Human epithelial ovarian cancer (hEOC) cell lines, ES-2 (High grade ovarian clear cell adenocarcinoma), OVCAR-5 (High grade ovarian serous adenocarcinoma), HEY (High grade ovarian serous adenocarcinoma) and PEO-1 (High grade ovarian cystadenocarcinoma) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). ES-2 and PEO-1 cells were cultured in RPMI 1640, whereas OVCAR-5 and HEY cells were maintained in DMEM medium. All media were supplemented with 10% foetal bovine serum, 50 U/mL of penicillin, and 50 µg/mL of streptomycin (Thermo Fisher Scientific, Milan, Italy). Cells were cultured at 37 °C in a humidified incubator with 5% CO₂ atmosphere. ES-2 and HEY cells were plated at a concentration of 2.0 $\times$ 10⁵ cells/well in a 6 well plate, while OVCAR-5 and PEO-1 cells were plated at a concentration of 2.5 $\times$ 10⁵ cells/well. After 24 hours, the medium was removed, cells were washed with PBS1X, and RSL3 ((1S,3R)-RSL3), Cat. HY-100218A/CS-5650, MedChemExpress, D.B.A., Milan, Italy) or RSL3 and Ferrostatine-1 (Fer-1) (Ferrostatine-1, AMBH303C51A, Merk Life Science S.r.l., Milan, Italy) conditioned medium was added for 24 hours. Untreated cells were used as control. All experiments were performed between the first (p1) and the 4th (p4) passage of cell culture. All cell lines were validated by STR profiling and tested negative for mycoplasma (MycoAway™ 1000X Mycoplasma Cocktail, G398 ABM; Mycoplasma PCR Detection Kit G238, Applied Biological Materials Inc., Viking Way Richmond, Canada).

To assess RSL3 toxicity, ES-2, HEY, OVCAR-5 and PEO-1 cells were treated with the following concentrations of RSL3: (ES-2: 50 nM, 100 nM, 200 nM; HEY: 1 µM, 2 µM, 6 µM; OVCAR-5: 2.5 µM, 5 µM, 10 µM; PEO-1: 5 µM, 10 µM, 15 µM). To assess Fer-1 toxicity, PEO-1 cells were treated at different concentrations of Fer-1 (5 µM, 10 µM, 15 µM) and ES-2, HEY and OVCAR-5 cells were treated respectively with 1, 10 and 2 µM of Fer-1concentration as indicated in [37, 38, 39]. Co-treatment with RSL3 and Fer-1 was performed for each cell line. Cells were processed as already described [40]. Briefly, 1 $\times$ 10⁵ cells with different treatments were collected and were incubated with propidium iodide (PI) at 37 °C for 15 min in the dark. After the incubation, 400 µL of PBS (1$\times$) was added, and all samples were acquired by FACS BD LSRFortessa™ X-20 cytofluorimeter (BD Biosciences, San Jose, CA, USA), measuring PI (PE) fluorescence against the forward scatter parameter (FSC-A). Data were analysed by FlowJo™ v10 Software (BD Biosciences, San Jose, CA, USA). Untreated cells were used as a control.

The growth rates of cells were obtained using the Trypan Blue dye exclusion method. Cell viability of ES-2, HEY, OVCAR-5, and PEO-1 was also evaluated with the CellTiter-Glo® Luminescent Cell Viability Assay (Promega, Madison, WI, USA), which is based on the quantitation of ATP as an indicator of metabolically active cells as previously described [41, 42]. Briefly, cells were plated in 96 wells overnight and the next day, were treated or not with different concentrations of RSL3 for 24 h. Each experiment was performed in technical and biological triplicates. Half-maximal inhibitory concentrations (IC₅₀) were calculated by plotting a dose-response curve using non-linear regression analysis using GraphPad Prism V9 software (GraphPad Software, Boston, MA, USA).

Apoptosis assay was assessed as already described [43]. Briefly, a number of 1 $\times$ 10⁵ of untreated and RSL3, Fer-1 or RSL3 and Fer-1 treated cells (ES-2, HEY, OVCAR-5 and PEO-1), were double-stained with Annexin V and PI (Alexa Fluor®488 Annexin V/Dead Cell Apoptosis Kit, Thermo Fisher Scientific) for 15 min at RT in the dark. 400 µL of Binding Buffer was added, and all samples were acquired by FACS BD LSRFortessaTM X-20 cytofluorometer (BD Biosciences), measuring PI (PE) fluorescence against Annessin V (FITC) fluorescence. Data were analysed by FlowJo™ v10 Software (BD Biosciences). Untreated cells were used as a control. Each experiment was performed in technical and biological triplicates.

Intracellular ROS production was quantified through the redox sensitive probe 2^′-7^′-Dichlorodihydrofluorescein diacetate (CMH2DCFDA) (Thermo Fisher Scientific). ES-2, HEY, OVCAR-5 and PEO-1 were treated with RSL3, Fer-1 or RSL3 and Fer-1 Cells were incubated with CMH2DCFDA for 30 min at 37 °C. Thereafter, cells were centrifuged and resuspended in 200 µL of PBS (1$\times$). Samples were acquired by FACS BD LSRFortessaTM X-20 cytofluorometer (BD Biosciences) and data were analysed with FlowJo v10 Software (BD Biosciences). Untreated cells were used as a control. Each experiment was performed in technical and biological triplicates. Gating strategy is indicated in Supplementary Fig. 1A.

Mitochondrial ROS production was assessed in both untreated and treated cells (ES-2, HEY, OVCAR-5 and PEO-1) with RSL3, Fer-1 or RSL3 and Fer-1. Single cell suspensions were incubated with MitoSOX (MitoSOX Red Mitochondrial Superoxide Indicator (Thermo Fisher Scientific, Waltham, MA, USA) for 30 min at 37 °C. Thereafter, cells were centrifugated and resuspended in 200 µL of PBS (1$\times$). Samples were acquired by FACS BD LSRFortessaTM X-20 cytofluorometer (BD Biosciences) and data were analysed with FlowJo v10 Software (BD Biosciences). Untreated cells were used as a control. Each experiment was performed in technical and biological triplicates. A gating strategy is indicated in Supplementary Fig. 1A.

Lipid peroxidation was investigated as previously described [35]. ES-2, HEY, OVCAR-5 and PEO-1 cells untreated and treated with RSL3, Fer-1 or RSL3 and Fer-1, were incubated with BODIPY (BODIPY™ 581/591C11 dye (Thermo Fisher Scientific) for 30 min at 37 °C. Cells were washed twice with PBS (1$\times$). Oxidation of BODIPY-C11 was observed by a shift of the fluorescence emission peak from ~590 nm to ~510 nm, directly correlated with lipid ROS generation. Samples were acquired by FACS BD LSR Fortessa TM X-20 cytofluorometer (BD Biosciences) and data were analysed with FlowJo v10 Software (BD Biosciences). Untreated cells were used as a control. Each experiment was performed in technical and biological triplicates. A gating strategy is indicated in Supplementary Fig. 1A.

To obtain NK cells, we first separated PBMCs from buffy coats provided by healthy donors using a standard density gradient centrifugation protocol [44]. Buffy-coats from healthy volunteers were supplied by the blood transfusion center of Pugliese-Ciaccio Hospital, Catanzaro, Italy, previous consent to the processing of personal data. In accordance with Italian regulations (Legislative Decree 196/2003 as amended by Legislative Decree 101/2018, and EU Regulation 2016/679 – GDPR), this study used residual biological material collected for routine diagnostic purposes. All samples were anonymized prior to analysis. No additional procedures or interventions were performed for research purposes. In line with national regulations, this type of retrospective, anonymized analysis does not require approval from an ethics committee. All procedures were conducted in compliance with the Declaration of Helsinki and institutional guidelines. Blood samples were divided into Falcon tubes according to the protocol described in [44]. For each tube, an equal volume (1:1) of PBS (1$\times$) and Lymphocyte Separation Medium (density 1.007 g/mL; Sigma Aldrich, Merck KGaA, Darmstadt, Germania) was added. The samples were then centrifuged at 2200 rpm for 30 minutes without brake. After the centrifugation, white ring cells were collected, washed twice with PBS (1$\times$) and were incubated with a red blood cell lysis buffer (Sigma Aldrich, Merck, Germany) at RT for 15 min. After the incubation, cells were washed with PBS1X and were cultured overnight at a concentration of 1.0 $\times$ 10⁶ cells/mL. The day after, cells were centrifuged and NK cells were isolated by using human NK Cell Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany). Cells were counted and incubated with NK Cell Biotin-Antibody Cocktail (for 5 min at 2–8 °C) and subsequently they were incubated with NK Cell MicroBead Cocktail (for 10 min at 2–8 °C). After the incubation, we proceed to subsequent magnetic cell separation. NK Isolation kit ensures around 95% of purity. To verify this, once isolated, purified NK cells were stained with CD56 and CD3 and analyzed by flow cytometry. PBMCs were used as control. Cell debris and dead cells were excluded by using viability marker (BD Horizon™ Fixable Viability Stain 780) (SSC vs viability fluorescence). Purified resting NK cells were used for cytotoxicity assay. The gating strategy is indicated in Supplementary Fig. 1C.

After the incubation with RSL3, ES-2, HEY, OVCAR-5 and PEO-1 cells were collected and incubated with a viability marker (BD Horizon™ Fixable Viability Stain 780) for 15 min at RT in the dark. A number of 2 $\times$ 10⁵ cells were used for each tube. Then, cells were washed twice with PBS (1$\times$) and were marked with the following antibodies: APC anti-human CD274 (B7-H1, PD-L1; clone 29E.2A3)/IgG2b, PE anti-human MICA/MICB (clone 6D4)/IgG2a, APC anti human CD155 (PVR) (clone SKII.4)/IgG1, PE anti-human CD112 (Nectin-2) (clone TX31)/IgG1 were purchased from BioLegend (San Diego, CA, USA); PE anti-human ULBP-2/5/6 (clone FAB1298P)/IgG2a were purchased from R&D Systems (Minneapolis, MN, USA). Cells were maintained for 30 minutes at +4 °C in the dark and subsequently centrifugated and pellets were resuspended with 200 µL of FACS FLOW and were acquired by FACS BD LSRFortessaTM X-20 cytofluorometer (BD Biosciences).

Voltages for physical parameters (SSC, FSC) and fluorescence channels were previously optimized for each cell line used. After identifying the population of interest, live cells were discriminated against from dead cells using an SSC-A vs viability marker plot. Subsequently, all markers were acquired on the live cell population gate (viability marker-negative). Data was analyzed with FlowJo v10 Software (BD Biosciences). Untreated cells were used as a control. Each experiment was performed in technical and biological triplicates. The gating strategy is indicated in Supplementary Fig. 1B.

Cytotoxicity assay was performed as already described [45]. After 24 hours of incubation with RSL3, target cells were detached with trypsin, centrifuged at 1500 rpm for 5 min and counted with trypan blue. Target cells were subsequently plated with purified NK cells in nude RPMI-1640 medium in 96 well U-bottom plates. The experiments were performed starting from 50:1 (500.000:10.000) Effector to Target Ratio(E:T). Co-cultures were incubated in a humidified 5% CO₂ incubator at 37 °C for three hours. After centrifugation at 250 $\times$g for 10 min the supernatants were collected and transferred into a96 well, flat-bottom micro-plate. Cells were incubated with freshly prepared reaction mixture (Cytotoxicity Detection Kit lactate dehydrogenase (LDH) (Roche) for 30 min at 37 °C. LDH activity was determined with the multiwell reader (Multiskan Microplate Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA), with a sample’s absorbance at 490 nm. The percentage of target cell lysis was calculated as follows: cytotoxicity (%) = (target cell mix – low control) / (high control – low control) $\times$ 100. Untreated cells were used as a control. All the experiments were performed in technical and biological triplicates.

A total of 1 µg of RNA, previously prepared using PureLink RNAMini Kit (Thermo Fisher Scientific) and verified using a NanoDrop 2000/2000c Spectrophotometer (Thermo Fisher Scientific), was used to synthesize cDNA using SuperScript III reverse transcriptase and was amplified with the iQ™ SYBR® green super mix (BioRad, Milan, Italy) using the qRT-PCR amplifier QuantStudio3 (Applied Biosystems, Milan, Italy) [46]. Reactions were carried out in triplicate, and the analysis of gene expression was calculated as 2^-ddCt and normalized for the house-keeping gene (Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH)). Primers used in this study were as follows (5-3):

h-GPX4 (fwd) ATCGACGGGCACATGGTTAA,

h-GPX4 (rev) CGACGAGCTGAGTGTAGTTT.

h-NRF2 (fwd) CACCACCCACACAACTTACTGC,

h-NRF2 (rev) GGTCTTCTTGGGGCTTAGGT.

h-CD71 (fwd) TGCTGCTTTCCCTTTCCTTG,

h-CD71 (rev) GCTCGTGCCACTTTGTTCAA.

h-GAPDH (fwd) CACCATCTTCCAGGAGCGAG,

h-GAPDH (rev) TCAC-GCCACAGTTTCCCGGA.

Total extracts were prepared as previously described [47]. Briefly, to obtain total protein extracts, cells were washed once with PBS (1$\times$) and total cell lysates were prepared using RIPA. The samples were centrifuged at 12,000 rpm for 20 min at +4 °C and supernatants containing the total extracts were recovered. Proteins were separated on 4–12% NuPAGENovexBis-Tris protein gradient polyacrylamide gels (Thermo Fisher Scientific) and blotted onto nitrocellulose. Membranes were blocked with 5% milk (BioRad) and then incubated with the following antibodies: GPX4 with a rabbit anti-GPX4 (1:500, ab41787), NRF2 with a mouse anti-NRF2 (1:500, sc-365949, Santa Cruz, Milan, Italy) antibody, CD71 with a rabbit anti-CD71 (1:1000, D7S5Z, Cell Signaling Technology, Milan, Italy) antibody and GAPDH with an anti-GAPDH-HRP conjugated (1:1000, sc-47724). Peroxidase AffiniPure Sheep Anti-Mouse IgG, Peroxidase AffiniPure Donkey Anti-Rabbit IgG, Peroxidase AffiniPure Donkey Anti-Mouse IgG (1:10,000, Jackson ImmunoResearch Europe Ltd. Cambridge House) secondary antibodies were used. Signals were detected using the WESTARï2.0 ECL substrates for Western blotting (XLS070,0250, Cyanagen, Bologna, Italy) and acquired using a Uvitec Alliance Mini HD9 (Uvitec, Cambridge, UK).

All experiments were performed in triplicate, and data are presented as the mean $\pm$ standard deviation (SD). Statistical comparisons were conducted using paired two-tailed Student’s t-tests in GraphPad Prism 5.0. Statistical significance was denoted as follows: p 0.05 (*), p 0.01 (**), p 0.001 (***) [42].

To assess whether RSL3 modulates NK cell-mediated response against ovarian cancer, the following cell lines (ES-2, HEY, OVCAR-5 and PEO-1) were treated with increasing concentrations of RSL3 for 24 hours (Fig. 1). For the purposes of this study, a concentration of RSL3 slightly below the IC₅₀, resulting in moderate cell death ($\sim$40%), were selected (Fig. 1). The IC₅₀ value for each cell line is reported on Fig. 1. Flow cytometry analysis confirmed the induction of ferroptosis in RSL3-treated HGOC cell lines (Figs. 2,3). RSL3 treatment significantly increased lipid peroxidation (RSL3 treated vs NT: 16.5$\times$ fold, p value 0.003 for ES-2; 3.84$\times$ fold, p value 0.04 for HEY; 20.5$\times$ fold, p value 0.02 for OVCAR-5; 1.36$\times$ fold, p value 0.02 for PEO-1; Fig. 2), mitochondrial ROS (RSL3 treated vs NT: 1.25$\times$ fold, p value 0.004 for ES-2; 2$\times$ fold, p value 0.04 for HEY; 1.76$\times$ fold, p value 0.01 for OVCAR-5; 1.5$\times$ fold, p value 0.0003 for PEO-1; Fig. 3A) and total intracellular ROS (RSL3 treated vs NT: 3.47$\times$ fold, p value 0.008 for ES-2; 2.65$\times$ fold, p value 0.0001 for HEY; 1.72$\times$ fold, p value 0.02 for OVCAR-5; 1.79$\times$ fold, p value 0.0001 for PEO-1 levels; Fig. 3B). Co-treatment with Ferrostatin-1 (Fer-1), a ferroptosis inhibitor, and RSL3 restored cellular viability (Supplementary Fig. 2A) together with intracellular ROS levels and lipid peroxidation to those observed in untreated cells (Supplementary Fig. 2B), effectively preventing ferroptotic cell death. Western blotting (Fig. 4A and Supplementary Fig. 3) and qRT-PCR (Fig. 4B) analyses confirmed RSL3-induced ferroptosis. CD71 mRNA levels were significantly increased in ES-2, HEY, and OVCAR-5 cells (RSL3 vs NT: p value 0.010 for ES-2; p value 0.032 for HEY; p value 0.025 for OVCAR-5), while a slight, but not significant, change was observed in PEO-1 cells. At the protein levels, CD71 was significantly increased only in ES-2 and PEO-1 cells (RSL3 vs NT: p value 0.002 for ES-2; p value 0.028 for PEO-1), whereas changes in HEY and OVCAR-5 were not statistically significant. NRF2 mRNA levels were significantly reduced in all cell lines (RSL3 treated vs NT: p value 0.016 for ES-2; p value 0.001 for HEY; p value 0.013 for PEO-1; p value 0.016 for OVCAR-5). At the protein level, NRF2 was significantly decreased only in ES-2 cells (RSL3 vs NT: p value 0.014), while increased levels were observed in HEY and OVCAR-5 cells (RSL3 vs NT: p value 0.0001 for HEY; p value 0.0004 for OVCAR-5). In PEO-1 cells, an increasing trend was observed (p value 0.058). GPX4 expression was reduced both at mRNA (RSL3 vs NT: p value 0.010 for ES-2; p value 0.012 for HEY; p value 0.053 for PEO-1; p value 0.045 for OVCAR-5) and protein (RSL3 vs NT: p value 0.00008 for ES-2; p value 0.003 for HEY; p value 0.0001 for PEO-1; p value 0.025 for OVCAR-5) levels in all cell lines.

Fig. 1.

Dose-dependent RAS-Selective Lethal 3 (RSL3) cytotoxicity on human ovarian cancer cell lines. Ovarian cancer cell lines were treated with RSL3 for 24 hours at the following concentrations: (A) ES-2: 50, 100, 200 nM; (B) HEY: 1, 2, 6 µM; (C) OVCAR-5: 2.5, 5, 10 µM; (D) PEO-1: 5, 10, 15 µM. The IC₅₀ of RSL3 was determined for all cell lines (A–D left panel). The percentage of dead cells (propidium iodide (PI) positive) is reported in each representative plot (A–D, middle panel). Statistical analysis of % of PI positive cells untreated (NT) and treated with RSL3 was reported for each cell line tested (A–D right panel). All the experiments were performed in technical and biological triplicates. Data were represented as means $\pm$ SD; ***p-value 0.001; **p value 0.01; *p value 0.05. A paired two-tailed Student’s t test was used. (E) RSL3 IC₅₀ cell viability on high-grade ovarian cancer (HGOC) was assessed through Cell Titer Glo following treatments with increasing amounts of RSL3 for 24 hours.

Fig. 2.

RSL3 induces lipid peroxidation in ovarian cancer cell lines. Statistical analysis (upper panel) and representative plots (bottom panel) of the percentage of positive cells for BODIPY-C11 are reported. Cells were treated with RSL3 for 24 hours at the following concentrations: 50 nM (ES-2), 1 µM (HEY), 5 µM (OVCAR-5) and 5 µM (PEO-1). All the experiments were performed in technical and biological triplicates. Data were represented as means $\pm$ SD. **p-value 0.01; *p-value 0.05. A paired two-tailed Student’s t test was used.

Fig. 3.

RSL3 enhances intracellular reactive oxygen species (ROS) in ovarian cancer cell lines. (A) Statistical analysis of Median Fluorescence Intensity (MFI) (left panel) and representative histograms (right panel) of MitoSOX are reported. (B) Statistical analysis of MFI (left panel) and representative histograms (right panel) of CM-H2DCFDA are reported. Cells were treated with RSL3 for 24 hours at the following concentrations: 50 nM (ES-2), 1 µM (HEY), 5 µM (OVCAR-5), 5 µM (PEO-1). All the experiments were performed in technical and biological triplicates. Data were represented as means $\pm$ SD. ***p-value 0.001; **p-value 0.01; *p-value 0.05. A paired two-tailed Student’s t test was used.

Fig. 4.

RSL3 induces mRNA and protein expression of ferroptosis-associated markers in HGOC cell lines. Cells were treated with RSL3 or Fer-1 alone or co-treated with RSL3 and Ferrostatin-1 (Fer-1) for 24 hours (NT indicates untreated cells). Proteins and total RNA, extracted from human ovarian cancer cell lines, were analysed by western blot (A) and qRT-PCR (B) for the expression of GPX4, NRF2 and CD71 in ES-2, HEY, OVCAR-5 and PEO-1. Results were normalized using GAPDH as the housekeeping protein or gene. All experiments were performed in technical and biological triplicates. Asterisks indicate *p-value 0.05, **p-value 0.01, ***p-value 0.001. A paired two-tailed Student’s t test was used. GPX4, Glutathione Peroxidase 4; NRF2, Nuclear factor erythroid 2-related factor 2; GAPDH, Glyceraldehyde-3-Phosphate Dehydrogenase.

Co-treatment with Fer-1 and RSL3 modulated RSL3-associated changes at both mRNA and protein levels (Fig. 4 and Supplementary Fig. 3). In particular, at mRNA levels, were observed changes in CD71 (Fer-1 + RSL3 vs RSL3: p value: 0.009 for ES-2; p value 0.029 for OVCAR-5), NRF2 (Fer-1 + RSL3 vs RSL3: p value 0.011 for HEY; p value 0.008 for PEO-1; p value 0.014 for OVCAR-5), and GPX4 (Fer-1 + RSL3 vs RSL3: p value 0.002 for ES-2; p value 0.005 for HEY; p value 0.022 for OVCAR-5). No significant changes were observed for CD71 in HEY and PEO-1 cells, for NRF2 in ES-2 cells, and for GPX4 in PEO-1 cells. At the protein levels, changes were observed in CD71 (Fer-1 + RSL3 vs RSL3: p value 0.019 for ES-2), NRF2 (Fer-1 + RSL3 vs RSL3: p value 0.020 for ES-2; p value 0.002 for OVCAR-5), and GPX4 (Fer-1 + RSL3 vs RSL3: p value 0.003 for ES-2; p value 0.011 for PEO-1). No significant changes were observed for CD71 in HEY and OVCAR-5, for NRF2 in HEY and PEO-1 and for GPX4 in HEY and OVCAR-5 cells. All together these results confirm that RSL3 induces ferroptosis in HGOC cell lines. Notably, none of the tested cell lines showed evidence of apoptosis upon exposure to RSL3 (Supplementary Fig. 4). Taken together, these results demonstrate that low doses of RSL3 are sufficient to induce ferroptosis in HGOC cell lines, establishing a basis for investigating its role in modulating NK cell-driven anti-tumor immunity.

To evaluate whether RSL3-induced ferroptosis directly affects the innate immune response, we performed flow cytometric analysis of surface molecules (PVR, Nectin-2, PD-L1, ULBP2, MICA/B) involved in NK cell recognition (Fig. 5). Treatment with RSL3 led to a reduction of PVR and PD-L1 expression in ES-2 and OVCAR-5 cells (RSL3-treated vs NT: 0.82$\times$ fold, p value 0.02 for ES-2; 0.86$\times$ fold, p value 0.04 for OVCAR-5 for PVR; 0.92$\times$ fold, p value 0.01 for ES-2; 0.84$\times$ fold, p value 0.04 for OVCAR-5 for PD-L1; Fig. 5A,C). In contrast, PD-L1 expression was increased in PEO-1 cells, (RSL3-treated vs NT: 1.18$\times$ fold, p value 0.013; Fig. 5D), while no significant alterations were observed in HEY cells (Fig. 5B). RSL3 treatment did not significantly alter the expression of Nectin-2 and ULBP2 in ES-2 and HEY cells (Fig. 5A,B), whereas these molecules were significantly upregulated in OVCAR-5 and PEO-1 cells (RSL3-treated vs NT: 1.31$\times$ fold, p value 0.01 for OVCAR-5; 1.24$\times$ fold, p value 0.002 for PEO-1, for Nectin-2; 1.45$\times$ fold, p value 0.0003 for OVCAR-5; 1.6$\times$ fold, p value 0.000002 for PEO-1 for ULBP2; Fig. 5C,D). No significant alterations in MICA/B expression were observed across the tested cell lines (Fig. 5A–D). These data indicate that RSL3 modulates the expression of some surface molecules in a cell line-specific manner, reflecting the intrinsic heterogeneity of ovarian cancer.

Fig. 5.

RSL3 modulates the expression of NK activating and inhibiting molecules on ovarian cancer cell lines. Flow cytometry analysis of PVR, Nectin-2, PD-L1, ULBP2, and MICA/B molecules expressed on (A) ES-2, (B) HEY, (C) OVCAR-5, (D) PEO-1 cells was performed. Statistical analysis is reported. All the experiments were performed in technical and biological triplicates. Data were represented as means $\pm$ SD. ***p-value 0.001; **p-value 0.01; *p-value 0.05. A paired two-tailed Student’s t test was used. NK, Natural Killer; PVR, Poliovirus Receptor; Nectin-2, Nectin-like molecules-2; MICA/B, MHC class I chain-related protein (MIC) A and B; ULBP2, Unique Long 16-Binding Protein 2; PD-L1, Programmed Death-Ligand 1.

To determine whether RSL3 treatment influences NK cell-mediated cytotoxicity, we conducted LDH-release assays using purified NK cells from healthy donors co-cultured with HGOC cells at different E:T ratios (Fig. 6). The results demonstrated variable susceptibility among RSL3-treated ovarian cell lines. ES-2 and PEO-1 exhibited minimal lysis (Fig. 6A,D). HEY cells showed a decreased lysis compared to untreated cells (Fig. 6B). Conversely, OVCAR-5 cells displayed a significant increase in NK cell killing following RSL3 treatment (RSL3-treated vs NT: 1.34$\times$ fold, p value 0.04 for 50/1; 1.43$\times$ fold, p value 0.008 for 25/1; 1.4$\times$ fold, p value 0.02 for 12/1; 1.78$\times$ fold, p value 0.02 for 6:1 E:T ratios; Fig. 6C). This variability reflects the distinct expression patterns of activating and inhibitory ligands among the different cell lines. In particular, the increased NK cell lysis observed in OVCAR-5 cells appears to be driven by the combined downregulation of inhibitory ligands (PVR, PD-L1) and upregulation of activating ligands (Nectin-2, ULBP2), which facilitates effective immune recognition and cytotoxicity.

Fig. 6.

Susceptibility of RSL3-treated HGOC cell lines to NK cell-mediated killing. Representative experiment (left panel) and statistical analysis (right panel) of cytotoxicity assay against untreated (NT) and RSL3-treated cells are reported. Purified NK cells were used as effector cells. (A) ES-2 were treated with 50 nM of RSL3 for 24 hours. (B) HEY were treated with 1 µM of RSL3 for 24 hours. (C) OVCAR-5 were treated with 5 µM of RSL3 for 24 hours. (D) PEO-1 were treated with 5 µM of RSL3 for 24 hours. Different E:T ratio show the percentage of NK cell lysis of untreated and RSL3-treated cells. All the experiments were performed in technical and biological triplicates. Data were represented as means $\pm$ SD. **p value 0.01; *p value 0.05. A paired two-tailed Student’s t test was used.

Conversely, the absence or insufficient modulation of ligands on ES-2, HEY, and PEO-1 cells results in impaired lysis, leading to either a lack of response or a reduced NK cell-mediated lysis.

In summary, these findings indicate that while RSL3-induced ferroptosis modulates the expression of immune ligands, it alone is insufficient to consistently elicit NK cell-mediated cytotoxicity across all HGOC cell lines.