Kidney specimens of seven patients (four males, three females; 57.7 $\pm$ 9.1 years of age (mean $\pm$ s.d.); four ADPKD patients and three renal cell carcinoma patients with relatively normal renal tissue) were obtained from Changzheng Hospital, Shanghai, China. Three patients were receiving hemodialysis at the time of nephrectomy, thus representing rather late stages of ADPKD. Collection and analysis of tissue samples were approved by the local ethics committee. This study was conducted in accordance with the Declaration of Helsinki.

Animal experiments were approved by the local institutional review board for the care of animals and were performed in accordance with National Institutes of Health guidelines. PKD1${}^{\mathit{\text{RC/RC}}}$ mice (provided by Dr. Peter Harris) were housed on a 12:12-h light–dark cycle under constant temperature (24 $\pm$ 1.1 °C) in standard cages, fed with a standard diet, and had free access to tap water in Mayo Clinic experimental animal center.

Madin-Darby canine kidney (MDCK) cells, inner-medullary collecting duct (IMCD3) cells, PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$cells and GANAB cells (from the lab of Dr. Peter Harris) were grown on glass coverslips in DMEM (Dulbecco’s Modified Eagle Medium) supplemented with 10% fetal bovine serum at 37 ${}^{\circ }$C in a humidified incubator containing 5% CO${}_2$ until full confluence. Cells were subjected to serum starvation to induce cilia growth. The medium was supplemented with forskolin and either Tinh16-A01 (5 $\mu$M) or Tannic acid (5 $\mu$M) as ANO1 inhibitors. The medium was changed every 24–48 h.

To knock down ANO1, RCTE or GANAB cells were transfected with 50 nM siRNA using Lipofectamine RNAiMAX (No. 13778075, Invitrogen, Carlsbad, USA) following the manufacturer’s instructions. siRNA sequences targeting human ANO1 are as follows: siRNA1,5${}^{\prime }$- GAAGCAACACCTATTCGACCTG -3${}^{\prime }$; and siRNA2:5${}^{\prime }$- TCCGTAACTTGCCCATTCCTC -3${}^{\prime }$.

Lentivirus system was used to construct stabilized Ano1 knock-down MDCK cell lines. Short hairpin RNA (shRNA)-expressing lentivirus constructs were generated using pLV-RNAi vector (Biosettia, San Diego, CA, USA. The following shRNA sequence was used to target Canis lupus ANO1: 5${}^{\prime }$- CCTTCAACGTCAGCGACTT -3${}^{\prime }$. The scrambled shRNA sequence used is 5${}^{\prime }$- CCTAAGGTTAAGTCGCCCTCG -3${}^{\prime }$.

Kidneys were fixed in 10% neutral-buffered formalin and were paraffin embedded. For immunohistological analyses, we used 4 $\mu$m paraffin kidney sections with heat-induced antigen retrieval, as described elsewhere [19]. Kidney sections were blocked with 5% BSA for 1 h at room temperature, followed by incubation with mouse monoclonal human anti- ANO1 (ab190721, Abcam, USA) 1:500 dilution overnight at 4 ${}^{\circ }$C. The negative control sections were stained by using IgG. The HRP-conjugated secondary antibodies (1:1000 dilution) were purchased from KPL Inc. (Gaithersburg, MD, USA). Peroxidase substrates were diaminobenzidine (DAB) (Vector Laboratories Inc., Burlingame, CA, USA). The nuclei were counter-stained with hematoxylin (Vector Laboratories Inc.) for 2 min, and then were mounted, which were further analyzed by Axioplan microscope and AxioVision Rel.4.6. software (Zeiss, Jena, Germany). A minimum of 10 views per slide were captured and analyzed.

Cells were cultured in DMEM/F-12 containing 10% FBS on glass coverslips and were starved when reaching 70% confluence. After 24–48 h, slides were fixed with ice-cold methanol or paraformaldehyde for 10 min, then were permeabilized and immune-stained with appropriate antibodies. For immunofluorescent staining, anti-ANO1 (diluted 1:500), anti-acetylated a-tubulin (diluted 1:1000, T7451, Sigma), anti-tubulin-detyrosinated (diluted 1:1000, AB3201, Sigma) and PC2 antibodies (diluted 1:200, provided by the Baltimore Polycystic Kidney Disease (PKD) Research and Clinical Core Center) were used. Binding of the primary antibody was visualized by incubation with secondary donkey anti-mouse antibodies conjugated with AlexaFluor 488 or 555 (1:1000 for each, Molecular Probes, Invitrogen, Darmstadt, Germany). IgG was used as negative controls. Confocal experiments were carried out on a Bio-Rad MRC-1024 laser scanning confocal microscope (Bio-Rad Laboratories, Hercules, CA, USA).

Total RNA was isolated from PKD1${}^{\mathit{\text{RC/RC}}}$ mouse, human kidney samples, transfected MDCK cells and PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells. The synthesis of cDNA was performed routinely by using the M-MLV Reverse Transcription system (Invitrogen Life Technologies, Darmstadt, Germany). Real-time RT–PCR was performed in a plate reader Light Cycler 480 by using a SYBR Green I (BioRad, USA) and a specific primer. The housekeeping gene GAPDH served as an internal control to estimate the relative quantity of mRNA expression and correct for differences in sample content. The following are primers used in this study: Human ANO1 primer sequences Forward, CAGCATGGAGATGTGTGACC; Reverse, CATCTGTTTCCGCTTCCAGT; Mouse ANO1 primer sequences Forward, GAAGCAACACCTATTCGACCTG; Reverse, TCCGTAACTTGCCCATTCCTC; Canis lupus ANO1 primer sequences Forward, AAAAGCAAAGAGAAGCGCCG; Reverse, GCCATGGCTGTCTTAACCCT.

Three-dimensional structured illumination microscopy was performed using a standard protocol in our lab. Briefly, an ELYRA Super-resolution Microscopy system (Zeiss) equipped with an alpha ‘Plan-Apochromat’ 100_/1.46 Oil DIC oil immersion objective and an AndoriXon 885 EMCCD camera was used to capture raw images. Sections were acquired at 0.125-mm z-steps. Color channels were aligned using alignment parameters from control measurements with 0.5-mm diameter multispectral fluorescent beads (Zeiss). Structured illumination reconstruction and image processing were performed with the ZEN software package (Zeiss). Final image processing was performed by using Adobe Photoshop.

Protein was extracted by using the ProteoPrep® Total Extraction Sample Kit (Sigma, USA), and was measured with a BCA protein assay kit (Pierce, USA). Protein sample (60 $\mu$g) was loaded for acrylamide gel electrophoresis (SDS-PAGE, resolving gel concentration was 12%) and transferred to nitrocellulose membranes at 100 Volts for 2 h. The membrane was blocked by 5% non-fat milk for 1 h at room temperature. The membrane was probed at 4 ${}^{\circ }$C over night with eight different primary antibodies: mouse anti-human ANO1 (diluted, 1:1000), rabbit anti-human PKD2 (1:1000, 07-488, Sigma), mouse anti-human ERK1/2 (1:2000, 4696#, Cell Signaling Technology), rabbit anti-human phospho-ERK1/2 (1:1000, 4376#, Cell Signaling Technology), rabbit anti-human STAT3 (1:1000, 12640#, Cell Signaling Technology), mouse anti-human phosphor-STAT3 (1:1000, 5726#, Cell Signaling Technology), mouse anti-human GAPDH (1:2000, 91153#, Sigma) and rabbit anti-mouse GAPDH (1:2000, 2118#, Cell Signaling Technology). After washing with PBS, the membrane was incubated with the corresponding HRP-labelled secondary antibody for 2 h at room temperature. Signals were developed by using the SuperSignal West Femto Luminol Enhanced ECL detection kit (Thermo Scientific). Visualization of protein bands was performed by using the ChemiDoc XRS imaging system (No.1708265, Bio-Rad, CA, USA). Band intensities were quantified by using ImageJ (National Institutes of Health, Washington D.C. USA).

Cells were cultured with serum-free defined medium containing DMEM-F12 and insulin (5 $\mu$g/mL), transferrin (5 $\mu$g/mL), and selenium (ITS, Sigma, 5 ng/mL), penicillin, Streptomycin, and epidermal growth factor (Sigma, 25 ng/mL) to generate cysts. When reaching confluence, cells were trypsinized and 4000 cells suspended in 0.4 mL of ice-cold Minimum Essential Medium (MEM) containing collagen type I 2.9 mg/mL (BD Biosciences), 10 mM HEPES, 27 mM NaHCO3, penicillin, and Streptomycin. The cell suspension was placed onto one well of a 24-well plate. When the collagen was solidified, 1 mL of cell medium including 10 $mu$M Forskolin was added to each well, and plates were maintained at 37 °C in a 5% CO${}_2$ humidified atmosphere. After 2 weeks of treatment, cultured cysts were imaged under bright field illumination using the Nikon dissecting scope. Cyst diameters (with diameter $>$50 uM) were measured by using MetaMorph software (Molecular Devices, USA). At least 3 wells per group were measured.

All data examined are presented as means $\pm$ SE. Comparisons between two groups were conducted using a two-tailed t-test when the data were normally distributed. p values of less than 0.05 were considered statistically significant. All analyses were carried out using GraphPad Prism software (GraphPad Software, USA), and all graphs were generated with the same software.

To understand the transcriptional control of Ano1 gene in kidneys, the renal expression of ANO1 was measured in hypomorphic PKD1${}^{\mathit{\text{RC/RC}}}$ mice. In young 1-month-old mice without cysts, there is no difference in the expression of Ano1 between WT and Pkd1${}^{\mathit{\text{RC/RC}}}$ mice. Intriguingly, Ano1 expression was significantly upregulated in adult Pkd1${}^{\mathit{\text{RC/RC}}}$ mice after cystogenesis is initiated (Fig. 1A).

Fig. 1.

ANO1 is up-regulated in mouse and human ADPKD kidneys. (A) Quantitative PCR analysis of ANO1 expression in kidney tissues of PKD1${}^{\mathit{\text{RC/RC}}}$ mice with different ages (1, 3, 5, 18 months). (B) Quantitative PCR analysis of ANO1 expression in human normal control and ADPKD patients renal tissues. (C,D) Western blotting analysis of ANO1 expression in human normal control and ADPKD patients renal tissues and was further quantified. (E) Immunohistochemistry analysis of ANO1 (in brown) expression in human normal control (N1, N2, N3) and ADPKD patients (A1, A2, A3) renal tissues. IgG served as a negative control for staining. Scale bars, 200 $\mu$m. On representative result from three independent experiments was shown. *p 0.05. **p 0.01.

To examine if ANO1 upregulation is relevant in ADPKD, we analyzed ANO1 expression levels in human ADPKD kidneys (Fig. 1B). Western blotting analysis indicated that ANO1 was significantly upregulated almost 5 folds in human ADPKD kidneys as compared with normal controls (Fig. 1C,D). Immunohistochemical staining revealed strong staining of ANO1 in lining cells of cystic renal tubules, but not in normal tubules or glomeruli, of kidneys from ADPKD patients as compared with those from normal kidneys (Fig. 1E).

We then assessed the subcellular localization of ANO1 in human renal collecting tubule epithelial (RCTE) cells by confocal immunofluorescence. As shown in Fig. 2A, contradictory to the assumption that ANO1 acts as a sensory receptor on the ciliary surface, ANO1 signal was only found at the ciliary base of RCTE cells. PKD1 deficiency did not change the localization of ANO1 (Fig. 2A). Moreover, we found that the intensity of ANO1 staining in the primary cilium of human PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells was stronger than that in RCTE cells (Fig. 2B). Super-resolution 3D structured illumination (SIM) microscopy analysis revealed that ANO1 was located to a subset of vesicles at the ciliary base in RCTE cells (Fig. 2C).

Fig. 2.

ANO1 is localized in primary cilia. (A,B) Immunofluorescence staining for ANO1 and Glu-tubulin was performed on RCTE and ADPKD cells (PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells) and further quantitative analyzed by confocal microscopy. IgG was used as a negative control for staining on RCTE and PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells. Scale bars, 10 $\mu$m. (C) Super-resolution 3D structured illumination microscopy analysis of ANO1 in RCTE cells. On representative result from three independent experiments was shown.

To investigate the role of ANO1 in the context of cilia, we used siRNA to knock down the expression of ANO1 in WT9-7 human PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells [20]. Contrary to previous discoveries that ANO1 deficiency reduces cilia length in IMCD3 cells [17], knock-down of ANO1 in human PKD cells did not affect ciliogenesis, but instead caused a subtle increase in the cilium length (Fig. 3). Intriguingly, ANO1 deficiency significantly increased the ciliary dosage of polycystin 2. The effect of ANO1 on polycystin 2 expression was further studied by using ANO1 specific inhibitor Tinh16-A01 in a ADPKD cell line. The expression of polycystin 2 (PC2) was not affected by Tinh16-A01 (Supplementary Fig. 1).

Fig. 3.

Knockdown of ANO1 increases the cilium length and the expression of polycystin 2 (PC2). Immunofluorescence: nonsense control (NC) siRNA or siRNA against ANO1was transfected in human PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells. Immunofluorescence staining for PC2 and AC-tubulin was performed on RCTE and ADPKD cells (PKD1${}^{\mathrm{+}\mathit{}\mathrm{/}\mathrm{-}}$ cells) and further analyzed by confocal microscopy. Cilia length and intensity of PC2 were quantified. The knockdown efficiency of siRNA was determined by real-time PCR. On representative result from three independent experiments was shown. Scale bars, 5 $\mu$m. **p 0.01.

3D culture with MDCK or IMCD3 cells are classical in vitro models to study ADPKD [21]. ANO1 specific inhibitor Tinh16-A01 or Tannic acid was used to treat IMCD3 cells. Tinh16-A01 or Tannic acid significantly inhibited cyst formation in 3D-cultured IMCD3 cells (Fig. 4A,B). To further study the functional impact of ANO1 on renal cyst formation, we established MDCK cell line with steady knockdown of Ano1 gene. As expected, genetic knockdown of Ano1 significantly inhibited cyst formation in MDCK cells (Fig. 4C,D).

Fig. 4.

Knock-down of ANO1 inhibits renal cyst formation in 3D culture models. (A,B) A three-dimensional (3D) culture model of cyst formation was established using IMCD3 cells which were treated with two different ANO1inhibitors (Tinh16-A01 or Tannic acid). After 2 weeks of culture, the Surface area of cysts (SA) was measured. Scale bars, 300 $\mu$m. (C,D) 3D culture model of cyst formation was established using MDCK cells which were transfected with shRNA against ANO1. Knock down efficiency was measured by RT-PCR before MDCK cells were planted into the collagen gel. After 2 weeks of culture, the diameter of cysts was measured. On representative result from three independent experiments was shown. Scale bars, 100 $\mu$m. *p 0.05. ***p 0.01.

We further examined the proliferative pathways abnormally upregulated in human PKD cells. GANAB is a novel ADPKD gene whose mutation compromises the protein maturity of PKD1 and PKD2 and impairs their ciliary localization [22]. As shown in Fig. 5A, ANO1 inhibition by Tinh16-A01 subdued phosphorylation of STAT3 and ERK in human GANAB${}^{\mathrm{-}\mathit{}\mathrm{/}\mathrm{-}}$ renal collecting tubule epithelial (RCTE) cells. Tannic Acid treatment showed similar effects in a dose-dependent manner in GANAB${}^{\mathrm{-}\mathit{}\mathrm{/}\mathrm{-}}$ RCTE cells (Fig. 5B). We further examined the effect of ANO1 inhibition in GANAB${}^{\mathrm{-}\mathit{}\mathrm{/}\mathrm{-}}$ cells [21]. Knockdown of ANO1 using two different siRNAs efficiently reduced activation of STAT3 and ERK pathways in GANAB${}^{\mathrm{-}\mathit{}\mathrm{/}\mathrm{-}}$ cells (Fig. 5C).

Fig. 5.

The effect of ANO1 on cell proliferation signaling pathways of ADPKD. (A) GANAB cells was treated with ANO1 specific inhibitor Tinh16-A01.The expression of ANO1 and phosphorylation of STAT3 and ERK in GANAB cells were analyzed by Western blot and further quantified. (B) GANAB cells was treated with ANO1 specific inhibitor Tannic acid. The expression of ANO1 and phosphorylation of STAT3 and ERK in GANAB cells were analyzed by Western blot and further quantified. (C) GANAB (an ADPKD cell line) cells were transfected with nonsense control (NC) siRNA or two different siRNAs against ANO1. The expression of ANO1 and phosphorylation of STAT3 and ERK in GANAB cells were analyzed by Western blot and further quantified. *p 0.05. **p 0.01.