The expression of lnc-RNA RAB11B-AS1 was analyzed using data from the TCGA database (https://cancergenome.nih.gov/) and data regarding RAB11B-AS1 copy number alterations were sourced from cBioPortal (https://www.cbioportal.org/). The Kaplan-Meier survival analysis was employed to assess the overall survival of patients diagnosed with cervical cancer, with a p-value of less than 0.05 being defined as statistically significant.

A total of 135 formalin-fixed, paraffin-embedded (FFPE) cervical tissue specimens were included in this study, which were collected from patients in our hospital between January 2019 and June 2024. The cohort consisted of two groups: 35 adjacent non-cancerous tissue specimens and 100 cervical carcinoma tissue specimens. The adjacent normal tissues were obtained from the non-cancerous periphery of surgical resections in patients with early-stage cervical cancer, all of which were confirmed to be histologically normal by pathological examination. The carcinoma tissues were collected from patients who underwent biopsy or surgical procedures in our Department of Gynecology, with a confirmed diagnosis of cervical cancer. All tissue specimens were processed according to standard protocols within 30 minutes after resection, fixed in 10% neutral buffered formalin, routinely embedded in paraffin, and stored in our hospital’s pathology department biobank for subsequent sectioning and analysis. All cervical cancer patients enrolled in this study were treated at the Department of Obstetrics and Gynecology, Shanghai Tongji Hospital. None of the included patients had a history of other malignant tumors, and 135 patients not undergone any radio or chemotherapy prior to this study. This study was conducted in accordance with the guiding principles of the Declaration of Helsinki. The experimental protocol was approved by the Ethics Committee of Shanghai Tongji Hospital (Approval Number: K-W-2025-011), and prior written informed consent was acquired from all enrolled patients.

The human cervical carcinoma cell line SiHa was commercially purchased from the American Type Culture Collection (ATCC) (Catalog No. HTB-35) and was cultured strictly according to the provider’s guidelines. SiHa was cultured at 37 ℃ in 90% humidity and 5% carbon dioxide (CO₂) in DMEM medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (FBS) (Gibco, USA) and penicillin-streptomycin (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) in a CO₂ incubator. All cell lines were validated by short tandem repeat analysis and tested negative for mycoplasma.

The expression of RAB11B-AS1 was detected using RNAscope, a novel RNA in situ hybridization assay. Specific RNAscope probes targeting RAB11B-AS1 (Probe-Hs-RAB11B-AS1, Cat # 838261, Advanced Cell Diagnostics, Newark, CA, USA) were employed. RAB11B-AS1 expression levels were quantified using the semiquantitative histopathological ACD scoring system, which is outlined below: Zero = no staining or fewer than one red punctate dot per ten cells; one = one to three dots per cell; two = four to nine dots per cell with no or rare clustering; three = ten to fifteen dots per cell and/or fewer than ten per cent of dots in clusters; four = at least fifteen dots per cell and/or at least ten per cent of dots in clusters.

Total RNA extraction was carried out using Trizol reagent (Cat. No. F419KA1560, Sangon Biotech, Shanghai, China) according to the manual. The reverse transcription process was carried out utilising the PrimeScript RT Reagent Kit (Cat. No. RR047A, Takara Bio, Tokyo, Japan). Quantitative PCR (qPCR) was conducted using PrimeSTAR Max DNA Polymerase with SYBR Green (Cat. No. R045A, Takara Bio, Tokyo, Japan) on an ABI7500 instrument (This product was manufactured by Applied Biosystems, a company based in Carlsbad, CA, USA).

All primer sequences were synthesized by Shanghai Sangon Biological Co., LTD. The specific sequences are as follows:

RAB11B-AS1 forward (5^′-3^′): TAATCCCAGCCATTTGTG,

RAB11B-AS1 reverse (5^′-3^′): GAATCTCGCTCTGTTGCC.

RPL26 forward (5^′-3^′): GACAGAAGTACAACGTGCGA,

RPL26 reverse (5^′-3^′): TTTTGCGGTCTTTGTCCAGT.

$\beta$-actin forward (5^′-3^′): CCCTGGAGAAGAGCTACGAG,

$\beta$-actin reverse (5^′-3^′): CGTACAGGTCTTTGCGGATG).

$\beta$-actin was set as the internal reference gene for other transcripts. The 2^-Δ⁢Ct method ($\mathrm{\Delta }$Ct = Ct target gene – Ct internal reference) was used to calculate the relative mRNA expression of each target gene.

The full-length cDNA of human RAB11B-AS1 (NR_038237.1) was synthesized by Viral Therapy Technologies (Wuhan, China) and was cloned into lentiviral vector pLVX-ZsGreen-Puro. rLV-CON and rLV-RAB11B-AS1 were prepared with pLVX-ZsGreen-Puro and pLVX-RAB11B-AS1-ZsGreen-Puro, respectively (Viral Therapy Technologies, Wuhan, China).

The RAB11B-AS1 sgRNA targeting RAB11B-AS1 (5^′-GGCTAGGATGCGCGGCTATACGG-3^′) was cloned into the lentiviral vector pLVX-U6-CMV-Cas9-P2A-ZsGreen to construct recombinant plasmid pLVX-U6-RAB11B-AS1 sgRNA-Cas9-ZsGreen (pLVX-Cas9-RAB11B-AS1). The resulting plasmid, which was used to produce the lentiviruses rLV-Cas9-RAB11B-AS1, rLV-Cas9-CON and rLV-Cas9-RAB11B-AS1, was prepared by Viral Therapy Technologies (Wuhan, China). The infection of SiHa cells with rLV-Cas9-CON and rLV-Cas9-RAB11B-AS1 was conducted in strict accordance with the manufacturer’s guidelines.

The shRPL26 (5^′-GAAGTACAACGTGCGATCCAT-3^′) was cloned into the pLVX-shRNA-mCherry-hygro (lentiviral vector) to construct a plasmid pLVX-shRNA-mCherry-hygro to construct a recombinant plasmid pLVX-shRNA-mCherry-hygro-hRPL26 (pLVX-RAB11B-AS1-siRPL26) which was then packaged into a lentivirus rLV-RAB11B-AS1+ rLV-shRNA-RPL26. Next, the infection of SiHa cells with rLV-CON, rLV-RAB11B-AS1, rLV-RAB11B-AS1+ rLV-shRNA-RPL26.

The SiHa cells were seeded 2 $\times$ 10³ cells per well in a 96-well plate. Optical density at 450 nm (OD450) was measured using CCK-8 reagents (MCE, Sigma-Aldrich, St. Louis, MO, USA) at different time points (0 h, 24 h, 48 h, 72 h, 96 h) according to manufacturer instructions. Cell proliferation ability was determined according to OD450.

A total 600 cells were seeded in a 6-well culture dish and subsequently cultured for a period of two weeks. The colonies were fixed with methanol for a period of 15 minutes and subsequently stained with 0.5% Giemsa for a further 10 minutes. The colonies were observed and enumerated.

The SiHa cell apoptosis was detected using the AnnexinV-APC/7-AAD Apoptosis Detection Kit (Tianjin Sungene Biotech Co., Ltd., Tianjin, China). Briefly, cells were stained with 7-AAD (5 µL) and Annexin V-APC 1 µL in the dark for 15 min. Then the cells were detected using a flow cytometer (CytoFLEX, Beckman Coulter Life Sciences, Brea, CA, USA).

Cells were seeded into upper transwell chambers (Lot: 353097; Corning Inc., Corning, NY, USA) coated with or without Matrigel at a density of 6 $\times$ 10⁴ cells in 200 µL serum-free medium; 600 µL medium containing 10% FBS was added to the lower chambers. Following a 24 h incubation period, the cells located on the lower membrane were subjected to fixation in 70% ethanol at 4 ℃ for 1 h and then stained with 0.5% methylrosanilinium chloride solution for at least 20 min. Migrated and invaded cells were visualized under a microscope (200$\times$).

1.2 $\times$ 10⁶ SiHa cells were lysed by RIPA lysis buffer containing PMSF (Beyotime, Shanghai, China). Approximately 15 µg of protein extracts were separated with a precast BeyoGel™ SDS-PAGE gel (Beyotime, Shanghai), transferred onto nitrocellulose membranes, and probed with primary antibodies (anti-RPL26, 1:1000, ab59567, Abcam, Cambridge, UK; GAPDH, 1:10,000, 60004-1-Ig, Proteintech Group, Wuhan, China). Membranes were incubated at 4 °C for 24 h, then with HRP-conjugated secondary antibodies (HRP-labeled Goat Anti-Rabbit IgG (H+L), 1:1000, A0208, Abclonal, Wuhan, China) for 2 h at room. The proteins were visualized by enhanced chemiluminescence.

SiHa cells were seeded in a 24-well plate at a density of 5 $\times$ 10⁴ cells per well and cultured for 24 hours in a humidified incubator at 37 °C with 5% CO₂. Each well received 100 µL of the EdU-containing medium. The plate pulsed for 2 hours. Following the wash steps, the cells were permeabilized and processed for the click chemistry reaction, as per the kit protocol, to fluorescently label the incorporated EdU. This was followed by nuclear counterstaining. The samples were visualized and imaged using a fluorescence microscope. The percentage of EdU-positive cells was quantified by analyzing the acquired images with ImageJ software.

Total cellular RNA was extracted in accordance with the manufacturer’s instructions. Construction of the sequencing library and RNA-sequencing (RNA-seq) were performed by Beijing Novogene Company.

The total proteins were isolated. In brief, the samples were lysed with a 0.5 mL lysis buffer, which contains 6 M Urea, 0.1 M ammonium bicarbonate, and 0.2% SDS. Extracts were reduced with 10 mM DTT for 1 h at 56 ℃ and subsequently alkylated with sufficient iodoacetamide for 1 h at room temperature shielded from light. Then samples were mixed with 4 times the volume of precooled acetone by vortexing and incubated at –20 ℃ for at least 2 h. Subsequently, the samples were subjected to a process of centrifugation, resulting in the collection of the precipitation. Following two cycles of washing with cold acetone, dissolution of the pellet was achieved by means of dissolution buffer. This buffer contains 0.1 M triethylammonium bicarbonate (TEAB, pH 8.5) and 6 M urea. LC–MS/MS analyses were performed in Beijing Novogene Company.

A total of 3 $\times$ 10⁷ cells from the rLV-RAB11B-AS1 group and rLV-CON group were processed using PIS (Novogene Company, Beijing, China) and PMSF (Beyotime, Shanghai). Cells were fixed in 1% formaldehyde for 10 minutes, and the fixation was quenched by adding 0.125 M glycine for 5 min. Chromatin immunoprecipitation sequencing (ChIP-seq) for histone H3 lysine 9 acetylation (H3K9Ac) was performed by Beijing Novogene Company.

Female BALB/c nude mice aged between four and six weeks were procured from Shanghai JieSiJie Laboratory Animal Co., Ltd. The housing of the mice was conducted in accordance with the guidelines stipulated by the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978). It is imperative to note that all procedures conducted in an animal experimental context were meticulously reviewed and formally endorsed by the esteemed Animal Ethics Committee of Tongji University (Approval Number: TJAB04225102).

SiHa cells in the logarithmic growth phase were digested with trypsin, resuspended in phosphate-buffered saline (PBS), and counted to achieve a final concentration of 5 $\times$ 10⁶ cells per mouse. A 50 µL aliquot of the cell suspension was mixed with an equal volume of Matrigel on ice. The mixture was loaded into a 1 mL syringe and injected subcutaneously into the left axilla of each mouse to construct a nude mouse xenograft model. Following injection, the mice were returned to a specific pathogen-free (SPF) environment and maintained under standard conditions. Once tumors grew to about 150–200 mm³ in size following a 30-day period, the mice were humanely euthanized via rapid anesthesia induced by 5% isoflurane in an induction chamber. The resulting tumors were excised, photographed, and weighed. Some tumor samples were fixed in formalin for subsequent immunohistochemical analysis.

Statistical analysis was performed using SPSS 22.0 software (IBM Corp, SPSS, Chicago, IL, USA) and GraphPad Prism software (Version 8.0.2, GraphPad Software, Inc., San Diego, CA, USA). The measurement data were expressed as the mean $\pm$ standard deviation (S.D.). The significance of differences between groups was estimated by two-tailed student’s t-tests, one-way ANOVA and Wilcoxon rank sum test. A p-value of less than 0.05 was considered to be significant. *, p $\le$ 0.05; **, p $\le$ 0.01; ***, p $\le$ 0.001; ****, p $\le$ 0.0001; ns, not statisticant.

In order to investigate the association between RAB11B-AS1 and cancers, the TCGA data was analysed initially. The study revealed a substantial decrease in RAB11B-AS1 expression levels in tumor tissues compared to normal tissues across the majority of cancer types (Fig. 1A). Concurrent analysis using cBioPortal indicated copy number loss of RAB11B-AS1 in 82% of CC cases (Fig. 1B). Consequently, we assessed RAB11B-AS1 expression in normal cervical tissues and CC tissues using RNA in situ hybridization. The results demonstrated significant downregulation of RAB11B-AS1 in cervical cancer tissues, with markedly lower RNAscope scores compared to normal tissues (Fig. 1C,D). Further analyses across different histological grades revealed a progressive decline in RAB11B-AS1 expression with increasing tumor grade, reaching its lowest level in grade 3 (G3) CC (Fig. 1E,F). In conclusion, the analysis of online survival curves demonstrated that patients exhibiting elevated levels of RAB11B-AS1 expression demonstrated a more favorable prognosis (Fig. 1G).

Fig. 1.

RAB11B-AS1 upregulation correlates with better CC prognosis. (A) RAB11B-AS1 expression in normal and cancer tissues of multiple cancers via TCGA data. (B) Copy number variation of RAB11B-AS1 in CC in the cBioPortal database (https://www.cbioportal.org/). (C) Expression level of RAB11B-AS1 in 35 normal cervical tissues and 100 CC tissues. All micrographs (20$\times$; scale bar, 50 µm). (D) RNAscope Scores of RAB11B-AS1 in CC and normal cervical tissues. Measurement data are expressed as the mean $\pm$ SD. (E) Expression of RAB11B-AS1 in G1, G2, and G3 CC by in situ hybridization staining. All micrographs (20$\times$; scale bar, 50 µm). (F) Analysis of RAB11B-AS1 expression in G1, G2, and G3 CC. The measurement data were expressed as the mean $\pm$ SD. CC is categorized as follows: (G1) Carcinoma of the cervix that exhibits significant heterogeneity. (G2) moderately differentiated CC. (G3) poorly differentiated CC. (G) Prognostic analysis of patients with CC with high and low RAB11B-AS1 expression in online data using Kaplan-Meier curves. For (A) statistical analyses were performed using Wilcoxon rank sum test. For (D,F) Data represent the mean $\pm$ SD, and statistical analyses were performed using two-tailed unpaired t-tests. RAB11B-AS1, Ras-related protein Rab-11B antisense RNA 1; CC, Cervical cancer; TCGA, The Cancer Genome Atlas; SD, standard deviation. **, p $\le$ 0.01; ***, p $\le$ 0.001.

To explore the functional role of RAB11B-AS1 in cervical cancer, we generated SiHa cell lines with stable overexpression of RAB11B-AS1. As shown in Fig. 2A, RAB11B-AS1 expression was significantly higher in rLV-RAB11B-AS1 cells than in rLV-CON control cells. Subsequent CCK-8 assays revealed that overexpression of RAB11B-AS1 significantly inhibited the proliferation of SiHa cells (Fig. 2B). Consistent with this, colony formation assays revealed that RAB11B-AS1-overexpressing cells formed significantly fewer colonies than controls (Fig. 2C). Further analysis using Transwell assays showed that SiHa cells with RAB11B-AS1 overexpression exhibited significantly impaired migratory and invasive capacities (Fig. 2D,E). To corroborate the anti-proliferative effect, EdU incorporation assays were performed, confirming significantly attenuated proliferation in rLV-RAB11B-AS1 cells versus rLV-CON cells (Fig. 2F). Finally, flow cytometric analysis indicated that RAB11B-AS1 overexpression significantly increased the apoptosis rate in SiHa cells (Fig. 2G).

Fig. 2.

RAB11B-AS1 inhibits the tumorigenic cervical cancer cells in vitro. (A) RT-qPCR detected RAB11B-AS1 in SiHa cells infected with either rLV-CON or rLV-RAB11B-AS1. (B) CCK-8 assay was used to determine the impact of RAB11B-AS1 overexpression on SiHa cell proliferation. (C) The ability of cell colonies to form was compared between the rLV-RAB11B-AS1 group and the rLV-CON group. Representative images from three independent biological replicates are shown. (D,E) Pictures show cell migration and invasion in SiHa cells infected with rLV-CON and rLV-RAB11B-AS1. Cell migration is shown in the upper panel and cell invasion in the lower panel. All micrographs are $\times$20 magnification with a scale bar of 50 µm. Representative images from three independent biological replicates are shown. (F) EdU assay was used to detect the cell proliferation ability of RAB11B-AS1 in the rLV-CON group and rLV-RAB11B-AS1 group. All micrographs (20$\times$; scale bar, 50 µm). Representative images from three independent biological replicates are shown. (G) Detection of apoptosis in SiHa cells infected with rLV-CON and rLV-RAB11B-AS1 by Annexin V-APC/7-AAD staining on flow cytometer. Representative images from three independent biological replicates are shown. (H) RAB11B-AS1 knockdown efficiency was determined by PCR gel electrophoresis and qRT-PCR. (I) CCK-8 assay was used to detect the effect of RAB11B-AS1 knockout on the proliferation of SiHa cells. (J) Ability of cell colonies to form was compared in the rLV-Cas9-RAB11B-AS1 group and the rLV-Cas9-CON group. Representative images from three independent biological replicates are shown. (K,L) Cell migration and invasion assays were performed on SiHa cells infected with rLV-Cas9-CON and rLV-Cas9-RAB11B-AS1. All micrographs (20$\times$; scale bar, 50 µm). Representative images from three independent biological replicates are shown. (M) The impact of RAB11B-AS1 knockout on SiHa cell proliferation was evaluated using an EdU incorporation assay. All micrographs (20$\times$; scale bar, 50 µm). Representative images from three independent biological replicates are shown. (N) Flow cytometry was used to evaluate the apoptotic rate in SiHa cells following RAB11B-AS1 knockout. Representative images from three independent biological replicates are shown. (O) Nude mice were euthanized after 30 days, and the transplanted tumors were imaged. (P) Comparison of average xenograft tumor weight and appearance time (days) between the rLV-RAB11B-AS1 and rLV-CON group. (Q) H&E staining and immunohistochemistry with anti-PCNA from xenograft tumors between rLV-RAB11B-AS1 and rLV-CON (scale bar, 200 µm). (R) Analysis of the H&E staining cell positive rate (%) and PCNA positive rate (%) from xenograft tumor between rLV-RAB11B-AS1 and rLV-CON groups. All measurement data are expressed as the mean $\pm$ SD. For (A,C,E–H,J,L–N,P,R) Data represent the mean $\pm$ s.d., and statistical analyses were performed using two-tailed unpaired t-tests. For (B,I) statistical analyses were performed using one-way ANOVA tests. *, p $\le$ 0.05; **, p $\le$ 0.01; ***, p $\le$ 0.001; ****, p $\le$ 0.0001.

To further validate the inhibitory role of RAB11B-AS1 in CC cells, we used CRISPR-Cas9 technology to generate RAB11B-AS1 knockout SiHa cells. The efficiency of the knockout was confirmed by qRT-PCR and PCR gel electrophoresis (Fig. 2H). Subsequent functional assays revealed that RAB11B-AS1 depletion significantly enhanced the proliferative capacity of SiHa cells and increased colony formation compared to control cells (Fig. 2I,J). Furthermore, RAB11B-AS1 knockout markedly promoted cell migration and invasion relative to the rLV-Cas9-CON control group (Fig. 2K,L). EdU incorporation assays corroborated the enhanced proliferation upon RAB11B-AS1 loss (Fig. 2M). Finally, flow cytometry demonstrated a significant reduction in apoptosis in RAB11B-AS1 knockout cells compared to controls (Fig. 2N). Taken together, these results demonstrate that RAB11B-AS1 suppresses the proliferation, migration and invasion of cervical cancer cells in vitro, while promoting apoptosis.

Consequently, we evaluated its function in vivo using a xenograft tumor model in nude mice. Tumors derived from rLV-RAB11B-AS1 cells exhibited significantly smaller volumes, reduced average weight, and delayed onset compared to tumors from rLV-CON control cells (Fig. 2O,P). Histological analysis (H&E staining) revealed a significant reduction in the number of poorly differentiated cells in rLV-RAB11B-AS1 tumors compared to the control group (Fig. 2Q). Further immunohistochemical analysis revealed significantly lower PCNA positivity in the rLV-RAB11B-AS1 group than in the rLV-CON group (Fig. 2R). Overall, these results suggest that RAB11B-AS1 inhibits cervical tumor growth.

As RAB11B-AS1 has been shown to inhibit the growth of human cervical cancer cells in vitro and in vivo, it is important to identify the genes and signaling pathways affected by RAB11B-AS1 in cervical tumor development. First, we performed chromatin immunoprecipitation sequencing (ChIP-seq) with anti-H3K9Ac in the two stable cell lines (Fig. 3A). Heat map analysis showed 16496 up peaks and 475 down peaks, such as RPL26, S100A14, echinoderm microtubule-associated protein like 2 (EML2), cellular retinoic acid-binding protein 2 (CRABP2), microtubule-associated protein 2 (MAP2), RPL35, RPL37, RPL28, and CDC28 protein kinase regulatory subunit 1B (CKS1B) (Fig. 3B). KEGG enrichment analysis of differentially expressed genes revealed the primary cellular pathways affected by the overexpression of RAB11B-AS1. Genes found to be downregulated following this overexpression—specifically those identified via ChIP-seq peak analysis—were significantly associated with several key biological processes, particularly ribosome, regulation of actin cytoskeleton, neuroactive ligand-receptor interaction, focal adhesion, and axon guidance (Fig. 3C). Further analyses revealed a difference in the modification ability of H3K9Ac on chromosome 17: the rLV-CON group contained 1500 peaks, whereas the rLV-RAB11B-AS1 group contained 3311 peaks. Moreover, the modification ability of H3K9Ac in the promoter regions of several genes was different. For example, six peaks appeared in the promoter region of RPL26 in the rLV-RAB11B-AS1 group and three peaks appeared in the rLV-CON group (Fig. 3D). Compared with the rLV-CON group, the scores of peaks in RPL26 were higher than those in the rLV-RAB11B-AS1 group (Fig. 3E). The pGL3-RPL26-promoter-LUC luciferase reporter gene with the RPL26 promoter sequence was transfected into two groups of cells (rLV-CON and rLV-RAB11B-AS1). The results showed that, compared with the rLV-CON group, luciferase reporter gene activity was significantly higher in the rLV-RAB11B-AS1 group (Fig. 3F). Taken together, these results suggest that RAB11B-AS1 increases H3K9Ac modification in the RPL26 promoter region.

Fig. 3.

RAB11B-AS1 enhances the transcriptional activity of RPL26 by the modification of H3K9ac. (A) IP enriched RAB11B-AS1 content in the rLV-CON and rLV-RAB11B-AS1 groups. (B) Heat map of RPM in peaks in the rLV-RAB11B-AS1 and rLV-CON groups. (C) KEGG enrichment analysis of down-regulated genes after RAB11B-AS1 overexpression in ChIP-seq data. (D) Different modification ability of H3K9ac on chromosome 17 was visually browsed using the IGV browser. H3K9ac data indicated enhanced transcriptional activity of RPL26 in the rLV-RAB11B-AS1 and rLV-CON groups. (E) Analysis of the score of peaks in RPL26 between the rLV-RAB11B-AS1 and rLV-CON groups. (F) Analysis of RPL26 promoter luciferase activity between the rLV-RAB11B-AS1 and rLV-CON group. (G) Volcano plot of differential transcripts. Abscissa presents log2FC and ordinate presents-log10 (padj). (H) The transcriptomics GO enrichment analysis is illustrated in a scatter plot, where the GeneRatio is plotted against GO term annotations. Dot color represents the adjusted p-value (padj), and dot size corresponds to the number of enriched transcripts. (I) KEGG pathway enrichment analysis of up-regulated differential genes after RAB11B-AS1 overexpression in RNA-seq results. (J) Analysis of reactome pathway enrichment. Log10 (padj) and ordinate present reactome pathway enrichment annotation and the number of enriched transcripts. (K) qRT-PCR showed that RPL26 was significantly up-regulated after RAB11B-AS1 overexpression. For (E,F,K) Data represent the mean $\pm$ s.d., and statistical analyses were performed using two-tailed unpaired t-tests. ChIP-seq, Chromatin immunoprecipitation sequencing; RPL26, ribosomal protein L26. *, p $\le$ 0.05; ****, p $\le$ 0.0001.

We sought to identify how RAB11B-AS1 affected on some genes and related signaling pathways involved in cervical tumorigenesis. Firstly, we analyzed transcriptome by RNA sequencing in the two stable cell lines. The results show that 19,605 differentially expressed transcripts were identified among the 133,924 transcripts analysed, including 9498 transcripts that were up-regulated and 10,107 transcripts that were down-regulated in the rLV-RAB11B-AS1 group compared to the rLV-CON group (Fig. 3G). In particular, the expression of RPL26 was significantly higher in the rLV-RAB11B-AS1 group than in the rLV-CON group (Fig. 3G). Transcriptome GO analysis revealed that, compared to the rLV-CON group, the rLV-RAB11B-AS1 group showed significant enrichment of gene sets in pathways related to chipmaker perception, substrate-specific channel activity, plasma membrane protein complex, passive transmembrane transporter activity, ion channel activity, and channel activity (Fig. 3H). KEGG analysis showed that the differential transcripts were highly enriched in pathways related to the neuroactive ligand-receptor interaction, calcium signaling pathway, and cell adhesion molecules (CAMs) (Fig. 3I). Reactome analysis revealed the substantial enrichment of differential transcripts in the rLV-RAB11B-AS1 group than in rLV-CON group, particularly in pathways such as G-protein coupled receptor (GPCR) downstream signaling and signaling by GPCR (Fig. 3J). Finally, the expression level of RPL26 was significantly increased in the rLV-RAB11B-AS1 group compared with rLV-CON group (Fig. 3K). Collectively, these observations suggest that RAB11B-AS1 enhances the transcriptional ability of RPL26.

Considering that RAB11B-AS1 can alter cancer related-genes at the level of transcription, we determined whether RAB11B-AS1 regulates cancer related genes at the protein level. Proteins were isolated from cells infected by rLV-RAB11B-AS1 and rLV-CON, followed by quantitative analysis. A volcano plot revealed 97 differentially expressed proteins (DEPs) out of a total of 6536 identified proteins. This subset, included 51 upregulated and 46 downregulated proteins in the rLV-RAB11B-AS1 group compared with the rLV-CON group, such as RPL26, S100A14, EML2, CRABP2, TMEM168, MAP2, RPS23, and RPL37 (Fig. 4A). Subcellular localization analysis revealed that the DEPs were mainly enriched in the nucleus (34.92%) (Fig. 4B). GO analysis showed that the DEPs were highly enriched in the rLV-RAB11B-AS1 group compared to in rLV-CON group, including protein phosphorylation (n = 199), metabolic process (n = 126), nucleus (n = 307), integral component of membrane (n = 199), protein binding (n = 1201), ATP binding (n = 527), and zinc ion binding (n = 339) (Fig. 4C). Proteomics KEGG analysis showed that the DEPs were highly enriched in rLV-RAB11B-AS1 group, including systemic lupus erythematosus, cardiac muscle contraction and hypertrophic cardiomyopathy. In particular, the differentially expressed transcripts were highly enriched in the ribosome in the rLV-RAB11B-AS1 group compared with the rLV-CON group (Fig. 4D). Protein-protein interactions analysis showed that 103 upregulated proteins (e.g., RPL26, MAP2, RPL28, RPL37) and 53 downregulated proteins involved in the protein were interaction network (e.g., S100A14, EML2, CRABP2, TMEM168) (Fig. 4E–G). Among these, the most pronounced variation was observed in RPL26 expression. Subsequent validation by western blotting revealed a significant reduction in RPL26 protein levels following RAB11B-AS1 knockout (Fig. 4H).

Fig. 4.

RAB11B-AS1 up-regulates the protein expression of RPL26. (A) Volcano plots of DEPs in the rLV-RAB11B-AS1 and rLV-CON groups. (B) Subcellular localization of DEPs. (C) Analysis of proteomics GO enrichment. Abscissa presents the number of enriched proteins and the ordinate presents the GO enrichment annotation. (D) Scatter diagram of proteomics KEGG enrichment. Abscissa presents the Ratio and the ordinate presents KEGG enrichment items. (E) Protein-protein interaction networks. Red presents upregulated proteins and blue present downregulated proteins. (F,G) Tandem mass tag labeled protein quantification analysis was performed in SiHa infected with rLV-RAB11B-AS1 and rLV-CON. (H) RPL26 was detected by Western blot analysis using antibodies against RPL26 with actin as a loading control. All measurement data are expressed as mean $\pm$ SD. For (F–H) Data represent the mean $\pm$ s.d., and statistical analyses were performed using two-tailed unpaired t-tests. DEPs, differentially expressed proteins. **, p $\le$ 0.01; ***, p $\le$ 0.001.

To further elucidate the downstream mechanism by which RAB11B-AS1 modulates CC progression via RPL26, we transduced RAB11B-AS1-overexpressing cells with RPL26-targeting shRNA; western-blot analysis confirmed efficient knockdown (Fig. 5A). Volcano-plot comparison of rLV-CON versus rLV-RAB11B-AS1+rLV-shRNA-RPL26 revealed 320 up-regulated genes (including S100A14, EML2, CRABP2 and TMEM168) and 725 down-regulated genes (including MAP2) (Fig. 5B). Gene Ontology enrichment analyses identified receptor-regulator activity, peptide binding and transmembrane-signaling-receptor activity as significantly enriched among the up-regulated genes in the rLV-RAB11B-AS1 group, yet these same categories were conversely enriched among the down-regulated genes in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group (Fig. 5C,D). KEGG pathway mapping further demonstrated that Pentose and glucuronate interconversions, cell adhesion molecules (CAMs), JAK-STAT signaling and cytokine–cytokine receptor interaction were up-regulated in rLV-RAB11B-AS1 cells but significantly down-regulated upon RPL26 silencing (Fig. 5E,F).

Fig. 5.

RAB11B-AS1 regulates the expression of cancer related-genes by enhancing RPL26. (A) Western blot analysis was used to detect the efficiency of RPL26 knockdown based on RAB11B-AS1 overexpression. (B) Volcano plot of differentially expressed transcripts between the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group. (C) Scatter plot of transcriptomic GO enrichment analysis comparing the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group group. (D) Scatter plot of transcriptomic GO enrichment analysis comparing the rLV-RAB11B-AS1 group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group group. (E) KEGG pathway enrichment analysis of differentially expressed genes between the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group group. (F) KEGG pathway enrichment analysis of differentially expressed genes between the rLV-RAB11B-AS1 group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group. (G) Volcano plot displaying differentially expressed transcripts between the rLV-CON group and the rLV‑RAB11B‑AS1 group. The x‑axis represents log₂(fold change), and the y‑axis represents –log10 (p value). (H) Volcano plot of differentially expressed transcripts between the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group. (I) Scatter plot of proteomic GO enrichment analysis comparing the rLV-CON group and the rLV-RAB11B-AS1 group. (J) Scatter plot of proteomic GO enrichment analysis comparing the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group. The x axis shows the GO term annotations, and the y axis indicates the number of enriched proteins. (K) Scatter plot of proteomic KEGG pathway enrichment analysis between the rLV-CON group and the rLV-RAB11B-AS1 group. (L) Scatter plot of proteomic KEGG pathway enrichment analysis between the rLV-CON group and the rLV-RAB11B-AS1 + rLV-shRNA-RPL26 group.

To further validate the above findings, we performed a proteomic analysis. Volcano plot analysis identified a total of 505 DEPs, including 209 upregulated proteins and 397 downregulated proteins in the rLV-RAB11B-AS1 group compared with the rLV-CON group. A total of 415 DEPs were identified, including 214 upregulated proteins and 201 downregulated proteins in the rLV-RAB11B-AS1+ rLV-shRNA-RPL26 group compared with the rLV-CON group (Fig. 5G,H). Proteomics GO analysis showed that the DEPs in the rLV-RAB11B-AS1 group exhibited significant enrichment in several terms-including dephosphorylation compared to the rLV-CON group. Conversely, the GO terms, cell junction, dephosphorylation were not enriched in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group compared with the rLV-CON group (Fig. 5I,J). Proteomics KEGG analysis showed that the DEPs were highly enriched in rLV-RAB11B-AS1 group compared to the rLV-CON group, including phagosome, Hedgehog signaling pathway, and inositol phosphate metabolism. These KEGG terms, were not enriched in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group compared with the rLV-CON group (Fig. 5K,L). Collectively, these observations suggest that RAB11B-AS1 regulates the expression of cancer related-genes by enhancing RPL26.

To explore the effect of RPL26 on RAB11B-AS1 overexpression inhibiting CC, we performed in vitro and in vivo experiments. CCK-8 assays showed that compared with the rLV-CON group, the proliferation ability was significantly decreased in the rLV-RAB11B-AS1 group; however, the proliferation ability was significantly increased in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group (Fig. 6A). Furthermore, compared with the rLV-CON group, the colony formation rate was notably decreased in the rLV-RAB11B-AS1 group, but was notably increased in the rLV-RAB11B-AS1+ rLV-shRNA-RPL26 group (Fig. 6B). Next, tumorigenesis test in vivo was performed in nude mice. Compared with the rLV-CON group, the average weight of xenograft tumors was significantly decreased in the rLV-RAB11B-AS1 group. However, compared with the rLV-RAB11B-AS1 group, the average weight of xenograft tumors was remarkably increased in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group (Fig. 6C,D). Tumor onset time was significantly increased in the rLV-RAB11B-AS1 group compared with the rLV-CON group. However, compared with the rLV-RAB11B-AS1 group, the appearance time of xenograft tumors was significantly shortened in the rLV-RAB11B-AS1+ rLV-shRNA-RPL26 group (Fig. 6E). H&E staining showed that poorly differentiated cells were significantly decreased in the rLV-RAB11B-AS1 group compared with the rLV-CON group but markedly increased in the rLV-RAB11B-AS1+ rLV-shRNA-RPL26 group compared with the rLV-CON group (Fig. 6F,G). Compared with the rLV-CON group, PCNA positivity rate was significantly decreased in the rLV-RAB11B-AS1 group. However, compared with therLV-RAB11B-AS1 group, the PCNA positive rate was significantly increased in the rLV-RAB11B-AS1+rLV-shRNA-RPL26 group (Fig. 6F,H).

Fig. 6.

RPL26 knockdown abrogates the suppressor function of RAB11B-AS1 in vivo. (A) CCK-8 assay was used to detect the proliferation trend of rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1+rLV-shRNA-RPL26 groups. (B) Cell colony formation ability in the rLV-CON, rLV-RAB11B-AS1, and rLV-RAB11B-AS1-rLV-shRNA-RPL26 groups. Representative images from three independent biological replicates are shown. (C) The nude mice were euthanized at 30 days and the transplanted tumors were imaged, including the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 group. (D) Comparison of average xenograft tumor weight among the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 group. (E) Comparison of appearance time (days) of xenograft tumor among the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 groups. (F) H&E staining and immunohistochemistry with anti-PCNA from xenograft tumor among the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 groups. The picture of H&E staining (upper) and immunohistochemistry with anti-PCNA (lower); scale bar, 200 µm. (G) Analysis of H&E staining cell positive rate (%) from xenograft tumor among the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 groups. (H) Analysis of PCNA positive rate (%) from xenograft tumor among the rLV-CON, rLV-RAB11B-AS1 and rLV-RAB11B-AS1-rLV-shRNA-RPL26 groups. (I) Schematic diagram illustrating the mechanism by which RAB11B-AS1 inhibits cervical cancer progression through the regulation of ribosomal proteins, cell cycle, and adhesion molecule-related pathways. All quantitative data are presented as mean $\pm$ SD. For A statistical analyses were performed using one-way ANOVA tests. For (B,D,E,G,H) data represent the mean $\pm$ s.d., and statistical analyses were performed using two-tailed unpaired t-tests. **, p $\le$ 0.01; ***, p $\le$ 0.001; ****, p $\le$ 0.0001.