1. Introduction
Cholestatic liver
diseases, such as primary biliary cholangitis (PBC) and primary sclerosing
cholangitis (PSC), are characterized by an impairment of bile secretion or
excretion, usually lead to liver fibrosis and cirrhosis, and even liver failure
[1, 2]. The clinical management dilemma of these diseases are linked with poor
understanding of their pathogenesis, late diagnosis and lack of effective cure
except for liver transplant [2]. Liver fibrosis plays a crucial role in the
disease’s progression and is closely related to clinical outcomes in cholestatic
liver diseases [3]. Therefore, developing new strategies for ameliorating or
reversing fibrogenesis is paramount to managing these diseases.
Cholangiocytes are the principal cells responsible for
cholestasis and liver fibrosis. They can activate hepatic stellate cells (HSCs)
and fibroblasts, causing overproduction of extracellular matrix and fibrotic
progression [4]. Cholangiocytes may also act as fibrogenic cells in the liver by
undergoing epithelial to mesenchymal transition (EMT) and enhanced senescence [5, 6]. Liver sections from patients with PBC contain cholangiocytes with enhanced
EMT markers, suggesting that preventing EMT may restrain or reverse liver
fibrosis [7]. Cholangiocyte senescence and its
senescence-associated secretory phenotype are hallmarks of PBC, contributing to
the paracrine activation of HSCs and increased liver fibrosis [8]. Evidence shows
transforming growth factor 1 (TGF-1) is the most potent
cytokine that perpetuates the fibrogenic response of the liver. It may do so by
positively regulating EMT and senescence of cholangiocytes [9, 10].
Myocyte enhancer factor 2A (MEF2A) is a transcription factor from the MEF2
family within the MADS-box superfamily [11]. It participates in numerous cellular
processes, including neuronal differentiation, muscular development, and cellular
growth control [12]. The important roles of MEF2A in human
cancers, cardiovascular diseases, and neurodegenerative diseases have been
demonstrated by a great deal of evidence [13, 14, 15, 16, 17]. Further, it may also have a
role in liver fibrosis. For example, MEF2A is involved in the activation of
cultured rat HSCs [18]. Furthermore, high levels of MEF2A are present in human
cirrhotic liver tissues and freshly isolated human HSCs [19]. By consulting the
HUMAN PROTEIN ATLAS database (https://www.proteinatlas.org/), we found that MEF2A
was not only expressed in HSCs, but also in cholangiocytes/bile duct epithelial
cells. However, whether and how cholangiocyte-derived MEF2A
participates in cholestatic liver fibrosis are still unclear.
In the present study, we quantified the levels of MEF2A in liver sections from
bile duct–ligated (BDL) mice and peripheral blood from patients with PBC to
explore its involvement in cholestatic liver fibrosis. We also assessed the
function of MEF2A in TGF-1-induced EMT, senescence, and fibrosis in
human intrahepatic biliary epithelial cells (HIBECs). Our findings identify MEF2A
as a novel inducer of cholestatic liver fibrosis.
2. Materials and Methods
2.1 Experimental Animals
Eight- to ten-week-old specific pathogen-free C57BL/6 male mice were maintained
under specific pathogen-free conditions, and offered free access to sterile water
and food. Their weight ranged between 20 and 25 g. Animal experiments were
approved by the Institutional Animal Care and Use Committee of Jining Medical
University.
2.2 Bile Duct Ligation (BDL) Mouse Model
After a week of adaptive feeding, the mice were randomly assigned to a sham (n =
10) or BDL group (n = 20). BDL was performed as previously described [20].
Briefly, the mice were anesthetized with 2% pentobarbital sodium (40 mg/kg)
(Sigma-Aldrich, St. Louis, USA). We first isolated the common bile duct and
the left and right hepatic ducts, and then ligated the left and right hepatic
ducts and the hepatic portal and duodenal portions of the common bile duct,
respectively. At last, the abdomen was closed. The sham group was used as a
control and underwent laparotomy without ligation. After 7 or 28 days, the mice
were killed and their liver tissues were harvested. It was further manipulated
for qRT-PCR, western blotting, histological, and immunohistochemical analyses.
2.3 Histology and Fluorescent Immunohistochemistry of Mouse Liver
Paraformaldehyde-fixed liver tissue samples were cut into 4-m-thick
paraffin-embedded sections and stained with hematoxylin-eosin. They were viewed
under a light microscope to assess the fibrosis stage according to the METAVIR
scoring system [21]. Before immunostaining, antigen retrieval was performed with
10 mM sodium citrate buffer in microwave. Sequentially, permeabilization was
performed with TritonX-100 (Solarbio, Beijing, China). Slices were incubated with 5% Bovine Serum Albumin (BSA) in phosphate buffer saline (PBS) for 30 min
at room temperature and then incubated at 37 °C for 1 h with a primary
anti-MEF2A antibody (Abcam, Cambridge, UK, 1:500). After rinsing 3 times with PBS, slices were
incubated with fluorescently conjugated secondary antibodies at room temperature
for 15 min. The sections were washed 5 times in PBS and 3 times in 5% BSA,
followed by adding 15 L mounting media containing DAPI stain and add a
coverslip. Scanning of slices was performed using a laser scanning confocal
microscope (Zeiss LSM800, Oberkochen, Germany).
2.4 Lentiviral Vectors for MEF2A Silencing
Lentiviral vectors expressing an shRNA targeted against the murine MEF2A
transcript (LV-shMEF2A) or negative control (LV-NC) were constructed by
GenePharma (China). The shMEF2A targeting sequence was 5′-GCAGCCAGCTCAACGTTAACA-3′, and that of the negative control was
5′-TTCTCCGAACGTGTCACGT-3′.
2.5 Cell Culture and Lentiviral Transfection
Human intrahepatic biliary epithelial cells (HIBECs) were purchased from the
BeNa Culture Collection (China). They were cultured in RPMI 1640 medium
(Gibco-BRL) supplemented
with 10% FBS (Gibco-BRL) at 37 °C and 5% CO. The cells (1
10 per well) were transfected with LV-shMEF2A or LV-NC following the
manufacturer’s protocol (multiplicity of infection = 30). In brief, LV-shMEF2A or
LV-NC was mixed with 10 mg/mL polybrene and added to the cell
suspension. The cell culture medium was
replaced with fresh RPMI 1640 12 to 16 h after transfection, and the transfected
cells were cultured continuously. Green fluorescent protein was detected by
fluorescence microscopy to assess the transfection efficiency 72 h after
transfection.
2.6 qRT-PCR
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, USA). Complementary DNA
(cDNA) was reverse transcribed with an All-In-One 5 RT reagent kit
(abm, Zhenjiang, Jiangsu, China) following the manufacturer’s protocol, and was stored at –20
°C until use. The quantitative PCR assay was performed using an
UltraSYBR Mixture (CWBIO, Taizhou, Jiangsu, China) with the following conditions: 1 min at 95
°C, 40 cycles at 95 °C, 15 s; and 40 cycles at 60 °C,
30 s. The primers were synthesized by ShengGong Biotech (Shanghai, China), and their
sequences are listed in Table 1. The relative expression of GAPDH was used as an
endogenous reference to quantify the relative mRNA expression of target genes.
The transcript level of each gene was calculated using the
2 method.
Table 1.The primers using in qRT-PCR analysis.
Gene |
Species |
DNA sequence (sense 5′–3′) |
DNA sequence (anti-sense 5′-3′) |
MEF2A |
Human |
TGCGACAGCCCAGACCCTG |
GAGGTGGCAGACCAGGTGCG |
MEF2A |
Mouse |
CAGGTGGTGGCAGTCTTGG |
TGCTTATCCTTTGGGCATTCAA |
-SMA |
Human |
GGCTCT GGGCTCTGTAAGG |
CTCTTGCTCTGG GCTTCATC |
E-cadherin |
Human |
TTCTGCTGCTCTTGCTGTTT |
TGGCTCAAGTCAAAGTCCTG |
N-cadherin |
Human |
GGTGGAGGAGAAGAAGACCAG |
GGCATCAGG CTCCACAGT |
vimentin |
Human |
GCCCTTAAAGGAACCAATGA |
AGCTTCAACGGCAAAGTTCT |
GAPDH |
Human |
CTGGGCTACACTGAGCACC |
AAGTGGTCGTTGAGGGCAATG |
2.7 Western Blotting
Cells were lysed using a RIPA lysis buffer containing 10% phosphatase and
proteinase inhibitor (Beyotime, Shanghai, China). An equal amount of protein was loaded and
separated on 10% sodium dodecyl sulphate-polyacrylamide gels. Proteins were
transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA, USA). They were blocked
with 5% non-fat milk for 2 h at room temperature and incubated overnight at 4 °C
with primary antibodies: anti-MEF2A (Abcam, 1:1000), anti-E-cadherin (Abcam,
1:1000), anti-N-cadherin (Abcam, 1:1000), anti-vimentin (Abcam, 1:1000),
anti--SMA (Abcam, 1:1000), anti-P21 (Abcam, 1:1000), anti-p38 (Danvers, MA, USA,
1:1000), anti-JNK (CST, 1:1000), anti-ERK (CST, 1:1000), or anti-GAPDH (Boster Bio, Shanghai, China,
1:1000). The HRP-conjugated secondary antibodies were added to the membranes and
incubated for 2 h at room temperature. The membranes were visualized in a drak
room using an ECL reagent (Beyotime) following the manufacturer’s
instructions.
2.8 Senescence-Associated -Galactosidase (SA--Gal)
Assay
The SA--Gal activity was assessed using a senescence
-galactosidase staining kit (Beyotime) by the manufacturer’s
instructions. Briefly, the cells were washed with PBS and fixed with
SA--Gal staining fixative for 15 min at room temperature. After
rewashing twice with PBS, the SA--Gal staining solution was added, and
the cells were incubated overnight at 37 °C in the dark. The cells were
observed under a light microscope, and the senescent cells were identified by
blue color.
2.9 Cell Immunofluorescence
Cells were fixed with 4% paraformaldehyde for 15 min at room temperature. They
were permeabilized with 0.01% Triton X-100 (Solarbio, Beijing, China) for 5 min and
blocked in 10% fetal bovine serum for 1 h at room temperature. For the staining,
the cells were incubated with a primary rabbit anti--SMA (Abcam, 1:500)
overnight at 4 °C, and then incubated with an Alexa Fluor 488- or
590-conjugated secondary antibody (Santa Cruz Biotechnology, California, USA, 1:200) for 1 h.
Nuclei were visualized with 4′-6-diamidino-2-phenylindole (Beyotime, 5
mg/mL), and images were captured using a confocal microscope (Zeiss LSM800, Oberkochen, Germany,
Germany).
2.10 Patients
Serum MEF2A levels of 15 patients with PBC and 15 healthy controls (HCs) was
analyzed in this study. All participants were inpatients from the Department of
Gastroenterology, Affiliated Hospital of Jining Medical University, China. All
fulfilled the requirements for PBC diagnosis specified in the European
Association for the Study of the Liver clinical practice guidelines [22]. The
participants gave their written informed consent to partake in the study. The
Institutional Review Board for Clinical Research of the Affiliated Hospital of
Jining Medical University approved the study. Clinical characteristics of
included patients are shown in Table 2.
Table 2.Baseline clinical characteristics of analyzed PBC patients.
Parameters |
Patients (n = 15) |
Age (years) |
56.5 9.3 |
Gender |
|
|
Male |
3 |
|
Female |
12 |
Duration of PBC (years) |
5.9 5.2 |
Liver stiffness measurement (LSM, kPa) |
12.0 5.7 |
2.11 ELISA
Serum MEF2A levels were tested using a human MEF2A ELISA kit (FineTest, China).
Peripheral blood was collected in EDTA anti-coagulated tubes and centrifuged at
1000 g and 4 °C for 20 min. The supernatant was aspirated,
and the assay was performed following the manufacturer’s
instructions. Briefly, the capture antibody was incubated in 96-well plates at 4
°C overnight. After blocking with assay diluents, the standards and
samples were added to the designated wells and incubated at 37 °C for 2
h. The plates were incubated with the detection antibody for 1 h and Horseradish Peroxidase (HRP) for 30
min. They were washed with 0.05% Tween-PBS before adding the 3,3',5,5'-tetramethylbenzidine sulfate (TMB) substrate to
develop color. Absorbance was measured using a microplate spectrophotometer
(BioTek, Vermont, USA).
2.12 Statistical Analysis
All experiments were performed in triplicates, and data were expressed as the
mean standard deviation (SD). Differences between two groups were
analyzed with the t test. A one-way ANOVA was recruited to compare
differences among multiple groups. Statistical Package for Social Sciences (v
20.0) (Chiago, IL, USA) was used for all data analyses.
Significant differences were considered when p 0.05.
3. Results
3.1 MEF2A is Considerably Overexpressed in Livers
of BDL Mice
Bile duct-ligated mice are a widely used model to study cholestatic liver
fibrosis, including PBC. Therefore, we examined the expression of MEF2A in the
livers of BDL mice. They were sacrificed 7 or 28 days after BDL
surgery, and their liver tissues were harvested. Histological examination of
liver sections showed that BDL surgery induced liver fibrosis in mice (Fig. 1A),
confirming the successful establishment of the BDL model. Fluorescent
immunohistochemistry analysis localized MEF2A expression in the liver and
revealed that the percentage of MEF2A cells in BDL-mice was markedly higher
than the control (Fig. 1B,C). We also examined protein levels of MEF2A and
TGF-1 in the liver by western blotting. In BDL-mice
liver tissues, which were substantially increased compared with those of the
control (Fig. 1D). Moreover, MEF2A mRNA levels were consistent with protein
levels (Fig. 1E).
Fig. 1.
MEF2A is overexpressed in livers of BDL mice and positively
correlates with degree of fibrosis. Bile duct-ligated model was established
using C57BL/6 mice to induce liver fibrosis. Sham mice were used as control. Mice
were sacrificed 7 or 28 days after BDL surgery, and liver tissues were harvested.
(A) Histological examination of liver sections with H&E staining. Scale bar
represents 50 m. (B) Expression of MEF2A in liver tissues of BDL and sham
mice detected with immunohistochemical staining using second antibodies labeled
with fluorochromes. Original magnification 200. Scale bar represents
50 m. (C) Percentages of MEF2A cells in mice livers shown in (B).
**p 0.01, ***p 0.001. (D) MEF2A and
TGF-1 protein expression in liver tissues of BDL and
sham mice identified by western blotting. Reference protein was GAPDH. (E)
Relative MEF2A mRNA expression in liver tissues of BDL and sham mice examined by
qRT-PCR. Gene expression was normalized to GAPDH in each group. **p
0.01, ***p 0.001.
3.2 Silencing MEF2A Inhibits TGF-1-Induced EMT in HIBECs
Evidence suggests that TGF-1 induces EMT in cultured cholangiocytes
[23]. Hence, we assessed whether silencing MEF2A affects
TGF-1-induced EMT. We treated HIBECs with
TGF-1 or in combination with a lentiviral vector
expressing shRNA against MEF2A (LV-shMEF2A) or the empty vector (LV-NC). Western
blotting and qRT-PCR assays verified the silencing of MEF2A with approximately
50% knock-down efficiency compared with control and LV-NC groups (Fig. 2). In
addition, TGF-1 significantly decreased the expression of E-cadherin but
increased N-cadherin and vimentin, which were significantly altered in the
presence of LV-shMEF2A (Fig. 2). These results indicate that MEF2A acts as a
positive modulator of EMT in HIBECs.
Fig. 2.
Silencing MEF2A inhibits TGF-1-induced EMT in HIBECs.
HIBECs were cultured and treated with TGF-1 (15 ng/mL) or in
combination with LV-shMEF2A (lentiviral vector expressing shRNA against MEF2A) or
LV-NC (empty vector). (A) Expression of MEF2A protein and EMT markers in HIBECs
assessed by western blotting. Reference protein was GAPDH. (B) Quantification of
MEF2A and EMT markers in cells depicted in (A).
*p 0.05, **p 0.01. (C) Relative
expression of MEF2A and EMT markers evaluated by qRT-PCR. Gene expression was
normalized to GAPDH in each group. *p 0.05, **p 0.01,
***p 0.001.
3.3 Silencing MEF2A Decreases
TGF-1-Induced Cellular Senescence in HIBECs
Cholangiocyte senescence contributes to
the pathogenesis of PBC and liver fibrosis [24]. HIBECs were transfected with
TGF-1 in combination with LV-shMEF2A or LV-NC to investigate the effect
of MEF2A on their senescence. About 96 h post-transfection, cells were stained
with SA--gal assay, and those positive for SA--gal activity
were determined. TGF-1 substantially increased the number of senescent
HIBECs than that in the control group. When MEF2A was silenced, the proportion of
the positive cells in the LV-shMEF2A-transfected group was significantly lower
than that in LV-NC-transfected group (Fig. 3A). Thus, silencing MEF2A decreases
the number of senescent HIBECs. Moreover, qRT-PCR and western blotting revealed
that transcript and protein levels of p21, a marker of senescence [25],
significantly decreased after the MEF2A knockdown (Fig. 3B,C). These data suggest
that MEF2A silencing reduces HIBEC senescence.
Fig. 3.
Silencing MEF2A decreases TGF-1-induced cellular
senescence in HIBECs. HIBECs were cultured and treated with TGF-1 (15
ng/mL) or in combination with LV-shMEF2A (lentiviral vector expressing shRNA
against MEF2A) or LV-NC (empty vector). Cells were harvested 96 h posttreatment
to determine senescence. (A) SA--galactosidase staining of the senescent
cells (blue). Original magnification 100. Scale bar = 50 m. (B)
Expression of p21, a senescence marker, in HIBECs detected by western blotting.
Reference protein was GAPDH. *p 0.05, **p 0.01. (C)
Quantification of p21 levels in cells shown in (B). (D) Relative expression of
p21 mRNA evaluated by qRT-PCR. Gene expression was normalized to GAPDH in each
group. *p 0.05, **p 0.01.
3.4 Silencing MEF2A Alleviates Fibrogenesis in HIBECs
TGF-1 is considered the most potent cytokine that maintains the
fibrogenic response in the liver. We treated HIBECs with TGF-1 or in
combination with LV-shMEF2A or LV-NC to explore whether MEF2A affects the
TGF-1-promoted fibrogenic response in these cells. Expression levels of
profibrogenic marker -SMA were examined by qRT-PCR, western blotting,
and immunofluorescence assays. The TGF-1 treatment significantly
increased protein and mRNA levels of -SMA in HIBECs compared with the
control (Fig. 4A–C). Conversely, MEF2A
knockdown significantly decreased the levels of -SMA induced by
TGF-1 (Fig. 4A–C). Immunofluorescence staining of HIBECs also
demonstrated elevated -SMA protein under the TGF-1 treatment
and its reduction upon MEF2A knockdown (Fig. 4D). These results imply that MEF2A
promotes fibrogenesis in HIBECs.
Fig. 4.
Silencing MEF2A alleviates fibrogenesis in HIBECs. HIBECs were
cultured and treated with TGF-1 (15 ng/mL) or in combination with
LV-shMEF2A (lentiviral vector expressing shRNA against MEF2A) or LV-NC (empty
vector). (A) Expression of -SMA protein in HIBECs identified by western
blotting. (B) Quantification of -SMA protein levels in cells shown in
(A). (C) Relative expression of -SMA mRNA in HIBECs evaluated with
qRT-PCR. *p 0.05, **p 0.01 vs. negative control. (D)
Immunofluorescence assay demonstrating -SMA expression in HIBECs.
Original magnification 200. Scale bar = 50 m. Red,
-SMA cells; blue, DAPI-counterstained nuclei.
3.5 Regulating MEF2A Expression and Cytoplasm Translocation via p38
MAPK Signaling Mediates TGF-1-Induced EMT, Senescence, and Fibrosis in
HIBECs
TGF-1 is a central regulator of EMT, senescence, and liver fibrosis. We
stimulated HIBECs with TGF-1 to determine whether it could induce MEF2A
expression and cytoplasm translocation. We determined its expression and
subcellular localization with qRT-PCR, western blotting and immunofluorescence
assays. The TGF-1 treatment increased the MEF2A expression in HIBECs in
a concentration- and time-dependent manner (Fig. 5A–F). Furthermore,
TGF-1 induced its translocation from the nucleus to
the cytoplasm (Fig. 5G,H).
Fig. 5.
Regulating MEF2A expression and cytoplasm translocation by
TGF-1 in HIBECs. (A–C) HIBECs were treated for 48 h
with TGF-1 at various concentrations: 0,
5, 10, and 15 ng/mL. Expression levels of MEF2A protein and mRNA were examined
across different TGF-1 concentrations by western blotting and qRT-PCR.
*p 0.05, **p 0.01 vs. control. (D–F) HIBECs were
treated with TGF-1 (15 ng/mL) at various time points: 0, 12, 24, 48, and
72 h. MEF2A protein and mRNA expression levels were analyzed at each time point
by western blotting and qRT-PCR. *p 0.05, **p 0.01 vs.
control. (G) Immunofluorescence analysis of MEF2A localization in HIBECs. Red,
MEF2A; blue, DAPI-counterstained nuclei (scale bar = 50
m). (H) Western blotting assay demonstrating MEF2A levels in cytoplasm and
nuclei of HIBECs.
The MAPK pathway may play a role in the pathogenesis of tissue fibrosis, acting
downstream of TGF-1 [26], and p38 directly activates MEF2A, promoting
its nuclear activation [27]. Hence, we tested the roles of MAPK signalings (p38,
JNK, and ERK) in TGF-1-induced MEF2A in HIBECs. The results showed that
TGF-1 causes an increase in the levels of phosphorylated p38 (p-p38),
but not in that of p-JNK or p-ERK, demonstrating activation of p38 MAPK (Fig. 6A). We further examined whether altering the p38 MAPK signaling could modulate
the TGF-1-induced MEF2A expression, EMT, and senescence in HIBECs.
Indeed, inhibiting phosphorylation of p38 by its inhibitor SB 203580 was
sufficient to prevent the increase of MEF2A, p21, -SMA and suppress the
decrease of E-cadherin induced by TGF-1 (Fig. 6B). These data suggest
that suppressing the TGF-1-activated p38 MAPK signaling contributes to
the anti-EMT and anti-senescence properties of MEF2A inhibition in HIBECs.
Fig. 6.
Regulation of the expression of MEF2A,
E-cadherin, p21, and -SMA by TGF-1-p38 MAPK in HIBECs. (A)
HIBECs were treated with TGF-1 for different lengths of time (0, 30 min,
and 60 min). Levels of phosphorylated p38 (p-p38), total p38 (t-p38), p-JNK,
t-JNK, p-ERK and t-ERK were determined by western blotting. (B) Western blotting
assay showing p-p38, p38, MEF2A, E-cadherin, p21, and -SMA levels in
HIBECs after TGF-1 treatment with or without SB 203580 inhibitor.
3.6 MEF2A Expression Increases in PBC Patients and Positively
Correlates with the Extent of Liver Fibrosis
Since MEF2A plays a key role in the fibrogenic response, we aimed to answer
whether it contributes to PBC fibrosis. We examined the expression of MEF2A in
the serum of patients with PBC and found its levels were significantly high in
the serum of patients versus HCs (Fig. 7A). To assess whether serum MEF2A levels
were also associated with the extent of liver fibrosis, we determined the liver
stiffness measurement (LSM). We used a transient elastographic instrument for the
noninvasive evaluation of liver fibrosis called Fibroscan [28]. Next, we analyzed
the correlation of serum MEF2A expression with LSM in patients with PBC.
Interestingly, MEF2A expression in serum from PBC patients positively correlated
with LSM (Fig. 7B). These data indicate that MEF2A expression in serum of
patients with PBC positively correlates with the extent of liver
fibrosis.
Fig. 7.
MEF2A expression increases in patients with PBC and correlates
with the extent of liver fibrosis. (A) Peripheral blood samples were collected
from patients with PBC (n = 15) and healthy controls (HCs) (n = 15). Expression
of serum MEF2A was detected by ELISA. **p 0.01. (B) Correlation
analysis was performed between liver stiffness measurement (LSM) and MEF2A
expression in serum from patients with PBC. **p 0.01.
4. Discussion
Chronic cholestatic liver diseases, including PSC and PBC,
mainly affecting intrahepatic bile ducts, usually lead to liver fibrosis,
cirrhosis, and failure. Cholangiocytes are primary targets
during the pathogenesis of cholestatic liver diseases [29]. It
is demonstrated that MEF2A implicated in liver fibrosis, but whether and how
cholangiocytes-derived MEF2A affect cholestatic liver fibrosis are still poorly
understood. This study revealed that MEF2A expression increases in BDL mice and
PBC patients, and positively correlates with the extent of liver fibrosis.
Silencing MEF2A in HIBECs suppresses TGF-1-induced EMT, senescence, and
fibrosis. Moreover, MEF2A is a downstream effector of
TGF-1 signals in HIBECs, whose expression depends on
the p38 MAPK pathway. Thus, the TGF-1-p38 MAPK-MEF2A axis is an
essential mechanism that may contribute to EMT, senescence, and fibrosis in
cholestasis (Fig. 8).
Fig. 8.
Schematic representation of the role of MEF2A in the
pathogenesis of cholestatic liver fibrosis. TGF-1 stimulated MEF2A
expression and cytoplasm translocation via p38MAPK pathway in HIBECs. Increased
MEF2A promoted EMT and cellular senescence in HIBECs, and eventually led to liver
fibrosis.
MEF2A belongs to the myocyte enhancer factor 2 (MEF2) family. It is critical for
activating genetic programs that control cell differentiation, morphogenesis,
proliferation, and apoptosis of numerous cell types [30]. The implication of
MEF2A in diverse human cancers, such as prostate, breast, gastrointestinal, and
liver cancer, was discovered. In gastric cancer, the p38 MAPK pathway
phosphorylates MEF2A, promoting tumor proliferation and metastasis [31].
Furthermore, MEF2A promotes colorectal cancer proliferation and metastasis by
activating the Wnt pathway [32]. It also contributes to the apoptosis of HepG2
hepatocellular carcinoma cells [33]. In neurons, MEF2A defines oxytocin-induced
morphological effects and regulates mitochondrial functions [34].
In addition, it is a nonredundant regulator of the inflammatory
epigenome in macrophages [35]. However, only a few reports investigated its roles
in fibrotic diseases. For instance, blockade of MEF2A prevented
hyperglycemia-induced extracellular matrix accumulation via suppressing Akt and
TGF-1/Smad activation in cardiac fibroblasts [36]. MEF2A protein
expression is high in liver sections obtained from patients with liver cirrhosis
and increases during culture-induced activation of primary human HSCs [19]. In
this study, we confirmed the role of MEF2A in cholangiocytes and cholestatic
liver fibrosis.
EMT has been implicated in several types of chronic fibrotic diseases. It is a
process where epithelial cells obtain mesenchymal features, contributing to the
fibrogenic process [37, 38]. It consists of two crucial steps. The first involves
the loss of epithelial cell adhesion and degradation of junction proteins,
including E-cadherin. The second includes the enhancement of cytoskeletal
proteins from the mesenchymal lineage, including N-cadherin and vimentin [39].
Knockdown of vimentin reduces EMT in cholangiocytes and leads to decreased liver
fibrosis in PSC [40]. MicroRNA-34a accelerates EMT in HIBECs and advances liver
fibrosis in PBC by regulating the TGF-1/Smad pathway [41]. However, the
role of cholangiocyte EMT in liver fibrosis remains controversial. Biliary
epithelial cell EMT is the key pathogenetic process identified in a study of a
PBC patient after transplantation [42]. We found low expression of E-cadherin and
augmented expression of N-cadherin, vimentin, and -SMA upon treating
HIBECs with TGF-1, in line with previous studies [43]. Silencing MEF2A
reversed the above EMT steps and fibrosis induced by TGF-1. Our results
indicate that elevated MEF2A is a trigger for TGF-1-induced EMT and a
profibrotic factor in HIBECs.
Cellular senescence is a cell cycle arrest occurring when cells under stress
stimulation, such as DNA damage, dysfunctional telomeres, and oncogenic mutations
[44]. Decreased cholangiocytes senescence may alleviate liver
fibrosis. For instance, remission of liver fibrosis in NK-1R mice with
BDL surgery is associated with reduced senescence of cholangiocytes and enhanced
senescence of HSCs [25]. Knocking out secretin receptor alleviates liver fibrosis
in Mdr2 mice by diminishing cholangiocyte senescence [6]. In this study,
we demonstrated that knocking down MEF2A suppresses TGF-1-induced
senescence of HIBECs, suggesting that MEF2A participates in the pathological
process of PBC fibrosis by partially promoting senescence in these cells.
We also discovered that MEF2A is a central mediator linking EMT and senescence
in TGF-1-induced liver fibrosis. To further evaluate the functions of
MEF2A under TGF-1 stimulation in vitro, we examined its
subcellular localization in HIBECs and showed that
TGF-1 induces MEF2A expression and cytoplasm
translocation. Several pathways mediate the TGF-1 signal in various cell
types, including MAPK and Smad. In addition, MEF2A is a nuclear target of the p38
MAPK signaling pathway [45]. Our study revealed that inhibiting p38 MAPK
decreases MEF2A expression in HIBECs under TGF-1 stimulation. Thus,
we propose the TGF-1-p38 MAPK-MEF2A axis is an
essential mechanism that contributes to cholangiocyte EMT, senescence, and
fibrosis in cholestatic liver fibrosis.
We show that MEF2A silencing may protect against liver fibrosis by regulating
cholangiocyte EMT and senescence in cholangiopathies. The
underlying mechanism likely involves the expression regulation and cytoplasm
translocation of MEF2A via interactions with the p38 MAPK pathway. In summary,
our study sheds new light on the role of MEF2A in the
pathogenesis of cholestatic liver fibrosis. We believe that inhibiting MEF2A
could be a valuable strategy for managing liver fibrosis in cholestatic liver
diseases. Intriguingly, the positive correlation of serum level of MEF2A with
fibrosis degree of PBC patients suggests that MEF2A may also serve as a potential
biomarker for predicting the risk of fibrogenesis in cholestatic liver diseases.
However, further research should be done in PSC patients and using more animal
models for cholestatic liver fibrosis, for example Mdr2 mouse model.
Moreover, we are establishing cholangiocyte-specific MEF2A KO mice, which may
better clarify the role of cholangiocyte-derived MEF2A in cholestatic liver
fibrosis.
5. Conclusions
In conclusion, we have shown here in an in vitro BDL mouse model, PBC
patients and human intrahepatic biliary epithelial cells that MEF2A may involve
in the pathogenesis of cholestatic liver fibrosis through regulating
TGF-1-induced cholangiocyte EMT and senescence. These data identify
MEF2A as a novel inducer of cholestatic liver fibrosis and targeting MEF2A may
serve as a potential therapeutic approach for cholestatic liver fibrosis.
Availability of Data and Materials
The data and material underlying this article are all available in the article.
Author Contributions
FZ conceived and designed the experiments. GZ and FH performed the experiments.
HH, YX and YW analyzed the data. GZ, XC and FZ wrote the manuscript. All authors
discussed and revised the manuscript.
Ethics Approval and Consent to Participate
This study was approved by the Institutional Review Board for Clinical Research
of the Affiliated Hospital of Jining Medical University. Written informed consent
has been obtained from the patients to publish this paper (Ethic approval number:
2019-FY-066).
Acknowledgment
Not applicable.
Funding
This work was supported by grants from Tai Shan Young Scholar Foundation of
Shandong Province (tsqn202103190), TCM Science and Technology Project of Shandong
Province (Q-2022134), Key research and development plan of Jining City
(2021YXNS045, 2021YXNS144), and Postdoctoral Fund of the Affiliated Hospital of
Jining Medical University (JYFY303574).
Conflict of Interest
The authors declare no conflict of interest.