IMR Press / FBL / Volume 26 / Issue 4 / DOI: 10.2741/4917

Frontiers in Bioscience-Landmark (FBL) is published by IMR Press from Volume 26 Issue 5 (2021). Previous articles were published by another publisher on a subscription basis, and they are hosted by IMR Press on imrpress.com as a courtesy and upon agreement with Frontiers in Bioscience.

Open Access Review
Emerging roles of microRNAs in the regulation of Toll-like receptor (TLR)-signaling 
Show Less
1 Department of Physiology, Morehouse School of Medicine, Atlanta, GA, USA
2 Department of Obstetrics and Gynecology, Morehouse School of Medicine, Atlanta, GA, USA
Front. Biosci. (Landmark Ed) 2021 , 26(4), 771–796; https://doi.org/10.2741/4917
Published: 1 October 2020
(This article belongs to the Special Issue Recent progress in reproductive biology)
Abstract

Toll-like receptors (TLRs) are evolutionarily conserved molecules that detect exogenous and endogenous molecular patterns and trigger both the innate and adaptive immune systems to initiate a pathogen-specific immune response and eliminate the threat. However, sustained, or prolonged activation of the immune system disrupts immunological homeostasis and leads to chronic or acute inflammatory diseases. MicroRNAs (miRNAs) can intervene in the initiation and modulation of the complex immunoregulatory networks via regulating the expression of TLRs and multiple components of TLR-signaling pathways including signaling proteins, transcription factors, and cytokines. Moreover, the aberrant expression of TLRs can induce the expression of several miRNAs which in turn regulate the expression of TLR signaling components and TLR-induced cytokines. The present review aims to highlight the emerging roles of miRNA in the regulation of TLR signaling, the interaction between the miRNAs and TLRs, and their implication in inflammatory diseases.

Keywords
miRNA
TLR
Immunity
Cytokine
SNAP
Chemokine
Review
2. INTRODUCTION

The immune system is a complex network of immune organs, cells, and soluble factors (cytokines) that act locally or systemically through an immediate (innate) inflammatory response by cytokines and phagocytes, and a specific tailored immune response through adaptive immune cells, or a regulated immune-tolerant response. The differing, and sometimes opposing, roles of the immune system are mediated by a complex interplay of intracellular and extracellular signaling pathways. Cells of the immune system participate in the protection of the host from invading pathogens, foreign antigens, and incipient tumor cells, and in development, maintenance of homeostasis, tissue repair and regeneration processes for wound healing (1). The innate immune system depends on the pattern recognizing receptors (PRRs), includes components of the complement system and Toll-like receptors (TLRs) family. TLRs are membrane-associated innate-immune sensors that detect the external pathogen-associated molecular patterns (PAMPs) or the internal damage-associated molecular patterns (DAMPs) and execute subsequent immune cell response (2); (3); (4). TLRs, the most extensively studied PRRs, are type-I transmembrane glycoprotein receptors. TLRs consist of three structurally important domains namely an ectodomain consisting of hydrophobic leucine-rich repeat region (LRR) for ligand recognition/binding at N-terminus and formation of functional dimers to initiate the signaling cascade, a single transmembrane helix, and a conserved cytoplasmic Toll/Interleukin-1 (IL-1) receptor (TIR) domain at C-terminus required for the activation of downstream intracellular signal transduction pathways (5); (6). Interestingly, the extracellular ligand-binding domains of TLRs contain hydrophobic leucine-rich repeat motifs that form horseshoe-shaped solenoid structures and contain an extensive β-sheet on its concave surface, and numerous ligand-binding insertions (7). TLRs are distinguished based on their ligand specificity, signal transduction pathways, and subcellular localization (8). In mammals, ten human (TLR1-10), and 13 murine TLR protein subfamily (TLR1-9, TLR11-13) have been identified with a functional difference among humans and mice (9); (5), (10); (11). TLRs are functionally classified into two categories. The group I TLRs include TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10, and are expressed on the cell membrane and recognize microbially derived lipopolysaccharide (LPS) and lipopeptide ligands (12). The group II TLRs include TLR3, TLR7, TLR8, and TLR9, and are primarily expressed on vesicles and located intracellularly in the endoplasmic reticulum (ER), endosomes, and lysosomes compartments and recognize microbial nucleic acids released from stressed or dying cells (13); (14); (15). Unlike the other TLRs, TLR3 is expressed both on the cell surface and in intracellular vesicles and recognize viral dsRNA (16). Thus, TLRs are expressed in all tissues including macrophages, NK cells, DCs, circulating monocytes and neutrophils of the innate immune system; the adaptive immune cells (T and B lymphocytes), as well as non-immune cells and organs, e.g. epithelial and endothelial cells, fibroblasts, brain, skeletal muscle, heart, lung, small intestine, liver, pancreas, colon, kidney, ovary, placenta, testis and prostate (17); (18).

MicroRNAs (miRNAs) have received considerable attention due to their involvement in the post-transcriptional regulatory mechanisms in almost all known cellular processes including development, differentiation, apoptosis, and the innate and adaptive immune responses to pathogen infections (19); (20); (21); (22); (23); (24); (25); (26). Besides, extracellular miRNAs secreted from the donor cells could be delivered into recipient cells via extracellular vesicles and exosomes to establish a cell-cell communication system during various physiological and pathological processes (27); (28); (29); (30); (31); (32). Selective miRNA studies in context to the regulation of TLRs suggest that miRNAs can modulate TLR signaling either through their involvement via transcriptional regulation or serving as physiological ligands of TLRs. Moreover, studies suggest that miRNA expression can be directly regulated by TLRs pathway (33). Interestingly, TLR activation modulates the expression of miRNAs that regulate TLR signaling either by the direct targeting of the molecules in the TLR pathway or indirectly through altering the activity of other cellular pathways that participate in crosstalk. The present review is highlighting the implication of TLRs in diseases and the emerging roles of microRNA (miRNA) in regulation of TLRs signaling.

3. PATHOPHYSIOLOGY OF TLR-SIGNALING

TLRs are the cell-surface initiators that trigger the inflammatory process. TLRs recognize conserved microbial-associated molecular patterns including LPS (TLR4), diacyl and triacyl lipopeptides, and zymosan (TLR2 associated with TLR1 or TLR6), peptidoglycan and lipoarabinomannan (TLR2), bacterial flagellin (TLR5), viral dsRNA (TLR3), viral or bacterial ssRNA (TLRs 7 and 8), HMGB1 (TLR2 and TLR4), and CpG-rich unmethylated DNA (TLR9) among others (34); (35); (36) (Figure 1). Several TLRs require to interact with their coreceptors to form homo- or heterodimers for ligand binding, such as TLR1 or TLR6 for TLR2, MD2 for TLR4, and CD14 for TLR2, TLR4, and TLR3 (37). Being a critical component of the inflammatory response system to pathogen invasion, TLR-signaling is regulated at multiple levels. These include binding of TLRs to ligands, cooperation with coreceptor molecules and dimerization, recruiting adaptor molecules upon ligand binding, leading to transcription factor activation and downstream signaling (38).

Figure 1

A schematic diagram is showing the Toll-like receptors (TLR) signaling pathway and downstream effector molecules. Depicted are key TLR molecules, their signaling adaptors and downstream mediators that are essential for TLR signaling and function. TLRs 1, 2, 4, 5 and 6 are expressed on the cell surface, while TLRs 3, 7, 8 and 9 are expressed intracellularly on endosomal membranes. Activation of the TLRs leads to recruitment of the adaptor molecules MyD88, TIRAP, TRIF and TRAM. Downstream signals involve TAK1, MAPKs, TRAF3, TBK1 and IKKs, resulting in nuclear translocation of transcriptions factors (AP-1, NF-κB, IRF-3 or IRF-7) into the nucleus and transcription of inflammatory genes.

Upon binding to the ligand two extracellular domains form an “m”-shaped structure sandwiching the ligand molecule and bringing the transmembrane and cytoplasmic domains close by to induce the downstream signals (39). After activation of TLR signaling pathways, the TIR domain recruits five different types of intracellular adaptor proteins including Myeloid differentiation primary response gene 88 (MyD88), Sterile α- and armadillo-motif-containing protein (SARM), TIR domain-containing adaptor protein (TIRAP or MAL), TIR domain-containing adaptor protein inducing IFN-β (TRIF) and TRIF-related adaptor molecule (TRAM) (2), (40); (41). Based on the recruited adaptor protein the TLR induced signaling cascade can be activated either by MyD88-dependent or by TRIF-dependent pathway (42); (43); (44); (45). Signaling through TLR1, TLR2, TLR5, TLR6, TLR7, TLR8, and TLR9 are activated via MyD88-dependent pathway that subsequently leads to the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and mitogen-associated protein kinase (MAPK) and produces the pro-inflammatory cytokines and chemokines (11). Activation through TIRAP is also linked via MyD88 and is associated with TLR2 and TLR4 (46); (47). TLR3-induced signaling is activated by the TRIF-dependent pathway and associated with the production of Interferon type-1 (6). Whereas TLR4 signaling is mediated by both MYD88-dependent as well as TRAM/TRIF dependent pathways (42); (6); (43), (48). In contrast, SARM negatively regulates TRIF thus controlling the TLR3 and TL4 signaling pathways (49); (50).

The interaction between a TLR and a microbial component triggers the initiation and the activation of the innate immune system, which not only initiates immediate host defensive responses such as inflammation but also prime and orchestrate antigen-specific adaptive immune responses (51). Upon engagement with PAMPs or DAMPs, TLRs recruit the adaptor proteins that lead to the activation of different transcription factors like NF-휅B, interferon regulatory factor IRF3, IRF7, activator protein-1 (AP1), and releasing the pro-inflammatory cytokines like tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1β and IL-6 and type 1 interferon (IFN-α,β), chemokines (CXCL8 and CXCL10), and antimicrobial peptides (52); (53); (54). Ultimately, all together they activate the adaptive immune system. Although the TLR-induced inflammatory cytokines are required as a part of the defense system to clear pathogens, however, the overproduction of many of these cytokines and chemokines are toxic and can cause pathological inflammation in the host. Overactivation of the TLR pathway disrupts the immune homeostasis through sustain pro-inflammatory cytokines and chemokines production and consequently contributes to the development of inflammatory and autoimmune diseases including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), Behcet's disease, chronic hepatitis B virus (HBV), sepsis, Alzheimer's disease, and even cancer (55); (56); (57); (58). Thus, fine-tuning of the TLR-signaling pathways is required to prevent excessive inflammation and maintain the homeostasis (53); (59); (60), even though the transcription factors and message translation can be regulated by post-transcriptional modification of the key proteins involved in the signaling cascade.

4. MicroRNA (miRNA) AND BIOGENESIS

miRNAs are small non-coding single-stranded RNA molecules with 18-24 nucleotides in length. miRNAs bind to the 3’ untranslated region (UTR) of the target mRNA leading to mRNA degradation, thus repressing translation of the respective targets (24). However, miRNAs are also known to interact with other regions, including the 5′ UTR and coding sequence and have silencing effects on gene expression (61); (62). Since a very short complementary sequence (6-8 nucleotide) is needed to bind to the target mRNA, a single miRNA can target hundreds or thousands of different mRNAs and thus being capable of controlling 30% of the human protein-encoding genes (63); (64). Ultimately, miRNAs in conjunction with other miRNAs and transcription factors post-transcriptionally regulate pathways and networks related to a variety of biological processes. Moreover, the interaction of miRNA with the promoter region has been also reported to modulate the gene expression (65).

The biogenesis of miRNAs is a complex process and is under tight temporal and spatial control. The dysregulation of miRNAs is found to be associated with the progression of multiple human diseases (27).; (66); (67); (68); (69); (70). miRNAs are transcribed from genomic DNA by RNA polymerases II and III, generating precursors primary miRNAs (pri-miRNAs) that undergo a series of cleavage events to form mature microRNA (71). The biogenesis starts with the processing of pri-miRNAs and follows either the canonical or non-canonical pathway. In the canonical pathway pri-miRNAs that are more than 200 nucleotides in length undergo a nuclear cleavage by an endonuclease complex consisting of RNase II enzyme Drosha and the DiGeorge critical region 8 protein (DGCR8) into a 60-70 nucleotide-long precursor miRNA (pre-miRNA) (72); (73); (74); (75). The pre-miRNA is exported to the cytoplasm in an Exportin5/RanGTP-dependent manner and undergo cleavage by the RNase III family enzyme Dicer into ~22 nucleotide-long mature microRNA duplex (76); (77); (78); (79). Finally, either of the 5p or 3p strands of the mature miRNA duplex known as guide strand is loaded into the Argonaute (AGO) family of proteins to form a miRNA-induced silencing complex (miRISC) (80). Whereas the non-canonical pathway can be grouped into Drosha/DGCR8-independent and Dicer-independent pathways (81). Mirtrons have a pre-miRNA that is defined by the entire length of the intron in which they are located and are produced during splicing as the first step in their biogenesis (82); (83). The pre-miRNA excised by splicing which is subsequently linearized by the debranching enzyme, Ldbr (DBR1 in humans), allowing the intron to form a structure that is exported to the cytoplasm by XPO5/RanGTP, recognized and cleaved by the Dicer complex to form a mature miRNA (84); (82); (85). Albeit, 7-methylguanosine (m7G)-capped pre-miRNA is processed by a Drosha-independent pathway. Initially, the pre-miRNAs are directly exported to the cytoplasm through PHAX/exportin-1 and finally cleaved by Dicer to a mature miRNA. After Dicer cleavage, only the 3p-miRNA is efficiently loaded onto Argonaute to form a functional microRNP (86). Dicer-independent miRNAs are processed by Drosha from endogenous short hairpin RNA (shRNA) transcripts to generate pre-miRNAs hairpin that is directly cleaved by Ago2 and followed by resection of its 3′ terminus (87). All pathways ultimately lead to a functional miRISC complex as a biologically active miRNA that binds 3’-UTR of the target mRNA which leads to mRNA degradation or repression of protein translation. In most cases, miRISC binds to target mRNAs leading to mRNA degradation or repression of protein translation (88); (89).

5. miRNAs AS MODULATORS OF TLR MEDIATED RESPONSE

Emerging pieces of evidence implicated the regulatory role of miRNA in biological and pathological processes including innate and adaptive immune responses (90). Although aberrant alterations in miRNA function are associated with the pathogenesis and progression of multiple human diseases (91); (92); (93); (94). Several studies indicated that miRNAs act as a key component of the complex immunoregulatory networks via modulating the expression of TLRs and multiple components of TLR-signaling pathways including signaling proteins, regulatory molecules, transcription factors, and cytokines (95); (96). Here we selectively highlighted a few miRNAs in context to their regulatory functions on TLR-signaling (Tables 1-2, Figure 1).

5.1. miRNAs in the regulation of TLR2

Studies revealed that TLR2 is highly expressed by lymphocytes and plasma cells and the expression is differentially regulated by different miRNAs. Also, TLR2 along with TLR4 is highly expressed in rheumatoid arthritis patients (55). In rheumatoid fibroblast-like synoviocytes, the expression of miR-19a/b is down-regulated with the upregulation of TLR2 and inflammatory cytokines associated with TLR2 signaling including IL-6 and matrix metalloproteinase 3 (MMP3) (97). In silico analysis data predicted that miR-105 has complementarity for TLR2 mRNA, and increased expression of miR-105 downregulates the production of inflammatory cytokines in human gingival keratinocytes (98). Also, miRNA-146a (miR-146a) plays an important role in endotoxin tolerance by downregulation of interleukin-1 receptor-associated kinase 1 (IRAK-1). miR-146a has shown to be upregulated in response to bacterial lipoprotein (BLP) and bacterial stimulation in both naive and BLP-tolerised human THP-1 promonocytic cells which is associated with downregulation of TLR2, TNFα and IRAK-1(99). Similarly, miR-143 blocks the TLR2 signaling pathways in human colorectal carcinoma cells and suppresses the invasion and migration of a subset of human CRC (100). Whereas, the treatment with LPS, synthetic lipid A, IL-1β, IL-2, IL-15, IFN-γ, and TNFα induced TLR2 gene expression in murine macrophages and promoted the inflammation and atherosclerosis (101) (102); (103). A recent study demonstrated that over-expression of miR-195 is involved in THP1 macrophage polarization, which reduces the levels of TLR2 along with pro-inflammatory cytokines (IL-1β, IL-6, and TNFα), and reduces phosphorylated forms of p54 JNK, p46 JNK and p38 MAPK (104). These studies suggest that miRNA-19a/b, miRNA-105, miRNA-143, miRNA-146a, and miR-195 act as a negative regulator of TLR2 expression and inflammation.

5.2. miRNAs in the regulation of TLR3

TLR3 is known to be conserved across the taxonomic kingdom and constitutively expressed by endosomes of myeloid and monocyte-derived dendritic cells (105). Studies have shown that the upregulation of TLR3 in macrophages induces the expression of IFN-β and TNFα, and promotes pristane-induced arthritis in rats, while inhibition of TLR3 reduces the severity of the disease (106). Further studies demonstrated that miR-26a-5p downregulates the expression of TLR3 in rat macrophages, whereas administration of miR-26a- mimic leads to the suppression of TLR3 protein expression and ameliorate arthritis in PIA rats (107). miR-155 has been known to be an important regulator of TLR3 signaling. Both endogenous miR-155 and virus-encoded miR-155 ortholog can inhibit IFN-β production by targeting the t-coding sequence of TLR3 in macrophages (108). Similarly, miR-223 regulates TLR3 expression in granulocyte and regulates the inflammatory response in mice (109)

5.3. miRNAs in the regulation of TLR4

TLR4 recognizes intrinsic mediators including heat-shock proteins and high-mobility group box-1 as well as LPS of gram-negative bacteria. Initial studies involving the role of miRNAs in immune response prevailed that let7i, a member of the let7 family regulate the expression of TLR4 in human biliary epithelial cells (cholangiocytes) through post-transcriptional suppression (110). The expression of let7i is decreased via a MyD88/NF-κB dependent mechanism with increased expression of TLR4 and TLR4-IKK2-signaling promotes the SNAP23-associated vesicular exocytotic process (111). Cryptosporidium parvum infection in non-malignant human cholangiocytes induces the luminal release of exosomes from the biliary and intestinal epithelium as a part of the microbial defense with reduced expression of miRNAs including let-7i, let-7d, let-7f, let-7e, and miR-98, and an increase in phosphorylation of SNAP23. Later studies have demonstrated that the parasitic protozoan C. parvum infection or LPS stimulation reduces the expression of let7 and miR-98, and also stimulates the expression of the Src homology 2-containing protein (CIS), an important negative regulator for inflammatory cytokine signaling in cholangiocytes ((112). In mouse macrophages, overexpression of let7e reduces the expression of TLR4 whereas inhibition of let7e induces the expression of TLR4 (113).

LPS treatment reduces the expression of miR-223-3P and miR-2909 in human adipose stem cells, while promotes the production of pro-inflammatory cytokines (IL-6, IL-1β, and TNFα) through TLR4/TLR2/NF-κB-signal transducer and activator of transcription (STAT)-3 signaling pathways. Also, miR-2909 regulates the expression of IL-6, IL-1β, and TNFα. STAT3 directly targets TLR4 and TLR2, and promote the production of IL-6. Similarly, TNFα promotes the expression of miR-223-3p which inhibits Stat3 and led to a negative feedback loop regulation of TNF-α secretion via the LPS/TLR2/TLR4/STAT3 signaling pathway (114). Also, miRNA-223 attenuates LPS-induced inflammation in an acute lung injury model by suppressing the TLR4/NF-κB signaling pathway (115).

miR-146a inhibits both LDL accumulation and inflammatory response by negatively regulating TLR4 and thereby inhibiting the activation of TLR4-dependent signaling pathways in macrophages (116). Moreover, miR-146a inhibits the proliferation and inflammatory response of rheumatoid arthritis or fibroblast-like synoviocytes by down-regulating the TLR4/NF-κB pathway (117). Furthermore, miR-146 directly targets IRAK1 and TRAF6, which are key adapter molecules in the TLR4/NF-κB pathway (118). Similarly, miR-511 is highly expressed in differentiating dendritic cells and macrophages and acts as a negative regulator of TLR4 (119).

miR-21 is a multifunctional RNA and overexpressed under inflammatory conditions. Studies showed that miR-21 targets pro-inflammatory protein PDCD4 and acts as a negative regulator of TLR4 in LPS-treated mouse murine macrophage ((120). In primary human lung cancer cells, LPS treatment increases the expression of miR-21 which promotes TLR4 and reactive oxygen species expression (121). In human lung transplants, miR-21 causes severe pathogenesis of primary graft dysfunction through the TLR4-signaling pathway (122). miR-100-5p was found to be expressed in follicular dendritic cells. Inhibition of miR-100-5p significantly enhanced expression of IL6, Ptgs1/2, and TLR4 mRNA in dendritic cells suggesting an indirect role of miR-100-5p in TLR4 signaling (123).

5.4. miRNAs in the regulation of TLR7 and TLR8

Besides the role of cellular miRNAs in TLR signaling, recent reports established an intriguing role of extracellular miRNAs in the binding and activation of intracellular TLRs (124). TLR7 recognizes viral RNA following endocytosis, an immune response, that is characterized by Type I IFN and pro-inflammatory cytokine production, whereas reduced expression of TLR7 is associated with a poor response to IFNs (125). In severe asthma, TLR7 deficiency is associated with elevated expression of miR-150-5p, mir-152-5p, and miR-375-5p in alveolar macrophages. Ex vivo knockdown of these microRNAs restored TLR7 expression with an increased IFN response to the virus (126). An elevated level of let-7b from the cerebrospinal fluid (CSF) from individuals with Alzheimer's disease activates the TLR7 and induces neurodegeneration in mice model (30). In a breast cancer mouse model, the specific delivery of let-7b efficiently reprogrammed the functions of tumor-associated macrophages (TAMs) and tumor-infiltrating dendritic cells (TIDCs), reversed the suppressive tumor microenvironment, and inhibited tumor growth by acting as a TLR-7 agonist and suppressing IL-10 production (127).

Other studies showed that tumor-secreted miR-21 and miR-29a bind as ligands to murine TLR7 and human TLR8, in immune cells, triggering a TLR-mediated pro-metastatic inflammatory response that leads to tumor growth and metastasis (28). miR-21 was also demonstrated to induce myoblast apoptosis in cancer cachexia via a TLR7-c-Jun N-terminal kinase-dependent pathway (128). In a mouse model of Acute graft-versus-host disease showed that the circulating extracellular miR-29a activates dendritic cells via TLR7 and TLR8, resulting in the activation of the NF-κB pathway and secretion of proinflammatory cytokines TNFα and IL-6 (129). Moreover, miR-21 released from the synovial tissue mediates knee OA pain through TLR7 activation in the surgical OA rat model (130).

Interestingly, in dorsal root ganglion (DRG) neurons, the extracellular let-7b couples with TRPA1 ion channel and support rapid excitation of nociceptor neurons via TLR7 and induces rapid inward currents and action potentials (131). The let-7b coupling with TRPA1 requires a core GU-rich motif (GUUGUGU motif), similar to HIV ssRNA40 (132). The GU-rich motif is required to bind to both TLR7 and TLR8 (133); (134); (135); (136). Moreover, the GU-rich motifs also contribute to the immune stimulation, and modification of this motif is an effective mechanism in preventing immune stimulation of endogenous miR-122 (137); (138).

During viral infection, viral miRNAs can also activate pro-inflammatory cytokines through TLR pathways. Studies showed that TLR8 signaling stimulates monocytes to express type I interferon and cytokines and promotes CD4+ T helper 1 (TH1) cell differentiation, whereas TLR7 signaling promotes the production of cytokines and induces TH17 cell differentiation (139). DNA virus-encoded miRNAs (e.g., KSHV-miR-K-10b, KSHV-miR-K12-12) are involved in sepsis by interacting with TLR8 as agonists and promote the secretion of IL-6 and IL10 that leads to increased inflammation and subsequent immunosuppression (140); (141). Epstein-Barr virus infection has been associated with the development of a variety of human malignancies, including several types of lymphoma, lymphoproliferative disorder, and nasopharyngeal carcinoma (142). Viral miRNA BHRF1-1 is expressed significantly higher in plasma of patients with chronic lymphocytic leukemia (CLL), and BHRF1-1 expression in B cells of patients with CLL causes a shorter overall survival rate (143); (144).

5.5. TLR-signaling in the regulation of miRNAs

Various studies have demonstrated that both TLRs and miRNA are differentially express and interdependent in the regulation of pathogenic infection, endotoxin sensitivity, and tolerance in the innate immune system. The pathogenic gram-negative bacteria, Francisella, is recognized on the host cell surface by TLR2, recruiting the adaptor protein MyD88, and activating MAPKs, PI3K, and Akt pathways, which leads to enhanced NF-κB activity, inflammatory cytokine production, as a part of an effective host response. Src homology 2 domain-containing inositol polyphosphate-5-phosphatase 1 (SHIP1) acts as a critical modulator and negatively regulates the activation of Akt to prevent effective host response. During Francisella infection, miR-155 is induced through the TLR signaling pathway, in turn, down-regulates SHIP1 to promote the activation of the PI3K/Akt pathway and inflammatory cytokine production in human monocytes (145). Also in macrophages infected with Leishmania RNA virus 1 (LRV1), miR-155 expression is dependent on TLR-3/TRIF signaling which enhances macrophage survival through Akt activation (146). In immortalized bone marrow-derived macrophages, IL-10 inhibits TLR-induced expression of miR-155 from the BIC gene in a STAT3-dependent manner leading to the elevated expression of SHIP1 (147). Similarly, in human plasmacytoid dendritic cells, TLR7 induces the expression of miR-155 through the c-Jun N-terminal kinase pathway. miR-155 augmented interferon-α/β expression by suppressing IRAKM, whereas miR-155 inhibited their expression by targeting TAB2. Both were inversely regulated by autocrine/paracrine type I interferon and TLR7-activated KHSRP at the posttranscriptional level (148).

In non-parenchymal liver cells (NPCs), IL-10 or TGF-β potently reduces the expression of TLR3 and TLR3 dependent miR-155 expressions and suppression of the transcription factors IRF-3 and NF-κB which regulate antiviral and inflammatory activity (149). IL-10 also suppresses Ets2 expression which is a TLR regulated gene and thereby inhibits the induction of miR-155 by LPS (150). In primary murine macrophages, treatment with polyriboinosinic:cpolyribocytidylic (16) acid or the cytokine IFN-β, miR-155 is substantially up-regulated through several TLR ligands including myeloid differentiation factor 88- or TRIF-dependent pathways. miR-155-induce signals through the JNK pathway (151). Studies have shown that in rheumatoid synovial fibroblasts, TNF-α stimulation induces the expression of miR-155 and inhibits IL-6-mediated JAK2/STAT3 activation (152). Similarly, treatment of human dermal lymphatic endothelial cells (HDLECs) and dermal fibroblast with the pro-inflammatory cytokines IFN-γ and TNFα synergistically up-regulated miR-155 expressions which suppresses the programmed death ligand-1 (PD-L1) expression (153). The serum TNFα and miR-155-5p are upregulated in patients with subacute thyroiditis. TNFα inhibits proliferation and induce apoptosis of rat thyroid follicle FRTL-5 cells through modulating the IL-6-JAK2/STAT3 pathway and miR-155-5p signaling (154). TNFα negatively regulates ectopic bone formation by regulating BMP signaling. Study in MC3T3-E1 cells showed that TNFα is up-regulated miR-155 expression, whereas knockdown of miR-155 partially mitigated the inhibition of TNFα on BMP-2-induced osteogenic differentiation (155). TNFα dependent osteogenic differentiation is through SOCS1 and the SAPK/JNK pathway. Similarly, progesterone can inhibit TLR4 dependent immune response and down-regulates LPS- and poly(I:C)-induced miR-155 expression in macrophages which inhibits TLR-induced IL-6 and IFN-β via increased SOCS1 expression (156).

Studies have demonstrated that Staphylococcal enterotoxin B (SEB) inhalation results in acute inflammatory lung injury with overexpression of miR-155 and IFNγ, whereas suppression of SOCS1 (157). Similarly, IκK-16 treatment of primary human monocytes decreases miR-155 expression and decreases the secretion of TNFα and IL-10, ultimately attenuates the monocyte inflammatory response (158). Moreover, hypothermia induces an increase in miR-155 expression and reduced production of IL-10, Ship1, and SOCS1 while the expression of proinflammatory cytokines is increased in monocytes and macrophages (159). In ischemia-induced cerebral inflammation, miR-155 promotes TNFα and IL-1β expression through TLR4 expression and inhibition of MyD88 and SOCS1 expression (160). Another study revealed that stimulation of monocyte-derived macrophages reduces their susceptibility to HIV-1 infection through TLR3 or TLR4 by inducing the expression of miR-155 (161). The nuclear protein HMGB1 induces the TLR2 mediated and MyD88-dependent upregulation of miR-155 with a decreased expression of Ets-1 during double-stranded antibody induction involved in the pathogenesis of SLE (162).

Studies are further demonstrated that LPS dependent activation of protein kinase Akt1 promotes miRNAs let-7e and miR-181c expressions, whereas downregulate miR-155 and miR-125b. Both miRNA and TLRs are differentially regulated with interdependent manner such as Let-7e repress TLR4, whereas miR-155 repress SOCS1 (113). Several other transcription factors such as Foxo3a regulates apoptosis by negatively targeting miR-21, whereas Foxo1 and Foxo3a positively regulate miR-145 in renal tumor development (163); (164). miR-145 serves as a key component of the Foxo-Mxi1-SRα/miR-145 axis as a major inhibitor of renal tumor development. Similarly, miRNA-27b-3p and miRNA-455-3p promote cancer cell quiescence by facilitating the stabilization of p27 (165). Another study showed that angiopoietin-1 (Ang-1) disrupts TLR4 signaling with inhibition of LPS-induced inflammatory responses in endothelial cells through selective targeting of IRAK1 and TRAF6 proteins by miR-146b-5p (166).

Studies also implicated that TLR4 is up-regulated in LPS-treated human polymorphonuclear neutrophils (PMN) and monocytes and induces the transcription of miR-9 in a MyD88- and NF-kB-dependent manner. miR-9 is also induced by TLR2 and TLR7/8 agonists and by the proinflammatory cytokines TNF-α and IL-1β, but not by IFN-γ (Bazzoni et al, 2009). Also, miR-147 was induced upon stimulation of multiple TLRs (TLR2/3 and 4) in LPS-treated murine macrophages while stimulation of TLR4 was more effective in inducing miR-147 expression. TLR4-induced miR-147 expression needs activation of both NF-κB and IRF3 to prevent excessive inflammatory responses (Liu et al, 2009; 19721002).

6. CONCLUSIONS

TLRs are the key innate immune PRRs and are tightly regulated system to ensure a host immune response to foreign invaders. At present, our understanding of the complex biology of the miRNAs in innate immunity is limited and functional studies remain a work in progress. We have provided some of the experimental shreds of evidence supporting a conserved role for the miRNAs in TLR-signaling or vise-versa. However, the individual miRNAs are likely to have functionally different effects compared to the TLRs, since a single miRNA may have overlapping functions in modulating gene expression. Moreover, miRNAs regulate TLR signaling at different levels by targeting multiple molecules involved in the TLR pathway, such as the expression of TLRs themselves, TLR recruited adaptor molecules, TLR-induced signaling cascade proteins, transcription factors, and even the pro-inflammatory cytokines of TLR signaling. Both intracellular and extracellular miRNAs can modulate TLR signaling pathways mainly either through their involvement via transcriptional regulation or serving as physiological ligands of TLRs. Given that crosstalk between the miRNAs and TLR signaling pathways suggesting further studies are needed for designing new therapies that target specific signaling pathways which could restore the adequate immune response necessary to address an invading pathogen.

7. ACKNOWLEDGMENTS

This study was supported in part by National Institutes of Health Grants 1SC3 GM113751, U54 MD007602 and G12-MD007602. This investigation was conducted in a facility constructed with support from Research Facilities Improvement Grant #C06 RR018386 from NIH/NCRR.

Table 1 The regulatory role of miRNA in TLR signaling pathway in Inflammatory diseases
mRNA Seed sequence Chromosome location Target Targets /Signaling molecules/pathway References
hsa-miR-19a aguuuugcauaguugcacuaca chr13: 91350891-91350972 [+] TLR2 ↓ IL6 & MMP3 97
hsa-miR--19b ugugcaaauccaugcaaaacuga chrX: 134169671-134169766 [-] TLR2↓ IL6 & MMP3 97
hsa-miR-105 ucaaaugcucagacuccuguggu chrX: 152392219-152392299 [-] TLR2 & TLR4 ↓ IL6 & TNFα 98
hsa-miR-146a ugagaacugaauuccauggguu chr5: 160485352-160485450 [+] TLR2, TLR4 ↓ IL1, IRAK1, TNFα/NFkB 99, 117, 116, 118
hsa-miR-143 ggugcagugcugcaucucuggu chr5: 149428918-149429023 [+] TLR2 ↓ CD44, KLF5, & BRAF 100
hsa-miR-195 uagcagcacagaaauauuggc chr17: 7017615-7017701 [-] TLR2 ↓ IL-1β, IL-6 & TNFα 104
rno-miR-26a uucaaguaauccaggauaggcu chr8: 127714441-127714530 [+] TLR3 ↓ IFNβ & TNFα 107
mmu-miR-223 cguguauuugacaagcugaguug chrX: 96242817-96242926 [+] TLR3 ↓ IL-1β, MCP-1, IL-8 & IL-18 109
gga-miR-155 rno-miR-26a uuaaugcuaaucgugauagggg chr1: 102485099-102485161 [+] TLR3 ↓ IFN-β 108
hsa-miR-let7i ugagguaguaguuugugcuguu chr12: 62603686-62603769 [+] TLR4 ↓ MyD88/NF-kappaB, Ikk2 110, 111
hsa-miR-let7d agagguaguagguugcauaguu chr9: 94178834-94178920 [+] TLR4 ↓ SNAP23 111
hsa-miR-let-7f ugagguaguagauuguauaguu chrX: 53557192-53557274 [-] TLR4 ↓ SNAP23 111
hsa-miR-Let7e ugagguaggagguuguauaguu chr19: 51692786-51692864 [+] TLR4 ↓ SNAP23 111, 112
hsa-miR-98 ugagguaguaaguuguauuguu chrX: 53556223-53556341 [-] TLR4 ↓ SNAP23 111, 112
hsa-miR-223-3P cguguauuugacaagcugaguu chrX: 66018870-66018979 [+] TLR4 ↓ IL-6, IL-β, TNFα/NFkB/STAT3 114, 115
hsa-miR-2909 guuagggccaacaucucuugg chr17: 37033745-37033813 [+] TLR2/TLR4 ↓ IL-6, IL-β, TNFα/NFkB/STAT3 114
hsa-miR-511 gugucuuuugcucugcaguca chr10: 17845107-17845193 [+] TLR4 ↓ 119
mmu-miR-21a uagcuuaucagacugauguuga chr11: 86584067-86584158 [-] TLR4 ↓ IL-6, NF-kB/MY-88/PDCD4 120
hsa-miR-21 uagcuuaucagacugauguuga chr17: 59841266-59841337 [+] TLR4 ↓ IRAK3 & CXCL10 122, 121 123
mmu-miR-100-5p aacccguagauccgaacuugug chr9: 41531425-41531504 [+] TLR4 ↓ Il6, Ptgs1/2 123
hsa-miR-150-5p ucucccaacccuuguaccagug chr19: 49500785-49500868 [-] TLR7 ↓ IFN-β & IFN-α 126
hsa-miR-152-5p agguucugugauacacuccgacu chr17: 48037161-48037247 [-] TLR7 ↓ IFN-β & IFN-α 126
hsa-miR-375-5p gcgacgagccccucgcacaaacc chr2: 219001645-219001708 [-] TLR7 ↓ IFN-β & IFN-α 126
let-7b ugagguaguagguugugugguu chr22: 46113686-46113768 [+] TLR-7 ↓ TNF-α / My88/TRPA1 30, 131
hsa-miR-21 uagcuuaucagacugauguuga chr17: 59841266-59841337 [+] TLR7/TLR8 ↓ IL-6, TNF-α 28
mmu-miR-21a uagcuuaucagacugauguuga chr11: 86584067-86584158 [-] TLR7 ↓ c-jun_N-terminal kinase 128
hsa-miR-29a acugauuucuuuugguguucag chr7: 130876747-130876810 [-] TLR7/TLR8 ↓ IL-6, TNF-α 28
mmu-miR-29a acugauuucuuuugguguucag chr6: 31062660-31062747 [-] TLR7/TLR8 ↓ IL-6, TNF-α/NF-kB 129
kshv-miR-K12-12 aaccaggccaccauuccucuccg KSU75698: 117674-117771 [-] TLR8 ↓ IL-6 & IL-10 140
kshv-miR-K12-10b ugguguuguccccccgaguggc TLR-8 ↓ IL-6 & IL-10 140
Table 2 The regulatory effect of TLR and Cytokines on miRNA in inflammatory diseases
Inducer TLRs miRNA Signaling Molecule Signaling pathway Reference
TLR2 miR-155↑ SHIP1 ↓ TLR2/MY88/PI3K & MAPKs/NF-kB 145
TLR3 miR- 155 ↑ IFN-β ↑ TLR3/TRIF/AKT 146
IL-10 TLR4 miR- 155↓ SHIP ↑ STAT3 147
TLR7 miR-155 ↑ miR-155* ↑ TAB2↓ IRAKM ↓ c-jun N-terminal kinase 148
IL-10/TGFβ TLR3 155↓ IRF-3/NF-kB 149
IL-10 miR-155↓ ETS2↓ 150
IFN-β miR-155↑ MY88/TRIF/JNK pathway 151
TNF-α miR-155↑ IL6-JAK2_STAT3↓ 152
IFN-γ & TNF-α miR-155↑ PD-L1↓ 153
TNF-α miR-155↑ SOCS1↓ SAPK/JNK 80
Pregesterone TLR4 miR-155↓ SOCS↑ 156
SEB miR-155↑ SOCS1↓ 157
Ikk16 155↓ IL-6, TNF-α↓ 158
hypothermia miR-155↑ IL-10, SHIP1, SOCS1↓ 159
Angp1 miR-146b-5p ↑ IRAK1& TRAF6↓ 166
HMGB1 TLR2 miR-155 Ets1↓ TLR2-My88 162
LPS TLR4 let7e↑ miR181c↑ miR-155 ↓ miR-125b ↓ SOCS1↓ 113
Foxo3a miR-21 ↓ 163
Foxo3a & Foxo1 miR-145 ↑ 164
LPS TLR3 TLR4 miR-155 ↑ ADAM10, TNPO3, Nup153, LEDGF/p75 ↓ 161
Abbreviations
AbbreviationExpansionAP1

activator protein-1

AGO

argonaute

BLP

bacterial lipoprotein

CSF

cerebrospinal fluid

DAMPs

damage-associated molecular patterns

DGCR8

Drosha and the DiGeorge critical region 8 protein

HBV

hepatitis B virus

IL

interleukin

IRAK-1

interleukin-1 receptor-associated kinase 1

LRR

leucine-rich repeat region

LPS

lipopolysaccharide

MMP3

matrix metalloproteinase 3

miRNAs

MicroRNAs

miRISC

miRNA-induced silencing complex

MAPK

mitogen-associated protein kinase

MyD88

Myeloid differentiation primary response gene 88

NF-κB

nuclear factor kappa-light-chain-enhancer of activated B cells

PAMPs

pathogen-associated molecular patterns

pri-miRNAs

primary miRNAs

RA

rheumatoid arthritis

SHIP1

Src homology 2 domain-containing inositol polyphosphate-5-phosphatase 1

SARM

Sterile α- and armadillo-motif-containing protein

SLE

systemic lupus erythematosus

TH1

T helper 1

TIRAP or MAL

TIR domain-containing adaptor protein

TRIF

TIR domain-containing adaptor protein inducing IFN-β

TIR

Toll/Interleukin-1 (IL-1) receptor

TLRs

Toll-like receptors

TRAM

TRIF-related adaptor molecule

TNF-α

tumor necrosis factor-alpha

TAMs

tumor-associated macrophages

TIDCs

tumor-infiltrating dendritic cells

UTR

untranslated region.

References
[1]
ChaplinD. D Overview of the immune responseJ Allergy Clin Immunol20101252 Suppl 2S323DOI: 10.1016/j.jaci.2009.12.980
[2]
AkiraS TakedaK Toll-like receptor signallingNat Rev Immunol200447499511DOI: 10.1038/nri1391
[3]
KawaiT AkiraS TLR signalingSemin Immunol20071912432 DOI: 10.1016/j.smim.2006.12.004
[4]
ElwardK GasqueP "Eat me" and "don't eat me" signals govern the innate immune response and tissue repair in the CNS: emphasis on the critical role of the complement systemMol Immunol2003402-48594DOI: 10.1016/s0161-5890(03)00109-3
[5]
TakedaK KaishoT AkiraS Toll-like receptorsAnnu Rev Immunol20032133576DOI: 10.1146/annurev.immunol.21.120601.141126
[6]
KawaiT AkiraS The role of pattern-recognition receptors in innate immunity: update on Toll-like receptorsNat Immunol201011537384DOI: 10.1038/ni.1863
[7]
BellJ. K MullenG. E LeiferC. A MazzoniA DaviesD. R SegalD. M Leucine-rich repeats and pathogen recognition in Toll-like receptorsTrends Immunol2003241052833DOI: 10.1016/s1471-4906(03)00242-4
[8]
Singh K Kant S Singh V. K Agrawal N. K Gupta S. K Singh K Toll-like receptor 4 polymorphisms and their haplotypes modulate the risk of developing diabetic retinopathy in type 2 diabetes patients Mol Vis 2014 20 704 13
[9]
KawaiT AkiraS Toll-like receptors and their crosstalk with other innate receptors in infection and immunityImmunity201134563750DOI: 10.1016/j.immuni.2011.05.006
[10]
WangY SongE BaiB VanhoutteP. M Toll-like receptors mediating vascular malfunction: Lessons from receptor subtypesPharmacol Ther201615891100DOI: 10.1016/j.pharmthera.2015.12.005
[11]
YamamotoM TakedaK Current views of toll-like receptor signaling pathwaysGastroenterol Res Pract20102010240365DOI: 10.1155/2010/240365
[12]
GayN. J SymmonsM. F GangloffM BryantC. E Assembly and localization of Toll-like receptor signalling complexesNat Rev Immunol201414854658DOI: 10.1038/nri3713
[13]
SellgeG KuferT. A PRR-signaling pathways: Learning from microbial tacticsSemin Immunol20152727584DOI: 10.1016/j.smim.2015.03.009
[14]
McGettrickA. F O'NeillL. A Localisation and trafficking of Toll-like receptors: an important mode of regulationCurr Opin Immunol2010221207DOI: 10.1016/j.coi.2009.12.002
[15]
OosenbrugT GraaffM. J. van de RessingM. E KasterenS. I. van Chemical Tools for Studying TLR Signaling DynamicsCell Chem Biol2017247801812DOI: 10.1016/j.chembiol.2017.05.022
[16]
MatsumotoM TLR3T. Seya interferon induction by double-stranded RNA including poly(I:C)Adv Drug Deliv Rev200860780512DOI: 10.1016/j.addr.2007.11.005
[17]
DelnesteY BeauvillainC JeanninP [Innate immunity: structure and function of TLRs]Med Sci (Paris)20072316773DOI: 10.1051/medsci/200723167
[18]
ZaremberK. A GodowskiP. J Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokinesJ Immunol2002168255461DOI: 10.4049/jimmunol.168.2.554
[19]
CalinG. A LiuC. G SevignaniC FerracinM FelliN DumitruC. D ShimizuM CimminoA ZupoS DonoM Dell'AquilaM. L AlderH RassentiL KippsT. J BullrichF NegriniM CroceC. M MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemiasProc Natl Acad Sci U S A2004101321175560DOI: 10.1073/pnas.0404432101
[20]
Leva G. Di Garofalo M Croce C. M MicroRNAs in cancer Annu Rev Pathol 2014 9 287 314 DOI: 10.1146/annurev-pathol-012513-104715
[21]
FabbriM PaoneA CaloreF GalliR CroceC. M A new role for microRNAs, as ligands of Toll-like receptorsRNA Biol201310216974DOI: 10.4161/rna.23144
[22]
MehtaA BaltimoreD MicroRNAs as regulatory elements in immune system logicNat Rev Immunol201616527994DOI: 10.1038/nri.2016.40
[23]
RooijE. van OlsonE. N MicroRNA therapeutics for cardiovascular disease: opportunities and obstaclesNat Rev Drug Discov2012111186072DOI: 10.1038/nrd3864
[24]
MicroRNAsD. P. Bartel target recognition and regulatory functionsCell2009136221533DOI: 10.1016/j.cell.2009.01.002
[25]
FabianM. R SonenbergN FilipowiczW Regulation of mRNA translation and stability by microRNAsAnnu Rev Biochem20107935179DOI: 10.1146/annurev-biochem-060308-103103
[26]
ChenC. Z SchaffertS FragosoR LohC Regulation of immune responses and tolerance: the microRNA perspectiveImmunol Rev2013253111228DOI: 10.1111/imr.12060
[27]
BayraktarR PichlerM KanlikilicerP IvanC BayraktarE KahramanN AslanB OguztuzunS UlasliM ArslanA CalinG Lopez-BeresteinG OzpolatB MicroRNA 603 acts as a tumor suppressor and inhibits triple-negative breast cancer tumorigenesis by targeting elongation factor 2 kinaseOncotarget2017871164111658DOI: 10.18632/oncotarget.14264
[28]
FabbriM PaoneA CaloreF GalliR GaudioE SanthanamR LovatF FaddaP MaoC NuovoG. J ZanesiN CrawfordM OzerG. H WernickeD AlderH CaligiuriM. A Nana-SinkamP PerrottiD CroceC. M MicroRNAs bind to Toll-like receptors to induce prometastatic inflammatory responseProc Natl Acad Sci U S A201210931E21106DOI: 10.1073/pnas.1209414109
[29]
Gonzalez-VillasanaV RashedM. H Gonzalez-CantuY BayraktarR Menchaca-ArredondoJ. L Vazquez-GuillenJ. M Rodriguez-PadillaC Lopez-BeresteinG Resendez-PerezD Presence of Circulating miR-145, miR-155, and miR-382 in Exosomes Isolated from Serum of Breast Cancer Patients and Healthy DonorsDis Markers201920196852917DOI: 10.1155/2019/6852917
[30]
LehmannS. M KrugerC ParkB DerkowK RosenbergerK BaumgartJ TrimbuchT EomG HinzM KaulD HabbelP KalinR FranzoniE RybakA NguyenD VehR NinnemannO PetersO NitschR HeppnerF. L GolenbockD SchottE PloeghH. L WulczynF. G LehnardtS An unconventional role for miRNA: let-7 activates Toll-like receptor 7 and causes neurodegenerationNat Neurosci201215682735DOI: 10.1038/nn.3113
[31]
RashedM. H KanlikilicerP Rodriguez-AguayoC PichlerM BayraktarR BayraktarE IvanC FilantJ SilvaA AslanB DenizliM MitraR OzpolatB CalinG. A SoodA. K Abd-EllahM. F HelalG. K BeresteinG. L Exosomal miR-940 maintains SRC-mediated oncogenic activity in cancer cells: a possible role for exosomal disposal of tumor suppressor miRNAsOncotarget20178122014520164DOI: 10.18632/oncotarget.15525
[32]
SquadritoM. L BaerC BurdetF MadernaC GilfillanG. D LyleR IbbersonM PalmaM. De Endogenous RNAs modulate microRNA sorting to exosomes and transfer to acceptor cellsCell Rep201485143246DOI: 10.1016/j.celrep.2014.07.035
[33]
OlivieriF RippoM. R PrattichizzoF BabiniL GraciottiL RecchioniR ProcopioA. D Toll like receptor signaling in "inflammaging": microRNA as new playersImmun Ageing201310111DOI: 10.1186/1742-4933-10-11
[34]
HoebeK DuX GeorgelP JanssenE TabetaK KimS. O GoodeJ LinP MannN MuddS CrozatK SovathS HanJ BeutlerB Identification of Lps2 as a key transducer of MyD88-independent TIR signallingNature200342469507438DOI: 10.1038/nature01889
[35]
KumarH KawaiT AkiraS Pathogen recognition in the innate immune responseBiochem J20094201116DOI: 10.1042/BJ20090272
[36]
AyresJ. S SchneiderD. S Tolerance of infectionsAnnu Rev Immunol20123027194DOI: 10.1146/annurev-immunol-020711-075030
[37]
LeeC. C AvalosA. M PloeghH. L Accessory molecules for Toll-like receptors and their functionNat Rev Immunol201212316879DOI: 10.1038/nri3151
[38]
LeiferC. A MedvedevA. E Molecular mechanisms of regulation of Toll-like receptor signalingJ Leukoc Biol20161005927941DOI: 10.1189/jlb.2MR0316-117RR
[39]
BotosI SegalD. M DaviesD. R The structural biology of Toll-like receptorsStructure201119444759DOI: 10.1016/j.str.2011.02.004
[40]
CartyM GoodbodyR SchroderM StackJ MoynaghP. N BowieA. G The human adaptor SARM negatively regulates adaptor protein TRIF-dependent Toll-like receptor signalingNat Immunol2006710107481DOI: 10.1038/ni1382
[41]
KennyE. F O'NeillL. A Signalling adaptors used by Toll-like receptors: an updateCytokine20084333429DOI: 10.1016/j.cyto.2008.07.010
[42]
BarbalatR LauL LocksleyR. M BartonG. M Toll-like receptor 2 on inflammatory monocytes induces type I interferon in response to viral but not bacterial ligandsNat Immunol2009101112007DOI: 10.1038/ni.1792
[43]
FaureE EquilsO SielingP. A ThomasL ZhangF. X KirschningC. J PolentaruttiN MuzioM ArditiM Bacterial lipopolysaccharide activates NF-kappaB through toll-like receptor 4 (TLR-4) in cultured human dermal endothelial cells. Differential expression of TLR-4 and TLR-2 in endothelial cellsJ Biol Chem2000275151105863DOI: 10.1074/jbc.275.15.11058
[44]
JanewayC. A MedzhitovR Innate immune recognitionAnnu Rev Immunol200220197216DOI: 10.1146/annurev.immunol.20.083001.084359
[45]
JinM. S LeeJ. O Structures of the toll-like receptor family and its ligand complexesImmunity200829218291DOI: 10.1016/j.immuni.2008.07.007
[46]
MansellA BrintE GouldJ. A O'NeillL. A HertzogP. J Mal interacts with tumor necrosis factor receptor-associated factor (TRAF)-6 to mediate NF-kappaB activation by toll-like receptor (TLR)-2 and TLR4J Biol Chem2004279363722730DOI: 10.1074/jbc. C400289200
[47]
BernardN. J O'NeillL. A Mal, more than a bridge to MyD88IUBMB Life201365977786DOI: 10.1002/iub.1201
[48]
McGettrickA. F BrintE. K Palsson-McDermottE. M RoweD. C GolenbockD. T GayN. J FitzgeraldK. A O'NeillL. A Trif-related adapter molecule is phosphorylated by PKC{epsilon} during Toll-like receptor 4 signalingProc Natl Acad Sci U S A2006103249196201DOI: 10.1073/pnas.0600462103
[49]
CouillaultC PujolN ReboulJ SabatierL GuichouJ. F KoharaY EwbankJ. J TLR-independent control of innate immunity in Caenorhabditis elegans by the TIR domain adaptor protein TIR-1, an ortholog of human SARMNat Immunol20045548894DOI: 10.1038/ni1060
[50]
TroutmanT. D HuW FulenchekS YamazakiT KurosakiT BazanJ. F PasareC Role for B-cell adapter for PI3K (BCAP) as a signaling adapter linking Toll-like receptors (TLRs) to serine/threonine kinases PI3K/AktProc Natl Acad Sci U S A201210912738DOI: 10.1073/pnas.1118579109
[51]
PalmN. W MedzhitovR Pattern recognition receptors and control of adaptive immunityImmunol Rev2009227122133DOI: 10.1111/j.1600-065X.2008.00731.x
[52]
BrozP MonackD. M Newly described pattern recognition receptors team up against intracellular pathogensNat Rev Immunol201313855165DOI: 10.1038/nri3479
[53]
HeX JingZ MicroRNAsG. Cheng new regulators of Toll-like receptor signalling pathwaysBiomed Res Int20142014945169DOI: 10.1155/2014/945169
[54]
NewtonK DixitV. M Signaling in innate immunity and inflammationCold Spring Harb Perspect Biol201243DOI: 10.1101/cshperspect.a006049
[55]
HuangQ. Q PopeR. M The role of toll-like receptors in rheumatoid arthritisCurr Rheumatol Rep200911535764DOI: 10.1007/s11926-009-0051-z
[56]
JialalI KaurH DevarajS Toll-like receptor status in obesity and metabolic syndrome: a translational perspectiveJ Clin Endocrinol Metab20149913948DOI: 10.1210/jc.2013-3092
[57]
Isaza-CorreaJ. M LiangZ BergA. van den DiepstraA VisserL Toll-like receptors in the pathogenesis of human B cell malignanciesJ Hematol Oncol2014757DOI: 10.1186/s13045-014-0057-5
[58]
DevarajS YunJ. M Duncan-StaleyC. R JialalI Low vitamin D levels correlate with the proinflammatory state in type 1 diabetic subjects with and without microvascular complicationsAm J Clin Pathol2011135342933DOI: 10.1309/AJCPJGZQX42BIAXL
[59]
O'NeillL. A When signaling pathways collide: positive and negative regulation of toll-like receptor signal transductionImmunity20082911220DOI: 10.1016/j.immuni.2008.06.004
[60]
KondoT KawaiT AkiraS Dissecting negative regulation of Toll-like receptor signalingTrends Immunol201233944958DOI: 10.1016/j.it.2012.05.002
[61]
FormanJ. J Legesse-MillerA CollerH. A A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequenceProc Natl Acad Sci U S A2008105391487984DOI: 10.1073/pnas.0803230105
[62]
ZhangJ ZhouW LiuY LiuT LiC WangL Oncogenic role of microRNA-532-5p in human colorectal cancer via targeting of the 5'UTR of RUNX3Oncol Lett201815572157220DOI: 10.3892/ol.2018.8217
[63]
MakeyevE. V ManiatisT Multilevel regulation of gene expression by microRNAsScience20083195871178990DOI: 10.1126/science.1152326
[64]
RebaneA MicroRNAsC. A. Akdis Essential players in the regulation of inflammationJ Allergy Clin Immunol201313211526DOI: 10.1016/j.jaci.2013.04.011
[65]
DharapA PokrzywaC MuraliS PandiG VemugantiR MicroRNA miR-324-3p induces promoter-mediated expression of RelA genePLoS One2013811e79467DOI: 10.1371/journal.pone.0079467
[66]
Bullrich F Fujii H Calin G Mabuchi H Negrini M Pekarsky Y Rassenti L Alder H Reed J. C Keating M. J Kipps T. J Croce C. M Characterization of the 13q14 tumor suppressor locus in CLL: identification of ALT1, an alternative splice variant of the LEU2 gene Cancer Res 2001 61 18 6640 8
[67]
FabbriM GarzonR AndreeffM KantarjianH. M Garcia-ManeroG CalinG. A MicroRNAs and noncoding RNAs in hematological malignancies: molecular, clinical and therapeutic implicationsLeukemia20082261095105DOI: 10.1038/leu.2008.30
[68]
KanlikilicerP RashedM. H BayraktarR MitraR IvanC AslanB ZhangX FilantJ SilvaA. M Rodriguez-AguayoC BayraktarE PichlerM OzpolatB CalinG. A SoodA. K Lopez-BeresteinG Ubiquitous Release of Exosomal Tumor Suppressor miR-6126 from Ovarian Cancer CellsCancer Res2016762471947207DOI: 10.1158/0008-5472. CAN-16-0714
[69]
MunkerR CalinG. A MicroRNA profiling in cancerClin Sci (Lond)2011121414158DOI: 10.1042/CS20110005
[70]
SevignaniC CalinG. A NnadiS. C ShimizuM DavuluriR. V HyslopT DemantP CroceC. M SiracusaL. D MicroRNA genes are frequently located near mouse cancer susceptibility lociProc Natl Acad Sci U S A200710419801722DOI: 10.1073/pnas.0702177104
[71]
MacfarlaneL. A MicroRNAP. R. Murphy Biogenesis, Function and Role in CancerCurr Genomics201011753761DOI: 10.2174/138920210793175895
[72]
LeeY AhnC HanJ ChoiH KimJ YimJ LeeJ ProvostP RadmarkO KimS KimV. N The nuclear RNase III Drosha initiates microRNA processingNature200342569564159DOI: 10.1038/nature01957
[73]
LeeY JeonK LeeJ. T KimS KimV. N MicroRNA maturation: stepwise processing and subcellular localizationEMBO J20022117466370DOI: 10.1093/emboj/cdf476
[74]
BallarinoM PaganoF GirardiE MorlandoM CacchiarelliD MarchioniM ProudfootN. J BozzoniI Coupled RNA processing and transcription of intergenic primary microRNAsMol Cell Biol2009292056328DOI: 10.1128/MCB.00664-09
[75]
MorlandoM BallarinoM GromakN PaganoF BozzoniI ProudfootN. J Primary microRNA transcripts are processed co-transcriptionallyNat Struct Mol Biol20081599029DOI: 10.1038/nsmb.1475
[76]
HutvagnerG McLachlanJ PasquinelliA. E BalintE TuschlT ZamoreP. D A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNAScience200129355318348DOI: 10.1126/science.1062961
[77]
GrishokA PasquinelliA. E ConteD LiN ParrishS HaI BaillieD. L FireA RuvkunG MelloC. C Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timingCell200110612334DOI: 10.1016/s0092-8674(01)00431-7
[78]
KettingR. F FischerS. E BernsteinE SijenT HannonG. J PlasterkR. H Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegansGenes Dev2001152026549DOI: 10.1101/gad.927801
[79]
BernsteinE CaudyA. A HammondS. M HannonG. J Role for a bidentate ribonuclease in the initiation step of RNA interferenceNature200140968183636DOI: 10.1038/35053110
[80]
YodaM KawamataT ParooZ YeX IwasakiS LiuQ TomariY ATP-dependent human RISC assembly pathwaysNat Struct Mol Biol20101711723DOI: 10.1038/nsmb.1733
[81]
O'BrienJ HayderH ZayedY PengC Overview of MicroRNA Biogenesis, Mechanisms of Actions, and CirculationFront Endocrinol (Lausanne)20189402DOI: 10.3389/fendo.2018.00402
[82]
RubyJ. G JanC. H BartelD. P Intronic microRNA precursors that bypass Drosha processingNature20074487149836DOI: 10.1038/nature05983
[83]
BabiarzJ. E RubyJ. G WangY BartelD. P BlellochR Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAsGenes Dev20082220277385DOI: 10.1101/gad.1705308
[84]
OkamuraK HagenJ. W DuanH TylerD. M LaiE. C The mirtron pathway generates microRNA-class regulatory RNAs in DrosophilaCell2007130189100DOI: 10.1016/j.cell.2007.06.028
[85]
HavensM. A ReichA. A DuelliD. M HastingsM. L Biogenesis of mammalian microRNAs by a non-canonical processing pathwayNucleic Acids Res20124010462640DOI: 10.1093/nar/gks026
[86]
XieM LiM VilborgA LeeN ShuM. D YartsevaV SestanN SteitzJ. A Mammalian 5'-capped microRNA precursors that generate a single microRNACell20131557156880DOI: 10.1016/j.cell.2013.11.027
[87]
YangJ. S MaurinT RobineN RasmussenK. D JeffreyK. L ChandwaniR PapapetrouE. P SadelainM O'CarrollD LaiE. C Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesisProc Natl Acad Sci U S A201010734151638DOI: 10.1073/pnas.1006432107
[88]
HuntzingerE IzaurraldeE Gene silencing by microRNAs: contributions of translational repression and mRNA decayNat Rev Genet201112299110DOI: 10.1038/nrg2936
[89]
IpsaroJ. J Joshua-TorL From guide to target: molecular insights into eukaryotic RNA-interference machineryNat Struct Mol Biol2015221208DOI: 10.1038/nsmb.2931
[90]
FuG BrkicJ HayderH PengC MicroRNAs in Human Placental Development and Pregnancy ComplicationsInt J Mol Sci2013143551944DOI: 10.3390/ijms14035519
[91]
LinS GregoryR. I MicroRNA biogenesis pathways in cancerNat Rev Cancer201515632133DOI: 10.1038/nrc3932
[92]
WangF ChenC WangD Circulating microRNAs in cardiovascular diseases: from biomarkers to therapeutic targetsFront Med20148440418DOI: 10.1007/s11684-014-0379-2
[93]
AbsalonS KochanekD. M RaghavanV KrichevskyA. M MiR-26b, upregulated in Alzheimer's disease, activates cell cycle entry, tau-phosphorylation, and apoptosis in postmitotic neuronsJ Neurosci201333371464559DOI: 10.1523/JNEUROSCI.1327-13.2013
[94]
Minones-MoyanoE PortaS EscaramisG RabionetR IraolaS KagerbauerB Espinosa-ParrillaY FerrerI EstivillX MartiE MicroRNA profiling of Parkinson's disease brains identifies early downregulation of miR-34b/c which modulate mitochondrial functionHum Mol Genet20112015306778DOI: 10.1093/hmg/ddr210
[95]
O'ConnellR. M RaoD. S ChaudhuriA. A BaltimoreD Physiological and pathological roles for microRNAs in the immune systemNat Rev Immunol201010211122DOI: 10.1038/nri2708
[96]
O'NeillL. A SheedyF. J MicroRNAsC. E. McCoy the fine-tuners of Toll-like receptor signallingNat Rev Immunol201111316375DOI: 10.1038/nri2957
[97]
PhilippeL AlsalehG SuffertG MeyerA GeorgelP SibiliaJ WachsmannD PfefferS TLR2 expression is regulated by microRNA miR-19 in rheumatoid fibroblast-like synoviocytesJ Immunol2012188145461DOI: 10.4049/jimmunol.1102348
[98]
BenakanakereM. R LiQ EskanM. A SinghA. V ZhaoJ GaliciaJ. C StathopoulouP KnudsenT. B KinaneD. F Modulation of TLR2 protein expression by miR-105 in human oral keratinocytesJ Biol Chem2009284342310715DOI: 10.1074/jbc. M109.013862
[99]
QuinnE. M WangJ. H O'CallaghanG RedmondH. P MicroRNA-146a is upregulated by and negatively regulates TLR2 signalingPLoS One201384e62232DOI: 10.1371/journal.pone.0062232
[100]
GuoH ChenY HuX QianG GeS ZhangJ The regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal carcinoma cellsMol Cancer20131277DOI: 10.1186/1476-4598-12-77
[101]
LiuY WangY YamakuchiM IsowakiS NagataE KanmuraY KitajimaI MaruyamaI Upregulation of toll-like receptor 2 gene expression in macrophage response to peptidoglycan and high concentration of lipopolysaccharide is involved in NF-kappa b activationInfect Immun2001695278896DOI: 10.1128/IAI.69.5.2788-2796.2001
[102]
MatsuguchiT MusikacharoenT OgawaT YoshikaiY Gene expressions of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophagesJ Immunol200016510576772DOI: 10.4049/jimmunol.165.10.5767
[103]
Chavez-SanchezL Garza-ReyesM. G Espinosa-LunaJ. E Chavez-RuedaK Legorreta-HaquetM. V Blanco-FavelaF The role of TLR2, TLR4 and CD36 in macrophage activation and foam cell formation in response to oxLDL in humansHum Immunol20147543229DOI: 10.1016/j.humimm.2014.01.012
[104]
BrasJ. P SilvaA. M CalinG. A BarbosaM. A SantosS. G AlmeidaM. I miR-195 inhibits macrophages pro-inflammatory profile and impacts the crosstalk with smooth muscle cellsPLoS One20171211e0188530DOI: 10.1371/journal.pone.0188530
[105]
O'MahonyD. S PhamU IyerR HawnT. R LilesW. C Differential constitutive and cytokine-modulated expression of human Toll-like receptors in primary neutrophils, monocytes, and macrophagesInt J Med Sci20085118DOI: 10.7150/ijms.5.1
[106]
MengL ZhuW JiangC HeX HouW ZhengF HolmdahlR LuS Toll-like receptor 3 upregulation in macrophages participates in the initiation and maintenance of pristane-induced arthritis in ratsArthritis Res Ther2010123R103DOI: 10.1186/ar3034
[107]
JiangC ZhuW XuJ WangB HouW ZhangR ZhongN NingQ HanY YuH SunJ MengL LuS MicroRNA-26a negatively regulates toll-like receptor 3 expression of rat macrophages and ameliorates pristane induced arthritis in ratsArthritis Res Ther2014161R9DOI: 10.1186/ar4435
[108]
HuX YeJ QinA ZouH ShaoH QianK Both MicroRNA-155 and Virus-Encoded MiR-155 Ortholog Regulate TLR3 ExpressionPLoS One2015105e0126012DOI: 10.1371/journal.pone.0126012
[109]
JohnnidisJ. B HarrisM. H WheelerR. T Stehling-SunS LamM. H KirakO BrummelkampT. R FlemingM. D CamargoF. D Regulation of progenitor cell proliferation and granulocyte function by microRNA-223Nature2008451718211259DOI: 10.1038/nature06607
[110]
ChenX. M SplinterP. L O'HaraS. P LaRussoN. F A cellular micro-RNA, let-7i, regulates Toll-like receptor 4 expression and contributes to cholangiocyte immune responses against Cryptosporidium parvum infectionJ Biol Chem2007282392892938DOI: 10.1074/jbc. M702633200
[111]
HuG GongA. Y RothA. L HuangB. Q WardH. D ZhuG LarussoN. F HansonN. D ChenX. M Release of luminal exosomes contributes to TLR4-mediated epithelial antimicrobial defensePLoS Pathog201394e1003261DOI: 10.1371/journal.ppat.1003261
[112]
HuG ZhouR LiuJ GongA. Y EischeidA. N DittmanJ. W ChenX. M MicroRNA-98 and let-7 confer cholangiocyte expression of cytokine-inducible Src homology 2-containing protein in response to microbial challengeJ Immunol20091833161724DOI: 10.4049/jimmunol.0804362
[113]
AndroulidakiA IliopoulosD ArranzA DoxakiC SchworerS ZacharioudakiV MargiorisA. N TsichlisP. N TsatsanisC The kinase Akt1 controls macrophage response to lipopolysaccharide by regulating microRNAsImmunity200931222031DOI: 10.1016/j.immuni.2009.06.024
[114]
WuJ NiuP ZhaoY ChengY ChenW LinL LuJ ChengX XuZ Impact of miR-223-3p and miR-2909 on inflammatory factors IL-6, IL-1ss, and TNF-alpha, and the TLR4/TLR2/NF-kappaB/STAT3 signaling pathway induced by lipopolysaccharide in human adipose stem cellsPLoS One2019142e0212063DOI: 10.1371/journal.pone.0212063
[115]
YanY LuK YeT ZhangZ MicroRNA223 attenuates LPSinduced inflammation in an acute lung injury model via the NLRP3 inflammasome and TLR4/NFkappaB signaling pathway via RHOBInt J Mol Med201943314671477DOI: 10.3892/ijmm.2019.4075
[116]
YangK HeY. S WangX. Q LuL ChenQ. J LiuJ SunZ ShenW. F MiR-146a inhibits oxidized low-density lipoprotein-induced lipid accumulation and inflammatory response via targeting toll-like receptor 4FEBS Lett2011585685460DOI: 10.1016/j.febslet.2011.02.009
[117]
LiuW WuY. H ZhangL XueB WangY LiuB LiuX. Y ZuoF YangX. Y ChenF. Y DuanR CaiY ZhangB JiY MicroRNA-146a suppresses rheumatoid arthritis fibroblast-like synoviocytes proliferation and inflammatory responses by inhibiting the TLR4/NF-kB signalingOncotarget20189352394423959DOI: 10.18632/oncotarget.24050
[118]
TaganovK. D BoldinM. P ChangK. J BaltimoreD NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targeted to signaling proteins of innate immune responsesProc Natl Acad Sci U S A200610333124816DOI: 10.1073/pnas.0605298103
[119]
TserelL RunnelT KisandK PihlapM BakhoffL KoldeR PetersonH ViloJ PetersonP RebaneA MicroRNA expression profiles of human blood monocyte-derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of Toll-like receptor 4J Biol Chem2011286302648795DOI: 10.1074/jbc. M110.213561
[120]
SheedyF. J Palsson-McDermottE HennessyE. J MartinC O'LearyJ. J RuanQ JohnsonD. S ChenY O'NeillL. A Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21Nat Immunol20101121417DOI: 10.1038/ni.1828
[121]
ZhangX WangC ShanS LiuX JiangZ RenT TLR4/ROS/miRNA-21 pathway underlies lipopolysaccharide instructed primary tumor outgrowth in lung cancer patientsOncotarget20167274217242182DOI: 10.18632/oncotarget.9902
[122]
XuZ SharmaM GelmanA HachemR MohanakumarT Significant role for microRNA-21 affecting toll-like receptor pathway in primary graft dysfunction after human lung transplantationJ Heart Lung Transplant2017363331339DOI: 10.1016/j.healun.2016.08.028
[123]
AungierS. R OhmoriH ClintonM MabbottN. A MicroRNA-100-5p indirectly modulates the expression of Il6, Ptgs1/2 and Tlr4 mRNA in the mouse follicular dendritic cell-like cell line, FL-YImmunology201514413444DOI: 10.1111/imm.12342
[124]
AkatK. M LeeY. A HurleyA MorozovP MaxK. E BrownM BogardusK SopeyinA HildnerK DiacovoT. G NeurathM. F BorggrefeM TuschlT Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysisJCI Insight20195DOI: 10.1172/jci.insight.127317
[125]
Arenas-PadillaM Mata-HaroV Regulation of TLR signaling pathways by microRNAs: implications in inflammatory diseasesCent Eur J Immunol2018434482489DOI: 10.5114/ceji.2018.81351
[126]
RupaniH Martinez-NunezR. T DennisonP LauL. C JayasekeraN HavelockT Francisco-GarciaA. S GraingeC HowarthP. H Sanchez-ElsnerT Toll-like Receptor 7 Is Reduced in Severe Asthma and Linked to an Altered MicroRNA ProfileAm J Respir Crit Care Med201619412637DOI: 10.1164/rccm.201502-0280OC
[127]
HuangZ GanJ LongZ GuoG ShiX WangC ZangY DingZ ChenJ ZhangJ DongL Targeted delivery of let-7b to reprogramme tumor-associated macrophages and tumor infiltrating dendritic cells for tumor rejectionBiomaterials2016907284DOI: 10.1016/j.biomaterials.2016.03.009
[128]
HeW. A CaloreF LondheP CanellaA GuttridgeD. C CroceC. M Microvesicles containing miRNAs promote muscle cell death in cancer cachexia via TLR7Proc Natl Acad Sci U S A20141111245259DOI: 10.1073/pnas.1402714111
[129]
RanganathanP NgankeuA ZitzerN. C LeonciniP YuX CasadeiL ChallagundlaK ReichenbachD. K GarmanS RuppertA. S VoliniaS HofstetterJ EfeberaY. A DevineS. M BlazarB. R FabbriM GarzonR Serum miR-29a Is Upregulated in Acute Graft-versus-Host Disease and Activates Dendritic Cells through TLR BindingJ Immunol2017198625002512DOI: 10.4049/jimmunol.1601778
[130]
HoshikawaN SakaiA TakaiS SuzukiH Targeting Extracellular miR-21-TLR7 Signaling Provides Long-Lasting Analgesia in OsteoarthritisMol Ther Nucleic Acids202019199207DOI: 10.1016/j.omtn.2019.11.011
[131]
ParkC. K XuZ. Z BertaT HanQ ChenG LiuX. J JiR. R Extracellular microRNAs activate nociceptor neurons to elicit pain via TLR7 and TRPA1Neuron20148214754DOI: 10.1016/j.neuron.2014.02.011
[132]
HeilF HemmiH HochreinH AmpenbergerF KirschningC AkiraS LipfordG WagnerH BauerS Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8Science2004303566315269DOI: 10.1126/science.1093620
[133]
HornungV Guenthner-BillerM BourquinC AblasserA SchleeM UematsuS NoronhaA ManoharanM AkiraS FougerollesA. de EndresS HartmannG Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7Nat Med200511326370DOI: 10.1038/nm1191
[134]
SioudM Induction of inflammatory cytokines and interferon responses by double-stranded and single-stranded siRNAs is sequence-dependent and requires endosomal localizationJ Mol Biol20053485107990DOI: 10.1016/j.jmb.2005.03.013
[135]
ForsbachA NemorinJ. G MontinoC MullerC SamulowitzU VicariA. P JurkM MutwiriG. K KriegA. M LipfordG. B VollmerJ Identification of RNA sequence motifs stimulating sequence-specific TLR8-dependent immune responsesJ Immunol20081806372938DOI: 10.4049/jimmunol.180.6.3729
[136]
DieboldS. S MassacrierC AkiraS PaturelC MorelY SousaC. Reis e Nucleic acid agonists for Toll-like receptor 7 are defined by the presence of uridine ribonucleotidesEur J Immunol20063612325667DOI: 10.1002/eji.200636617
[137]
JudgeA. D SoodV ShawJ. R FangD McClintockK MacLachlanI Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNANat Biotechnol200523445762DOI: 10.1038/nbt1081
[138]
PeacockH FuciniR. V JayalathP Ibarra-SozaJ. M HaringsmaH. J FlanaganW. M WillinghamA BealP. A Nucleobase and ribose modifications control immunostimulation by a microRNA-122-mimetic RNAJ Am Chem Soc20111332492003DOI: 10.1021/ja202492e
[139]
MarckenM. de DhaliwalK DanielsenA. C GautronA. S Dominguez-VillarM TLR7 and TLR8 activate distinct pathways in monocytes during RNA virus infectionSci Signal201912605DOI: 10.1126/scisignal.aaw1347
[140]
GizaD. E Fuentes-MatteiE BullockM. D TudorS GoblirschM. J FabbriM LupuF YeungS. J VasilescuC CalinG. A Cellular and viral microRNAs in sepsis: mechanisms of action and clinical applicationsCell Death Differ2016231219061918DOI: 10.1038/cdd.2016.94
[141]
TudorS GizaD. E LinH. Y FabrisL YoshiakiK D'AbundoL ToaleK. M ShimizuM FerracinM ChallagundlaK. B CortezM. A Fuentes-MatteiE TulbureD GonzalezC HendersonJ RowM RiceT. W IvanC NegriniM FabbriM MorrisJ. S YeungS. C VasilescuC CalinG. A Cellular and Kaposi's sarcoma-associated herpes virus microRNAs in sepsis and surgical traumaCell Death Dis20145e1559DOI: 10.1038/cddis.2014.515
[142]
YoungL. S RickinsonA. B Epstein-Barr virus: 40 years onNat Rev Cancer200441075768DOI: 10.1038/nrc1452
[143]
FerrajoliA IvanC CicconeM ShimizuM KitaY OhtsukaM D'AbundoL QiangJ LernerS NouraeeN RabeK. G RassentiL. Z RoosbroeckK. Van ManningJ. T YuanY ZhangX ShanafeltT. D WierdaW. G SabbioniS TarrandJ. J EstrovZ RadovichM LiangH NegriniM KippsT. J KayN. E KeatingM CalinG. A Epstein-Barr Virus MicroRNAs are Expressed in Patients with Chronic Lymphocytic Leukemia and Correlate with Overall SurvivalEBioMedicine20152657282DOI: 10.1016/j.ebiom.2015.04.018
[144]
RoosbroeckK. Van CalinG. A When kissing (disease) countsBlood20161271619478DOI: 10.1182/blood-2016-01-692087
[145]
CremerT. J RavnebergD. H ClayC. D Piper-HunterM. G MarshC. B EltonT. S GunnJ. S AmerA KannegantiT. D SchlesingerL. S ButcharJ. P TridandapaniS MiR-155 induction by F. novicida but not the virulent F. tularensis results in SHIP down-regulation and enhanced pro-inflammatory cytokine responsePLoS One2009412e8508DOI: 10.1371/journal.pone.0008508
[146]
ErenR. O ReverteM RossiM HartleyM. A CastiglioniP PrevelF MartinR DespondsC LyeL. F DrexlerS. K ReithW BeverleyS. M RonetC FaselN Mammalian Innate Immune Response to a Leishmania-Resident RNA Virus Increases Macrophage Survival to Promote Parasite PersistenceCell Host Microbe2016203318328DOI: 10.1016/j.chom.2016.08.001
[147]
McCoyC. E SheedyF. J QuallsJ. E DoyleS. L QuinnS. R MurrayP. J O'NeillL. A IL-10 inhibits miR-155 induction by toll-like receptorsJ Biol Chem201028527204928DOI: 10.1074/jbc. M110.102111
[148]
ZhouH HuangX CuiH LuoX TangY ChenS WuL ShenN miR-155 and its star-form partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cellsBlood201011626588594DOI: 10.1182/blood-2010-04-280156
[149]
JiangM BroeringR TripplerM WuJ ZhangE ZhangX GerkenG LuM SchlaakJ. F MicroRNA-155 controls Toll-like receptor 3- and hepatitis C virus-induced immune responses in the liverJ Viral Hepat201421299110DOI: 10.1111/jvh.12126
[150]
QuinnS. R ManganN. E CaffreyB. E GantierM. P WilliamsB. R HertzogP. J McCoyC. E O'NeillL. A The role of Ets2 transcription factor in the induction of microRNA-155 (miR-155) by lipopolysaccharide and its targeting by interleukin-10J Biol Chem20142897431625DOI: 10.1074/jbc. M113.522730
[151]
O'ConnellR. M TaganovK. D BoldinM. P ChengG BaltimoreD MicroRNA-155 is induced during the macrophage inflammatory responseProc Natl Acad Sci U S A2007104516049DOI: 10.1073/pnas.0610731104
[152]
MigitaK IwanagaN IzumiY KawaharaC KumagaiK NakamuraT KogaT KawakamiA TNF-alpha-induced miR-155 regulates IL-6 signaling in rheumatoid synovial fibroblastsBMC Res Notes2017101403DOI: 10.1186/s13104-017-2715-5
[153]
YeeD ShahK. M ColesM. C SharpT. V LagosD MicroRNA-155 induction via TNF-alpha and IFN-gamma suppresses expression of programmed death ligand-1 (PD-L1) in human primary cellsJ Biol Chem2017292502068320693DOI: 10.1074/jbc. M117.809053
[154]
Li H Zhang X Gao L Min J Zhang Y Zhang R Yang Y TNF-alpha is upregulated in subacute thyroiditis and stimulates expression of miR-155-5p in thyroid follicle cells Discov Med 2018 26 142 67 77
[155]
WuT XieM WangX JiangX LiJ HuangH miR-155 modulates TNF-alpha-inhibited osteogenic differentiation by targeting SOCS1 expressionBone2012513498505DOI: 10.1016/j.bone.2012.05.013
[156]
SunY CaiJ MaF LuP HuangH ZhouJ miR-155 mediates suppressive effect of progesterone on TLR3, TLR4-triggered immune responseImmunol Lett20121461-22530DOI: 10.1016/j.imlet.2012.04.007
[157]
RaoR RiederS. A NagarkattiP NagarkattiM Staphylococcal enterotoxin B-induced microRNA-155 targets SOCS1 to promote acute inflammatory lung injuryInfect Immun201482729719DOI: 10.1128/IAI.01666-14
[158]
GalbraithN. J BurtonJ EkmanM. B KenneyJ WalkerS. P ManekS BishopC CarterJ. V GardnerS. A PolkH. C IkappaK-16 decreases miRNA-155 expression and attenuates the human monocyte inflammatory responsePLoS One2017129e0183987DOI: 10.1371/journal.pone.0183987
[159]
BilleterA. T HellmannJ RobertsH DruenD GardnerS. A SarojiniH GalandiukS ChienS BhatnagarA SpiteM PolkH. C MicroRNA-155 potentiates the inflammatory response in hypothermia by suppressing IL-10 productionFASEB J20142812532236DOI: 10.1096/fj.14-258335
[160]
WenY ZhangX DongL ZhaoJ ZhangC ZhuC Acetylbritannilactone Modulates MicroRNA-155-Mediated Inflammatory Response in Ischemic Cerebral TissuesMol Med201521197209DOI: 10.2119/molmed.2014.00199
[161]
SwaminathanG RossiF SierraL. J GuptaA Navas-MartinS Martin-GarciaJ A role for microRNA-155 modulation in the anti-HIV-1 effects of Toll-like receptor 3 stimulation in macrophagesPLoS Pathog201289e1002937DOI: 10.1371/journal.ppat.1002937
[162]
WenZ XuL ChenX XuW YinZ GaoX XiongS Autoantibody induction by DNA-containing immune complexes requires HMGB1 with the TLR2/microRNA-155 pathwayJ Immunol201319011541122DOI: 10.4049/jimmunol.1203301
[163]
WangK LiP. F Foxo3a regulates apoptosis by negatively targeting miR-21J Biol Chem2010285221695866DOI: 10.1074/jbc. M109.093005
[164]
GanB LimC ChuG HuaS DingZ CollinsM HuJ JiangS Fletcher-SananikoneE ZhuangL ChangM ZhengH WangY. A KwiatkowskiD. J KaelinW. G SignorettiS DePinhoR. A FoxOs enforce a progression checkpoint to constrain mTORC1-activated renal tumorigenesisCancer Cell201018547284DOI: 10.1016/j.ccr.2010.10.019
[165]
LaT LiuG. Z FarrellyM ColeN FengY. C ZhangY. Y SherwinS. K YariH TabatabaeeH YanX. G GuoS. T LiuT ThorneR. F JinL ZhangX. D A p53-Responsive miRNA Network Promotes Cancer Cell QuiescenceCancer Res2018782366666679DOI: 10.1158/0008-5472. CAN-18-1886
[166]
EchavarriaR MayakiD NeelJ. C HarelS SanchezV HussainS. N Angiopoietin-1 inhibits toll-like receptor 4 signalling in cultured endothelial cells: role of miR-146b-5pCardiovasc Res2015106346577DOI: 10.1093/cvr/cvv120
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Share
Back to top