus and triggers the NF-$\kappa$B signaling pathway in response to external conditions, leading to the synthesis of several cytokines, adhesion molecules, and factors promoting cell survival. NFKB1 gene expression increases 1.5–1.8 fold only 24 hours after the addition of F1 and F2 fullerene derivatives to the cell culture medium at a concentration of 122 µg/mL. 24 hours after the addition of F1 and F2 fullerene derivatives to the cell culture medium in concentration 18 ng/mL, NFKB1 gene expression decreases (Fig. 3A). This is indeed inversely proportional to the change in the NRF2 gene expression. Each experiment was replicated at least 3 times in three or more independent experiments.

Fig. 3.

The expression of genes in HELF following the addition of fullerenes. (A) The expression of NFKB1 gene in cells (HELF) incubated with F1 (left) and F2 (right) at the concentrations indicated in the figure. The amount of NFKB1 RNA is the average value (for three experiments) of the NFKB1 gene expression in the presence of fullerene derivatives relative to the expression of the NFKB1 gene in the control cells. We used TBP as the internal standard gene. (*) – significant differences with control cells (cultured in the absence of fullerenes), p 0.01, nonparametric U-test. (B) Histograms of the distribution of medians of the values of the signals of the DNA oxidation marker (8oxodG) in HELF incubated with F1(left) and F2 (right) at the concentrations indicated in the figure relative to the control values. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (C) Histograms of the distribution of median values of the phosphorylated form of histone H2AX in HELF incubated with fullerenes F1 (left) and F2 (right) at concentrations indicated in the figure relative to the control values. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (D) The expression of the BRCA1 gene in cells (HELF) incubated with F1 (left) and F2 (right), at the concentration indicated in the figure. The amount of BRCA1 RNA is the average value (three experiments) of the expression of the BRCA1 gene in the presence of fullerene derivatives in relation to the expression of the BRCA1 gene in the control (cells cultured in the absence of fullerenes). We used TBP as the internal standard gene. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (E) Histograms of the distribution of median values of BRCA1 protein signals in HELF incubated with F1 (left) and F2 (right) at concentrations indicated in the figure relative to control values. (*) – significant differences with control cells, p 0.01, nonparametric U-test. Each experiment was replicated at least 3 times in three or more independent experiments.

Since we found the ROS synthesis after adding new water-soluble fullerene derivatives to the HELF, possibly, free radicals produce a damage to the cells. The water-soluble fullerene derivatives damaging effect on the cells can be detected as oxidative modifications and as the nuclear DNA breaks. We studied oxidative damage produced by compounds F1 and F2 to the DNA of fibroblast nuclei. 1 hour after fullerene F1 derivative is applied to the cells at concentration 18 ng/mL, the level of oxidative DNA modifications (8-Oxo-2^′-deoxyguanosine or 8oxodG) increases 2.5–3 fold compared to the control, after 3–72 hours the level of the DNA oxidation marker (8oxodG) in the cells decreases (Fig. 3B).

When fullerene derivative F1 is applied to the cells at concentration 122 µg/mL, 8oxodG increases 3 fold after 3 hours and remains elevated 1.5–2 fold for 72 hours (Fig. 3B). F2 at concentration 18 ng/mL 3 and 24 hours after its addition to the cells increases 8oxodG 1.5–2.5 fold, after 72 hours oxidative DNA modifications decreases below the control values (Fig. 3B). When fullerene derivative F2 is added to the cells at concentration 122 µg/mL, the level of 8-oxodG increases after 3 hours, and after 24–72 hours it increases 2–2.5 fold (Fig. 3B).

An increase in the level of 8oxodG can cause the formation of DNA breaks. One of the methods for double-strand DNA breaks detection is based on the phosphorylation of the serine 139 residue in the conservative histone protein involved in DNA chromatin packaging (H2AX) with the participation of ATM, ATR, and DNA-PK kinases. Phosphorylated histones $\gamma$H2AX associated with labeled antibodies are detected in the cell nucleus; their accumulation in large quantities indicates an increase in the level of double-strand DNA breaks in the cell nuclei.

Using the flow cytofluorometry method (comparing median distributions), it was shown that 1 hour after fullerene F1 derivative addition to the cells at concentration 18 ng/mL, the level of double-strand DNA breaks increased 1.7–1.8 fold compared to the control, correlating with an increased level of oxidative DNA modifications. After 3, 24 and 72 hours we observed a tendency of double-strand DNA breaks decrease below control values (Fig. 3C). 3 hours after addition to the cells in concentration 122 µg/mL F1 induces 1.4–1.5-fold increase of double-strand DNA breaks level compared to the control, that saves a tendency to be elevated after 24 and 72 hours. Compound F2 at concentration of 18 ng/mL increases the level of double-strand DNA breaks 3 hours after its addition to the cells, after 24–72 hours - reduces the double-strand breaks level; F2 at concentration of 122 µg/mL increase in the level of double-strand DNA breaks 24 hours after addition to the cells culture medium (Fig. 3C).

In response to DNA damage we found an activation of genes involved in the DNA repair processes. Among them BRCA1 gene plays a pivotal role. Using real-time PCR and flow cytofluorimetry (comparing median distributions), it was shown that when fullerene F1 derivative was applied in concentration 18 ng/mL 1 hour after its addition BRCA1 gene and protein expression increased 2–2.5 fold compared to the control. Increased BRCA1 gene and protein expression persisted until the end of observation (up to 72 hours), explaining the decrease in double-strand breaks 24–72 hours after F1 fullerene addition at concentration of 18 ng/ml to the cells (Fig. 3D,E). When the fullerene F1 derivative is used in concentration 122 µg/mL, BRCA1 gene and protein expression also increases 1.5–2 fold 3–24 hours after its addition to the cells (Fig. 3D,E).

Compound F2 in concentrations 18 ng/mL and 122 µg/mL 3–24 hours after its addition to the cells causes an increase in the expression of the BRCA1 gene and protein 1.5 fold after 3–72 hours (Fig. 3D,E). Possibly, an increase in the level of expression of genes and proteins involved in the repair processes in response to DNA breaks produced in the cells neutralizes the negative impact of compounds after their addition to the cells.

DNA breaks in the cells can be repaired by the cell cycle arrest. In addition, cells can activate a program of programmed cell death (apoptosis). Using the MTT test, we did not find an increase in the proliferative activity of HELF in the presence of F1 and F2 compounds at concentrations of 18 ng/mL. In concentrations 122 µg/mL these compounds reduced the number of cells in the population by about 20%.

We investigated the effect of compounds F1 and F2 on the genes regulating the cell cycle. With the cell cycle progression, the cyclin D1 protein synthesis is activated, encoded by the CCND1 gene. Cyclin D1 plays a key role, regulating the transition of cells from the G1 phase of the cell cycle to the S phase. Inhibitors of cyclin-dependent kinases belong to the regulators of the cell cycle. The p21 kinase inhibitor has a negative effect on the activity of cyclin-dependent kinase (CDK) complexes in the G1 phase of the cell cycle, an increase in the expression of the p21 gene (CDKN1A gene) can lead to G1 arrest. A complex system of regulation of the genes of the cell cycle leads either to its progression or to its inhibition.

1 hour after fullerene F1 derivative addition to the cell culture medium in concentration 18 ng/mL, we observed a short–term decrease of CCND1 gene expression and an increase in CDKN1A and CDKN2 gene expression. It may reflect short-term G1 arrest of cells observed during the activation of repair genes, and contribute to a decrease in the level of double-strand DNA breaks (Fig. 4A–C). 3–24 hours after exposure of the cells to the fullerene F1 derivative in concentration 18 ng/mL, the cell cycle progression continues.

Fig. 4.

The expression of genes in HELF following the addition of fullerenes. (A) Expression of CCND1 gene in cells (HELF) after addition of F1 (left), and F2 (right), at the concentrations indicated in the figure. The amount of CCND1 RNA is the average value (for three experiments) of CCND1 gene expression in the presence of fullerene derivatives relative to CCND1 gene expression in the control. The TBP gene was used as the internal standard gene. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (B) Expression of CDKN2 gene in cells (HELF) under the action of F1 (left), and F2 (right) at the concentrations indicated in the figure. The amount of CDKN2 RNA is the average value (for three experiments) of CDKN2 gene expression in the presence of fullerene derivatives relative to CDKN2 gene expression in the control. The TBP gene was used as the internal standard gene. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (C) Expression of CDKN1 gene in cells (HELF) under the action of F1 (left), and F2 (right) at the concentrations indicated in the figure. The amount of CDKN1 RNA is the average value (three experiments) of CDKN1 gene expression in the presence of fullerene derivatives relative to CDKN1 gene expression in the control. The TBP gene was used as the internal standard gene. (*) – significant differences with control cells, p 0.01, nonparametric U-test. (D) Ratio of the expression of anti-apoptotic protein B-cell lymphoma 2 (BCL2) to pro-apoptotic Bcl-2 associated X protein (BAX) in HELF cell culture under the action of F1 (left), F2 (right) at the concentrations indicated in the figure, (*) –significant differences with control cells, p 0.01, nonparametric U-test. Each experiment was replicated at least 3 times in three or more independent experiments.

Similarly, when the fullerene derivative F2 is applied at concentration of 18 ng/mL, a short-term decrease in CCND1 gene expression and an increase in CDKN1 and CDKN2 genes expression is found 3 hours after addition of the compound to the cell culture medium, possibly indicating a short-term G1 arrest observed during repair genes activation (Fig. 4A–C).

When F1 and F2 compounds are added to the cells at concentration of 122 µg/mL for 72 hours, we observed no changes in the RNA level of CCND1, CDKN1 and CDKN2 genes (Fig. 4A–C).

The change in the number of cells in a population depends both on the progression of the cell cycle and the apoptosis. We investigated the effect of F1 and F2 compounds on the expression of pro-apoptotic (BAX) and anti-apoptotic (BCL2) genes. The most adequate and frequently used ratio of the expression of the anti-apoptotic protein BCL2 to the pro-apoptotic BAX indicates a decrease in the level of apoptosis in the cell population.

3 hours after fullerene derivatives F1 and F2 are added in concentration 18 ng/mL, an increase in the expression of the anti-apoptotic protein BCL2 is observed compared to BAX, while the ratio BCL2/BAX increases 2–2.5 fold (Fig. 4D). It indicates a short-term inhibition of apoptosis and reflects an increase in the number of cells in the early cultivation stages produced by these compounds in nanomolar concentration.

1 hour after F1 and F2 compounds are added to the cells at concentration 122 µg/mL, the BCL2/BAX ratio increases 1.5–2 fold, and after 3–72 hours the BCL2/BAX ratio returns back to the control level.