†These authors contributed equally.
This study was aimed at investigating the differentially expressions of long
noncoding RNAs (lncRNAs) and mRNAs in the brains of a middle cerebral artery
occlusion/reperfusion (MCAO/R) group and a MCAO/R + 20(R)-Rg3 group.
Biological enrichment analysis was performed, and a lncRNA-mRNA coexpression
network was constructed, to reveal the targets and pathways of 20(R)-Rg3
involved in the regulation of cerebral ischemia-reperfusion injury (CIRI). The
RNA-seq high-throughput sequencing method was employed to detect
differentially-expressed genes between the groups, which were verified by RT-PCR.
Functional enrichment analyses of Gene Ontology (GO) and Kyoto Encyclopedia of
Genes and Genomes (KEGG) pathway were performed to explore the biological
functions and relevant pathways. The coexpression network of the screened lncRNAs
and mRNAs was built by using Cytoscape software. The results identified 77
upregulated lncRNAs, 162 downregulated lncRNAs, 66 upregulated mRNAs and 472
downregulated mRNAs in the MCAO/R + 20(R)-Rg3 group, compared with those
in the MCAO/R group. GO enrichment analysis showed that the GO terms were mainly
enriched in stimulation response, cellular response, and stress response. KEGG
pathways were mainly related to the tumor necrosis factor (TNF), NF-
Ischemic stroke (also called cerebral infarction) is recognized as one of the most prevalent neurological/stroke-related disorders worldwide with high rates of morbidity and disability. Every year, an estimated 6.2 million people die of stroke, while the lifetime risk of stroke is approximately 8% to 10%. It has been reported that ischemic stroke makes up to 70–85% of all strokes [1]. Cerebral ischemia-reperfusion injury (CIRI) is considered as a complicated pathophysiological condition of ischemic stroke involving excitotoxicity, inflammatory response, oxidative stress and apoptosis [2]. The occurrence of CIRI can cause an imbalance in calcium homeostasis, resulting in excessive release of the neurotransmitter glutamate and excitatory amino acid toxicity [3]. In addition, CIRI can activate macrophages and microglia, produce proinflammatory mediators such as tumor necrosis factor (TNF), the interleukin family cytokines, and adhesion molecules, increase leukocyte infiltration, and eventually lead to the apoptosis of neurons [4]. At present, long noncoding RNAs (lncRNAs), as new key regulators involved in nervous system diseases, have attracted increasing attention from researchers [5].
Around 99% of mammalian genomes are pervasively transcribed into noncoding RNAs (ncRNAs), and most of which are lncRNAs [6]. LncRNAs can regulate target gene expression by affecting histone modification, chromatin remodeling and protein functional activity [7]. Accumulating research indicates that the function of lncRNAs is closely correlated with the pathological process of ischemic stroke [8]. It has been reported that overexpression of antisense noncoding RNA in the INK4 locus (ANRIL) alleviated PC-12 cell injury induced by oxygen-glucose deprivation (OGD), and the underlying mechanism maybe related to the suppressed miR-127, which is negatively regulated by expression of the antiapoptotic factor myeloid leukemia factor (Mcl-1) [9]. Zhang et al. [10] found that knockdown of the lncRNA small nucleolar RNA host gene 6 (SNHG6) can reduce brain infarct volumes and alleviate neurobehavioral outcomes in mice following middle cerebral artery occlusion (MCAO). In addition, cell experiments confirmed that interfering with SNHG6 expression can reduce the expression of caspase-3, inhibit cell apoptosis, and increase the survival rate of cortical neurons after OGD treatment. Therefore, by studying the interactions between lncRNAs and mRNAs, we can better understand the pathophysiological processes of CIRI and develop new therapeutic strategies for CIRI.
Studies have shown that the most active plant-derived natural products, such as saponins, flavonoids and alkaloids, have protective effects or potential activities against cerebral ischemia and are also important sources for preventing and treating ischemic stroke [11]. Radix notoginseng is the dried root of Panax notoginseng (Burk.) F.H. Chen, and its main active ingredients are dammarane-type triterpenoid saponins. Ginsenoside Rg3, the monomer saponin extracted from P. notoginseng, exists in two stereoisomeric configurations in nature, namely, 20(S)-Rg3 and 20(R)-Rg3. Pharmacological experiments confirmed that 20(R)-Rg3 has neuroprotective, antitumor and antioxidant properties [12, 13, 14]. Our previous research showed that 20(R)-Rg3 protects against CIRI in the rat brain by reducing the infarct rate and decreasing cerebral infarct volumes on 2,3,5-triphenyltetrazolium chloride (TTC)-stained brain sections, and improving the animals’ behavior. In addition, 20(R)-Rg3 significantly suppressed caspase-3 and calpain I mRNA expression [15]. Also, in vitro experiments confirmed that 20(R)-Rg3 can reduce the apoptosis rate induced by OGD/R in SH-SY5Y cells, and the mechanism may have relations with the downregulation of Bax expression and the upregulation of Bcl-2 expression [16]. Current reports on 20(R)-Rg3 for treating neurological conditions tend to focus on a single therapeutic target or single molecular signaling pathway. The underlying mechanism of 20(R)-Rg3 based on multiple regulatory aspects and levels, especially lncRNAs, has not been completely illuminated.
In this study, we set out to investigate the changes in the lncRNA and mRNA expression profiles in a MCAO/R + 20(R)-Rg3 vs. a MCAO/R group by using RNA sequencing technology. Our results demonstrated that multiple lncRNAs are closely associated with the protective efficacy of 20(R)-Rg3 in a MCAO/R-induced rat model and therefore provide a novel treatment for neurological diseases related to ischemic stroke.
20(R)-Rg3 (purity
Male Sprague-Dawley rats in a SPF-grade weighing about 300 g were purchased from
the Laboratory Animal Center of Kunming Medical University [license number: SCXK
(Yunnan) k2015-0002]. Rats were housed in a controlled environment maintained at
21–23
The rat model of MCAO/R was duplicated as reported previously [15]. Thereafter, the rats were scored according to the method of Bederson’s test [17], and those rats that scored more than 3 points were considered as successful models. Briefly, the rats were anesthetized using 2% isoflurane and fixed in the supine position, and cervical hair was removed with a razor. Then, a small incision of approximately 3.0 cm was cut along the medioventral line. The right common carotid artery, external carotid artery and internal carotid artery were bluntly separated, and the proximal and external carotid arteries were ligated. A 0.47 mm nylon thread was inserted into the middle cerebral artery at a depth of approximately 20 mm. During the operation, the rats were placed on the heating pad, and the filament was withdrawn after two hours of ischemia/24 h of reperfusion. The therapeutic agent of 20(R)-Rg3 (20 mg/kg, i.p.) was given 12 h before the operation. Two hours later, the thread was retracted to perform the reperfusion operation, and the agent was immediately given a second time. Twelve hours after reperfusion, the last dosage of 20(R)-Rg3 was given. The experimental animals were euthanized 24 h after reperfusion, and the brain tissues were rapidly collected.
The cerebral cortex was collected from three
randomly selected rats in each group, and a 2
The differential expression of each lncRNA and mRNA in each sample were analyzed using Cuffdiff software (v2.2.1, http://cole-trapnell-lab.github.io/cufflinks/install/). A fold change value of 1.3 with a p-value of 0.05 was used as the cutoff, and padj less than 0.05 indicated a significant difference.
RT-PCR was used to validate the differentially expressed genes. Fresh brain tissue was immediately immersed in TRIzol reagent. After chloroform phase separation, RNA was extracted from the upper transparent layer. Total RNA was reverse transcribed, and RT-PCR was performed using a real-time PCR system (ABI7500; Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was regarded as an internal reference control, and the comparative cycle threshold (Ct) method was used for the relative quantitative analysis [18]. The primer sequences are listed in Table 1.
Gene | Forward primer | Reverse primer | Length | TM |
(bp) | ( | |||
GAPDH | GGGTGTGAACCACGAGAAAT | ACTGTGGTCATGAGCCCTTC | 20 | 59.7 |
Ephx2 | CGTTCGACCTTGACGGAGTG | CTGGAAAGCGCCAAGTAGGA | 20 | 57.4 |
Phyhip | CTCTCTCTTCTTGCGCGTTC | GATGATGAGCTCTCCAGGCAG | 21 | 57.4 |
Hspa1b | CAGCGAGGCTGACAAGAAGA | TTGCAGACCGAACGAAGGAG | 20 | 59.5 |
Itga2 | ACCCTTTGGATCTGCGAGTG | AGAAAACTCAGCCAGGACGG | 20 | 57.4 |
Ptx3 | GCAGCCAAGGACAGGTAGTT | ACCCCTGTGATGGTCTTAGC | 20 | 57.4 |
Mettl27 | GGGAGGCTGAGACAGGAGGA | GTCACCATATTGATGCCGAACT | 22 | 59.5 |
Cyp23 | CTCCAGTTGAACCAGCACCA | GAAGACCCAGAAATGAACCCAC | 22 | 57.4 |
Msn | GCACAAGTCTGGCTACCTGG | GTCAGCTTTGTCTGCTACCCA | 21 | 57.4 |
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Ephx2, Epoxide hydratase2; Phyhip, Alkate oxidase; Hspa1b, Heat Shock 70kDa Egg 1B; Itga2, Integrin A2; Ptx3, Pentraxin 3; Mettl27, Methyltransferase like 27; Cyp23, Cytochrome oxidase23; membrane protein pseudogene (Msn) is a membrane protein. |
Pathway enrichment analysis was used to identify the major signal transduction
and biochemical metabolic pathways associated with differentially expressed genes
(DEGs). Gene Ontology (GO) term enrichment was carried out using GO-seq software
to acquire annotation and enrichment information. The differentially expressed
mRNAs were mapped to the appropriate GO database, and the number of genes was
calculated for each term. The enrichment analysis of Kyoto Encyclopedia of Genes
and Genomes (KEGG) pathway was conducted using KOBAS (v2.0,
http://kobas.cbi.pku.edu.cn). The GO terms/pathways with significant enrichment
were defined with p
Based on correlation analysis of the differentially expressed lncRNAs and mRNAs, a coexpression network of 6 lncRNAs and 308 mRNAs was constructed by using weighted gene coexpression network analysis (WGCNA). The network was visualized using Cytoscape software (version 2.8.3; Cytoscape Consortium, San Diego, CA, USA). Six lncRNAs are represented by red squares, and 308 mRNAs are represented by blue nodes. The positive and negative connections are shown as solid lines and dotted lines, respectively.
All analyses were performed using SPSS 20.0 (IBM Corp., Chicago, IL, USA).
Results were expressed as the mean
The quality-controlled library was sequenced by Illumina PE150 according to the data output requirements and effective concentration of the library. A total of 726,279,344 raw data points were generated (Table 2). After stringent quality assessment, a total of 708,340,346 clean reads were acquired. At the same time, the clean reads were compared with the reference genome to obtain transcriptome information, and the RNA-seq sequencing data were compared and analyzed by Hisat 2 software. The comparison rates of model 1, model 2, model 3, 20(R)-Rg3_1, 20(R)-Rg3_2, and 20(R)-Rg3_3 was 96.77%, 96.68%, 96.73%, 96.46%, 96.07% and 96.68%, respectively (Table 3). Overall, a total of 708,340,346 transcripts were collected, which were used for subsequent analysis.
Sample name | Raw reads | Clean reads |
Model 1 | 137,917,586 | 134,670,272 |
Model 2 | 135,458,378 | 132,972,226 |
Model 3 | 117,303,944 | 113,125,424 |
Rg3_1 | 138,741,702 | 136,323,788 |
Rg3_2 | 101,383,840 | 98,266,784 |
Rg3_3 | 95,473,894 | 92,981,852 |
Model group was the middle cerebral artery occlusion/reperfusion (MCAO/R) model group. Rg3 group was 20(R)-ginsenoside Rg3 group (20 mg/kg). |
Sample name | Model 1 | Model 2 | Model 3 | Rg3_1 | Rg3_2 | Rg3_3 |
Total reads | 134,670,272 | 132,972,226 | 113,125,424 | 136,323,788 | 98,266,784 | 92,981,852 |
Total mapped | 130,326,512 (96.77%) | 128,563,463 (96.68%) | 1,109,431,654 (96.73%) | 131,497,694 (96.46%) | 94,407,835 (96.07%) | 89,892,005 (96.68%) |
Model group was the middle cerebral artery occlusion/reperfusion (MCAO/R) model group. Rg3 group was 20(R)-ginsenoside Rg3 group (20 mg/kg). |
The single-exon transcripts with low credibility in the transcriptional results
were filtered out using Cuffcompare software (v2.2.1, http://cole-trapnell-lab.github.io/cufflinks/install/). Transcripts greater than 200 bp in length and exon
number
Venn distribution of different IncRNA types. LncRNA, antisense, sense-overlapping, and sense-intronic were presented as yellow, brown, purple and green, respectively.
The predicted 11,375 lncRNAs and 3571 mRNAs were used for comparison with known lncRNAs and mRNAs. The results demonstrated that the average transcript lengths of mRNAs were longer than those of lncRNAs (Fig. 2a), and most mRNAs contained more exons than lncRNAs (Fig. 2b). The open reading frame lengths of mRNAs in the obtained dataset were longer than those of lncRNAs (Fig. 2c). All lncRNAs overlapped with known lncRNAs. The above results suggested that the predicted novel lncRNAs were similar to known lncRNAs and significantly different from known mRNAs.
Comparing the characteristics of IncRNA and mRNA. (a) Transcription length distribution in mRNA and IncRNA. (b) The distribution of exon number of mRNA and lncRNA. (c) Distribution of open reading frame length in mRNA and IncRNA. Purple region indicates the known IncRNAs, the cyan region reflects the known mRNAs, the red region indicates the predicted new IncRNAs, and the orange region represents the predicted new mRNAs (n = 3).
The fold change cutoff value was set at 1.3, and the differential expression was
analyzed by using Cuffdiff software (v2.2.1, http://cole-trapnell-lab.github.io/cufflinks/install/) (p
Differential expression analysis of IncRNA and mRNA. (a,b) The abscissa represents the expression multiple Change (log2 Fold Change) between different samples or comparison combinations. The ordinate represents the level of significance of the expression difference. The up-regulated genes are represented by red dots, down-regulated genes are represented by green dots, and the genes with no significant changes are represented by blue dots. (c,d) The horizontal axis denotes each sample, and the vertical axis represents the differentially expressed genes. The selected genes were clustered on the left side of the dendrogram according to the degree of similarity, and clustering of each sample was performed on the top side according to the expression similarity degree. Color scale represents the expression level of each sample from low expression level (blue) to high expression level (red).
Among lncRNA and mRNA transcripts with significant differential expression, four
lncRNAs and four mRNAs were chosen randomly and verified by RT-PCR. As shown in
Fig. 4, compared with that in the MCAO/R group, the expression of the lncRNAs
Mettl27 and Cyp23 in the MCAO/R + 20(R)-Rg3 group was upregulated
(p
RT-PCR Verification of differentially expressed genes of IncRNA
and mRNA. (a) The expression of Mettl27. (b) The expression of Cyp23. (c) The
expression of Msn. (d) The expression of Ptx3. (e) The expression of Ephx2. (f)
The expression of Phyhip. (g) The expression of Hspa1b. (h) The expression of
Itga2. Model group represents the MCAO/R group, and Rg3 (20 mg/kg) group donates
MCAO/R 20(R)-Rg3 group. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
was used as a control housekeeper gene, Mean
All the differentially-expressed genes were enriched and analyzed. After
classifying the enriched GO terms, a histogram of GO enrichment analysis was
generated. The histogram showed that the top five significant GO terms were
stimulation response (GO: 00508960), cell immunity activation response (GO:
00051716), biological positive regulatory response (GO: 0045321), stress response
(GO: 0006950), and molecular function regulation (GO: 0065009) (Fig. 5a). KEGG
analysis showed that the top seven signaling pathways involved in the regulation
of CIRI by 20(R)-Rg3 were the pathways for tuberculosis, proteoglycan,
osteoclast differentiation, phagocyte, TNF, NF
GO and KEGG pathway enrichment analysis. (a) GO enrichment. (b) KEGG pathway enrichment. The vertical axis represents different pathways, and the horizontal axis represents the proportion of the differentially expressed genes. The redder color of the dots represents the more significant enrichment. The size of the circle indicates the number of genes enriched in the pathway.
On the basis of the above related differential gene analysis, the lncRNA-mRNA
coexpression network was constructed by selecting lncRNA-mRNA pairs with an
absolute value of the correlation coefficient (
LncRNA-mRNA co-expression network. In the network analysis, the red and blue nodes represent the IncRNA and mRNA, respectively (n = 3).
Ischemic stroke is an acute attack of neurological dysfunction caused by focal cerebral ischemia and is the second major cause of death worldwide [19]. The clinical treatment of ischemic stroke mainly aims to restore blood flow as soon as possible, but at the same time, resulting in CIRI, which can cause a series of serious cascade reactions, such as blood-brain barrier dysfunction, oxidative stress, excitotoxicity, and inflammation after ischemia, and can eventually lead to neuronal death [20]. Some researchers have elucidated the changes of lncRNA, microRNA (miRNA) and mRNA expression profiles in focal ischemic rat brains by using RNA sequencing technology. A coexpression network analysis revealed that 1924 new lncRNAs may be involved in brain injury and DNA repair [21]. Recent studies using RNA-seq, a microarray sequencing technology, showed that lncRNAs play critical roles in multiple diseases. Bao et al. [22] found that a large number of abnormally expressed lncRNAs were screened from ischemic stroke patients and animals with ischemic injury: MEG3, H19 and MALAT1 may be involved in neurogenesis, angiogenesis, and inflammation through gene regulatory mechanisms include DNA transcription, methylation, RNA folding, and gene imprinting. Prior researchers have studied the expression profiles of lncRNA in normal and ischemic stroke models. In this study, we performed systematic analyses of lncRNA and mRNA expression profiles from an untreated MCAO/R group and a treated MCAO/R + 20(R)-Rg3 group, using sequencing technology. It was found that 20(R)-Rg3 protects against CIRI by regulating 239 differentially expressed lncRNAs (77 upregulated, 162 downregulated) and 538 differentially expressed mRNAs (66 upregulated, 472 downregulated) involved in stimulus response (GO: 00508960), cell immunity activation response (GO: 00051716), stress response (GO: 0006950), etc. The lncRNA-mRNA coexpression network showed that there was a strong correlation between ENSRNOG00000095 and AABR07001160.1 in the MCAO/R rat model after 20(R)-Rg3 treatment.
RNA-seq technology can provide gene expression information at the transcription level, which can be used to infer the function of unknown genes and reveal the regulatory mechanism of specific genes [23]. Studies have indicated that some aberrantly expressed lncRNAs and their gene polymorphisms in ischemic stroke patients can be developed as potential serum diagnostic marker of ischemic stroke [24]. Deng et al. [25] found that expressions of the lncRNAs SNHG15, linc-DHFRL1-4, and linc-FAM98A-3 in the serum of patients with ischemic stroke were significantly increased compared with the serum of healthy controls. Moreover, their expression changes were significantly associated with neurological deficits and could be proposed as potential biomarkers for ischemic stroke. In the present study, we detected a total of 11,375 differentially expressed lncRNAs and 3571 differentially expressed mRNAs between the 20(R)-Rg3 treated group and the untreated MCAO/R model group, using RNA-seq technology, of which 239 lncRNAs and 538 mRNAs showed statistically significant differences. To verify the reliability of the sequencing results, four lncRNAs and four mRNAs with significant differences were selected for RT-PCR. The results of RT-PCR agreed well with the sequencing results, indicating that the sequencing results were highly reliable.
In the pathological process of CIRI, severe ischemia triggers oxidative stress and the inflammatory response of brain tissue and nerve cells through the increased production of free radicals and calcium overload [26]. After CIRI, the dynamic imbalance in the nervous system between oxidative factors such as reactive nitrides (RNS) and reactive oxygen species (ROS), and antioxidant factors such as superoxide glutathione (GSH) and dismutase (SOD), causes nerve cell injury and eventually leads to brain nerve dysfunction [27]. Studies have demonstrated that various signaling pathways were involved in the regulation of oxidative stress, including the Kelch-like ECH-associated protein 1/nuclear factor erythroid 2-related factor 2 (Keap1/Nrf2) pathway, the phosphatidylinositol-3-kinase/protein kinase B (PI3K/Akt) pathway, and the Wnt signaling pathway [28]. The Wnt signaling pathway also plays an important role in signal transduction in the brain. Oxidative stress can lead to Wnt signaling pathway dysfunction with subsequent alterations in neuronal apoptosis [29]. Yao et al. [30] found that the lncRNA LOC101927196 can reduce oxidative stress via suppression of the Wnt signaling pathway by targeting frizzled class receptor 3 (FZD3) in a rat model of autism.
In addition, the forkhead frame transcription factor family O subgroup (FOXO) is an important mediator of the intracellular stress response by inducing the expression of antioxidant genes and subsequently activating antioxidant enzymes in response to oxidative stress [31]. FOXO3, a member of the FOXO family, can regulate the activity of various transcription factors and participate in cell apoptosis. It has been reported that FOXO3 can initiate transcription of the downstream antioxidant stress genes manganese superoxide dismutase (MnSOD) and catalase genes. Some studies have reported that FOXO3 overexpression can induce the activation of autophagy and protect neurons from oxidative stress [32]. It has been confirmed that lncRNAs has a crucial function in oxidative stress injury by regulating the FOXO3 signaling pathway. Wen et al. [33] showed that lncRNA LINC00963 promoted oxidative stress by activating the FOXO3 signaling pathway. Other studies have confirmed that upregulation of lncRNA SNHG12 expression can improve cell activity, inhibit oxidative stress and suppress the autophagy of HT22 cells by repressing the SIRT1/FOXO3 signaling pathway [34]. In the current study, GO enrichment analysis suggested that the effects of 20(R)-Rg3 on CIRI were related to responses such as stimulation response (GO: 00508960), stress response (GO: 0006950) and cell immunity activation response (GO: 00051716). KEGG pathway analysis revealed that the Wnt pathway and the FOXO3 pathway were shown to participate to the protective effects of 20(R)-Rg3 against CIRI induced by MCAO/R, but the specific mechanism needs further experimental study.
CIRI can result in an increase in
inflammatory mediators, such as TNF
The analysis of lncRNA-mRNA coexpression can help to further clarify the
molecular regulatory mechanism by identifying the specific associated targets and
their interactions. Previously, researchers collected blood from three healthy
controls and three ischemic stroke patients and analyzed the lncRNA-mRNA
coexpression network. Their results showed that LOC102723446 was coexpressed with
lymphoid enhancer binding factor 1 (LEF1) and Kelch-like family member 3 (KLHL3),
suggesting that LOC102723446 may contribute to ischemic stroke pathogenesis by
regulating LEF1 and KLHL3 expression [40]. Wu et al. [41] constructed a
lncRNA-mRNA coexpression network from a rat model of brain ischemia-reperfusion
injury using genome-wide lncRNA microarray analysis. Their data showed that
lncRNA N1LR inactivates the phosphorylation site of p53 to probably provide
protection in ischemic stroke model. In the present study, we also constructed a
lncRNA-mRNA coexpression network based on Pearson correlation analysis. The
results showed that six lncRNAs, ENSRNOG00000058989, ENSRNOG0000005589,
ENSRNOG00000051361, ENSRNOG00000010061, ENSRNOG00000059555, and
ENSRNOG00000030721, interacted with 308 mRNAs. Taking six lncRNAs as the core,
the closer the surrounding mRNAs were, the higher the correlation was. Among
these mRNAs with high correlation, we found that many genes could regulate
neurons, such as prokinetin 2 (Prok2), growth/differentiation factor 3 (GDF3) and
C-C chemokine ligand 20 (CCL20). Among them, Prok2 is an indicator related to
neuronal expression. Studies have found that neural stem cells in the
subventricular zone of the lateral ventricle gave rise to new interneurons
through the rostral migratory stream to the olfactory bulb (OB), and Prok2/ProkR2
signaling pathway plays a critical role in the radial and tangential migration of
OB interneurons [42]. In addition, GDF3, a member of the large TGF-
Nevertheless, there were some deficiencies in this study. Although we previously reported that 20(R)-Rg3 conferred an impressive protective effect against CIRI, we did not explore the functional/structural outcomes of 20(R)-Rg3 in brain tissue in this study, and the detailed mechanism of action of key target genes is also worthy of attention and further research. Another limitation of the present study is that a sham surgery group was not tested. However, we focused on the transcriptional expression profile of lncRNAs, regulated by 20(R)-Rg3 in CIRI, and complete lncRNA-mRNA coexpression analysis also found some meaningful results. We will conduct further studies on the functions and related pathways of these significantly regulated lncRNAs closely related to CIRI. Future research is expected to better reveal the regulatory mechanism of 20(R)-Rg3 in the control of CIRI at the molecular level.
In the present study, we performed a comprehensive analysis of lncRNAs and mRNAs
expression profiles of in rats with CIRI treated with 20(R)-Rg3 and
explored potential therapeutic targets for the treatment of CIRI. The data showed
that 20(R)-Rg3 may work in the therapy of CIRI through anti-inflammatory
and antioxidant pathways, including the Wnt, FOXO3, NF-
YY and BH performed experiments and wrote the paper; RY, XZ analyzed the data; DC and FL performed the experimental animals; ZS revised article critically for important intellectual content; PC guided the experiment.
All experiments were conducted in accordance with the Chinese Legislation on the care and use of laboratory animals and approved by the Ethical Committee of Kunming Medical University, ethic code: SCXK (Yunnan) k2015-0002.
We thank the anonymous reviewers for their valuable review of the article.
This work was supported by the National Natural Science Foundation of China (No. 81660613, 81860665), the Joint Fund for the Department of Science and Technology of Yunnan Province-Kunming Medical University (No. 2019FE001-191, 202001AY070001-157), and the Ten-Thousand Talents Program of Yunnan Province (No. YNWR-QNBJ-2019-137).
The authors declare no conflict of interest.