The TCGA database was utilized to examine the expression levels of PLIN3 and its prognostic significance in LUAD (Kaplan-Meier Plotter). RNA-seq data and corresponding clinical information for patients with LUAD were retrieved from the TCGA database via the UALCAN portal (https://ualcan.path.uab.edu/). On the UALCAN analysis page (https://ualcan.path.uab.edu/analysis.html), PLIN3 expression was assessed in LUAD based on sample types, cancer stages, smoking habits, nodal metastasis status, TP53 mutation status, and histological subtypes. Survival analysis was conducted using both the TCGA and Kaplan-Meier Plotter databases (https://kmplot.com/analysis/). Patients were categorized into two groups based on the median PLIN3 expression level in LUAD. Survival curves were generated to evaluate the prognostic impact of PLIN3 expression on patient survival. The analysis was performed using the following parameters: Affy ID:202122_s_at; Survival: Overall Survival (OS); Split patients by: median; Follow up threshold: all; Censor at threshold: checked; Compute median over entire database: false; Cutoff value used in analysis: 962; Expression range of the probe: 38-7829; Probe set option: user-selected probe set; Invert HR values below 1: not checked.

Tumor and adjacent non-tumor tissue samples were collected from 24 patients with LUAD at the PLA Naval Medical Center (Shanghai, China), with the non-tumor tissues being situated more than 5 cm from the tumor. Only patients with primary LUAD who had not received any prior treatment, including chemotherapy, were included in the study. All tissues were diagnosed histopathologically and clinically. The study was approved by the Ethics Committee of the Naval Medical Center (ethical approval number: AF-HEC-068), and all patients or their families/legal guardians provided written informed consent. The clinical characteristics of the included patients were summarized in Table 1.

The NSCLC cell lines H2030 (ATCC), H2405, H1755, H2347, H1703, and the lung epithelial cell line BEAS-2B were sourced from American Type Culture Collection (ATCC, Manassas, MD, USA) and cultured in a humidified incubator at 37 °C with 5% CO₂. Cells were maintained in RPMI-1640 medium (Sigma-Aldrich, Shanghai, China) supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich, Shanghai, China). All cell lines were validated by short tandem repeat (STR) profiling and tested negative for mycoplasma.

For transfection experiments, cells were seeded in 6-well plates (Sigma-Aldrich, Shanghai, China) at a density of 2 $\times$ 10⁵ cells per well and allowed to adhere overnight. Transfection of short hairpin RNA (shRNA), small interfering RNA (siRNA), or overexpression plasmids was performed using Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA). Specifically, shRNA transfection utilized a plasmid encoding the shRNA sequence, while siRNA transfection involved specific siRNA sequences targeting the genes of interest. The transfection complexes were prepared in Opti-MEM medium (Thermo Fisher Scientific, Waltham, MA, USA) and applied to the cells for 48–72 hours, after which a fresh complete medium was added. The target sequences used were: si-FOSL1-1: GACTGACAAACTGGAAGATGAGA (349–371); si-FOSL1-2: TACAAACCTACCAAAATGGAATA (1383–1405); si-PLIN3: GGGAAGCTAAGGCTCTCAAAACG (1505–1527).

The DDP-resistant LUAD cell line was established through gradual drug selection. Parental H2030 and H1775 cells were initially exposed to low concentrations of DDP (0.5–1.0 µg/mL, Sigma-Aldrich, Shanghai, China) and allowed to proliferate until stable growth was observed. The DDP concentration was then incrementally increased by 0.5–1.0 µg/mL every 2–4 weeks, enabling the cells to adapt to each new concentration. This process continued until the cells were able to proliferate stably in high concentrations of DDP (up to 10 µg/mL). Resistance development was confirmed by comparing the half-maximal inhibitory concentration (IC₅₀) of DDP between resistant and parental cells via cell viability assays. The resistant cell line was further stabilized by culturing in a DDP-free medium for several passages.

Total RNA was extracted from the cultured cells following the TRIzol reagent protocol (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA). RNA quality and concentration were assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). For cDNA synthesis, 1 µg of total RNA was reverse-transcribed using Superscript II Reverse Transcriptase (Thermo Fisher Scientific, Inc., Waltham, MA, USA). QPCR was performed with SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) on a real-time PCR detection system, employing primers specific to the target genes. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal reference for normalization. Negative controls, including no-template controls, were included to exclude contamination or non-specific amplification. Relative expression levels were calculated using the 2^{-Δ⁢Δ⁢Ct} method. The primers for FOSL1 were: left primer: AGCTGCAGAAGCAGAAGGAG; right primer: GGAGTTAGGGAGGGTGTGGT. The primers for PLIN3 were: left primer: CAGCAGAGAAGGGAGTGAGG; right primer: ACACAAGCTCCTTGGTGTCC.

Cell lysates were prepared using Radio-Immunoprecipitation Assay (RIPA) buffer (Sigma-Aldrich, Shanghai, China), supplemented with protease and phosphatase inhibitors (Sigma-Aldrich, Shanghai, China). After lysis, the samples were centrifuged at 12,000 rpm for 10 minutes at 4 °C, and the supernatants were collected. Protein concentration was quantified using a bicinchoninic acid (BCA) protein assay kit (Sigma-Aldrich, Shanghai, China). Equal amounts of protein (20–30 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Bio-Rad, Shanghai, China) and transferred to Polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Shanghai, China). The membranes were blocked for 1 hour at room temperature with 5% non-fat dry milk in tris-buffered saline with tween (TBST) (Sigma-Aldrich, Shanghai, China), followed by overnight incubation at 4 °C with primary antibodies (anti-PLIN3, SAB1406951, 1 μg/Ml, Sigma-aldrich, Shanghai, China; anti-Wnt3a, ab219412, 1:1000, Abcam, Shanghai, China; anti-β-Catenin, #9582, 1:1000, Cell Signaling Technology, Shanghai, China; anti-Lamin A/C, L1293, 1:1000, Sigma-aldrich, Shanghai, China; anti-FOSL1, SAB1411459, 1 µg/mL, Sigma-aldrich, Shanghai, China; anti-GAPDH, AB2302, 1:10,000, Sigma-aldrich, Shanghai, China). After three washes with TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibody (Rabbit Anti-Goat lgG Antibody HRP conjugate, AP106P, 1:5,000, Sigma-aldrich, Shanghai, China) for 1.5 hours at room temperature. Protein bands were visualized using an enhanced chemiluminescence (ECL) detection system (Thermo Fisher Scientific, Waltham, MA, USA). Relative protein expression was quantified using ImageJ software (Version 1.53, NIH, Bethesda MD, USA), with GAPDH or Lamin A/C as loading controls. The original Western blot is provided as Supplementary Material.

The cytotoxicity and cell viability effects of DDP were assessed using the Cell Counting Kit-8 (CCK-8) assay (Sigma-Aldrich, Shanghai, China). Cells were seeded in 96-well plates at a density of 5000 cells per well and incubated overnight to allow attachment. For the cytotoxicity assessment, cells were treated with increasing concentrations of DDP for 48 hours. Following the designated treatment or growth periods (24, 48, or 72 hours), 10 µL of CCK-8 reagent was added to each well, and the plates were incubated at 37 °C for 2 hours in the dark. Absorbance at 450 nm was measured using a microplate reader (Tecan-UK, Reading, UK), with background correction performed by subtracting the absorbance of wells containing only media and CCK-8. Cell viability or cytotoxicity was calculated as a percentage relative to control cells, with the control group set to 100% for normalization. The half maximal inhibitory concentration (IC₅₀) of DDP was determined by plotting dose-response curves and performing nonlinear regression to identify the concentration required to inhibit 50% of cell viability.

For colony formation assays, cells were plated in 6-well plates at a density of 500 cells per well and cultured at 37 °C with 5% CO₂ for 10–14 days to allow colony formation. At the end of the incubation, the culture medium was discarded, and colonies were fixed with 4% paraformaldehyde (Sigma-Aldrich, Shanghai, China) for 15 minutes at room temperature. After fixation, colonies were stained with 0.5% crystal violet (Sigma-Aldrich, Shanghai, China) for 20 minutes and washed with distilled water to remove excess stain. Colonies containing more than 50 cells were counted under a microscope (OLYMPUS IX71, Olympus, Tokyo, Japan), and colony formation efficiency was calculated by dividing the number of colonies formed by the initial cell number.

Cells were cross-linked with 1% formaldehyde (Sigma-Aldrich, Shanghai, China) for 10 minutes at room temperature to preserve protein-DNA interactions. The reaction was subsequently quenched with 125 mM glycine (Sigma-Aldrich, Shanghai, China). Following this, cells were lysed in chromatin immunoprecipitation (ChIP) lysis buffer (Thermo Fisher Scientific, Waltham, MA, USA), and chromatin was fragmented to an average size of 200–1000 bp by sonication. The sheared chromatin was subjected to overnight immunoprecipitation at 4 °C using antibodies (Anti-FOSL1, ab252421, 1/30, Abcam, Shanghai, China; IgG, I8140, 1/30, Sigma-aldrich, Shanghai, China) specific to the protein of interest or control immunoglobulin G (IgG). Immunoprecipitated DNA-protein complexes were then eluted, and cross-links were reversed by heating at 65 °C for 4 hours. Purified DNA was analyzed by qPCR using primers specific to the target DNA sequences to identify the presence of these sequences in the immunoprecipitates. Results were normalized to input DNA to account for variations in chromatin preparation and PCR efficiency.

For luciferase assays, cells were co-transfected with a luciferase reporter plasmid containing the PLIN3 promoter region and a Renilla luciferase plasmid as an internal control to assess transfection efficiency. Forty-eight hours post-transfection, cell lysates were prepared using passive lysis buffer according to the manufacturer’s instructions. Luciferase activity was measured using a dual-luciferase reporter assay system (Thermo Fisher Scientific, Waltham, MA, USA), with the firefly luciferase signal, reflecting the promoter activity of the target gene, normalized to the Renilla luciferase signal to correct for transfection efficiency. Relative promoter activity was determined by calculating the ratio of firefly to Renilla luciferase activity.

Six-week-old female nude mice (Bikai Keyi Biotechnology Co., Ltd., Shanghai, China) were subcutaneously injected with H2030/DDP cells into the right flank under anesthesia with ketamine (100 mg/mL) and acepromazine (10 mg/mL) at a dose of 100 mg/kg and 5.0 mg/kg, respectively, via intraperitoneal injection. The injected cells had undergone FOSL1 knockdown, or FOSL1 knockdown combined with overexpression of PLIN3 or Wnt3a. Mice received intraperitoneal injections of DDP at a dose of 2 mg/kg, twice weekly. Tumor dimensions were measured weekly, and tumor volume was calculated using the formula (length $\times$ width²)/2 to ensure consistent and accurate measurements. At the study’s conclusion, mice were humanely euthanized via quick cervical dislocation, and tumors were carefully excised and weighed to evaluate tumor burden. The study adhered to the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines 2019 and was approved by the ethical committee of PLA Naval Medical Center.

Experimental data were processed and analyzed using GraphPad Prism 19.0 software (Dotmatics, Boston, MA, USA). Quantitative data are presented as mean $\pm$ standard deviation (SD) from at least three independent experiments. Statistical comparisons between groups were conducted using one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparisons. For two-group comparisons, an unpaired two-tailed Student’s t-test was applied. p-values less than 0.05 were considered statistically significant. Kaplan-Meier survival curves were analyzed using the log-rank (Mantel-Cox) test. Correlation analysis was performed using Pearson’s correlation coefficient. All figures were generated with GraphPad Prism, and results were interpreted in the context of their biological relevance.

Querying the TCGA database via GEPIA (http://gepia2.cancer-pku.cn/#survival) and performing survival analysis using the Kaplan-Meier Plotter database confirmed a strong association between elevated PLIN3 expression and poor prognosis in LUAD (Fig. 1A,B). Results from both databases revealed that patients with higher PLIN3 expression had significantly reduced survival times (p 0.0001). Further analysis in the UALCAN database demonstrated that PLIN3 is markedly upregulated in LUAD tissues (Fig. 1C), with consistent findings across various LUAD subgroups stratified by cancer stages, smoking history, nodal metastasis status, TP53 mutation status, and histological subtypes (Fig. 1D–H). PLIN3 expression was significantly higher in all stages (1–4) compared to normal tissues (p 0.01). Additionally, PLIN3 expression was significantly higher in patients with LUAD regardless of smoking history compared to normal tissues (p 0.01), suggesting that PLIN3 expression may be independent of smoking. Regarding nodal metastasis status, PLIN3 expression levels were significantly elevated in patients across N0-N3 categories compared to normal (p 0.01). For TP53 mutation status, both TP53-mutant and TP53-wildtype patients showed higher PLIN3 expression compared to normal (p 0.01). In summary, bioinformatics analyses provide compelling evidence that PLIN3 is significantly upregulated in LUAD and is strongly associated with poor patient survival.

Fig. 1.

Bioinformatics analysis revealed prominent expression of PLIN3 in LUAD and its strong correlation with LUAD prognosis. (A) Survival probabilities from the TCGA database via GEPIA (http://gepia2.cancer-pku.cn/#survival) for patients with LUAD exhibiting high (n = 239) and low/medium (n = 239) PLIN3 expression (p 0.01). (B) Survival probabilities from the Kaplan-Meier Plotter database for patients with LUAD exhibiting high (n = 1082) and low (n = 1084) PLIN3 expression (p = 0.00023). PLIN3 expression in LUAD across various sample types (C), cancer stages (D), smoking habits (E), nodal metastasis status (F), TP53 mutation status (G), and histological subtypes (H). *p 0.05, **p 0.01. PLIN3, perilipin 3; LUAD, lung adenocarcinoma; TCGA, the cancer genome atlas.

Building on previous analyses, PLIN3 mRNA levels were assessed in 24 pairs of normal and LUAD tissues, revealing a marked elevation in PLIN3 expression in LUAD tissues (Fig. 2A). Consistent with these results, both transcriptional and translational levels of PLIN3 were significantly upregulated in five NSCLC cell lines (H2030, H2405, H1755, H2347, and H1703) compared to normal BEAS-2B cells (Fig. 2B,C). Among these, PLIN3 expression was most prominent in H2030 and H1775 cells, which were selected for further investigation. The impact of PLIN3 knockdown was confirmed in H2030 and H1775 cells (Fig. 2D,E), with results showing that PLIN3 knockdown notably reduced cell viability (Fig. 2F,G). In H2030/DDP cells, PLIN3 expression was significantly decreased compared to normal H2030 cells (Fig. 2H), and PLIN3 shRNA also significantly reduced PLIN3 levels in H2030/DDP cells. Moreover, cytotoxicity assays demonstrated that PLIN3 shRNA treatment significantly increased the susceptibility of H2030 cells to DDP (Fig. 2I,J). The knockdown of PLIN3 in H2030/DDP cells significantly diminished cell viability and reduced the IC₅₀ value in response to DDP treatment (Fig. 2K,L). In conclusion, these results suggest that PLIN3 is notably elevated in LUAD, playing a role in promoting DDP resistance.

Fig. 2.

PLIN3 was markedly elevated in LUAD and promoted DDP resistance. (A) Relative PLIN3 mRNA levels in normal and LUAD tissues (n = 24). Transcription (B) and translation (C) levels of PLIN3 in five NSCLC cell lines. (D,E) Western blot analysis of PLIN3 translation levels in H2030 and H1775 cells transfected with shNC or shPLIN3. Cell viability (F,G) of H2030 and H1775 cells transfected with shNC or shPLIN3. (H) PLIN3 protein levels in H2030 and H2030/DDP cells (left) and in H2030/DDP cells transfected with shNC or shPLIN3 (right). Cell viability (I) and IC₅₀ values (J) in gradient DDP concentrations of H2030 cells transfected with shNC or shPLIN3. Cell viability (K) and IC₅₀ values (L) in gradient DDP concentrations of H2030/DDP cells transfected with shNC or shPLIN3. *p 0.05, **p 0.01. DDP, cisplatin; NSCLC, non-small cell lung cancer; shNC, short hairpin RNA negative control.

Given the pivotal role of the Wnt/$\beta$-catenin signaling pathway in drug resistance mechanisms in lung cancer [25], DDP-resistant LUAD cells were subjected to either PLIN3 overexpression or knockdown, and the impact on Wnt mRNA expression was subsequently assessed. Among the Wnt family members, only Wnt3a mRNA expression was significantly altered (Fig. 3A). To further validate these observations, the effects of PLIN3 overexpression or knockdown on protein levels of intracytoplasmic Wnt3a, intracytoplasmic $\beta$-catenin, and nuclear $\beta$-catenin were evaluated. The results demonstrated that PLIN3 knockdown notably reduced Wnt3a protein levels, increased intracytoplasmic $\beta$-catenin protein levels, and decreased nuclear $\beta$-catenin levels (Fig. 3B,C). Conversely, PLIN3 overexpression induced the opposite effects (Fig. 3D,E). These results collectively indicate that PLIN3 overexpression significantly upregulates Wnt3a expression, promotes $\beta$-catenin nuclear translocation, and activates the Wnt3a/$\beta$-catenin signaling pathway.

Fig. 3.

PLIN3 activates the Wnt/$\beta$-catenin signaling pathway. (A) Relative mRNA levels of Wnt family members in DDP-resistant LUAD cells transfected with OE-PLIN3 or shPLIN3. Protein levels of Wnt3a, intracytoplasmic $\beta$-catenin, and nuclear $\beta$-catenin in DDP-resistant LUAD cells transfected with shPLIN3 (B,C) or OE-PLIN3 (D,E). **p 0.01 compared to corresponding sh-NC or OE-NC groups. DDP, cisplatin; LUAD, lung Adenocarcinoma; OE, overexpressed; sh, short hairpin RNA.

To investigate the upstream regulatory factors of PLIN3, the TCGA database was queried to identify 205 proteins strongly correlated with PLIN3 expression. The JASPAR database (https://jaspar.elixir.no/) was then used to identify 605 transcription factors (TFs) with potential binding sites in the PLIN3 promoter region. The intersection of these two datasets revealed four common proteins: FOS-like antigen 2 (FOSL2), TEA domain transcription factor 1 (TEAD1), v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA), and FOSL1 (Fig. 4A). Further analysis using the TCGA database evaluated the prognostic significance of these four proteins in patients with LUAD, revealing that only FOSL1 was consistently associated with poorer survival outcomes (Fig. 4B–E). Additionally, analysis from the GEPIA database (http://gepia.cancer-pku.cn/index.html) showed a positive linear correlation between FOSL1 and PLIN3 expression (Fig. 4F). These data suggest that FOSL1 may regulate PLIN3 expression and influence survival in LUAD.

Fig. 4.

FOSL1 may regulate PLIN3 expression. (A) Intersection of proteins correlated with PLIN3 and transcription factors regulating PLIN3. Survival probabilities from the TCGA database for patients with LUAD exhibiting high or low/medium expression of FOSL2 (B), TEAD1 (C), RELA (D), and FOSL1 (E, p 0.0001). (F) Positive linear correlation between FOSL1 and PLIN3 expression (p = 0, R² = 0.47). FOSL1, FOS-like antigen 1; FOSL2, FOS-like antigen 2; TEAD1, TEA domain transcription factor 1; RELA, v-rel avian reticuloendotheliosis viral oncogene homolog A.

Building on previous findings regarding FOSL1’s role in regulating PLIN3 expression, its impact on DDP resistance in LUAD cells was further investigated. FOSL1 translation and transcription levels were evaluated in normal lung cells and five NSCLC cell lines, with results revealing prominent FOSL1 expression across all NSCLC cells (Fig. 5A–C). H2030/DDP cells were incubated with FOSL1 siRNA, and the protein and mRNA levels of PLIN3 were subsequently quantified. The results showed that both the transcriptional and translational levels of PLIN3 were significantly reduced following FOSL1 knockdown (Fig. 5D–F). Additionally, H2030/DDP and H1775/DDP cells were transfected with siFOSL1, siPLIN3, or a combination of siFOSL1 and a PLIN3 overexpression plasmid (siFOSL1+OE-PLIN3), and changes in cell viability and IC₅₀ values at varying DDP concentrations were monitored. FOSL1 and PLIN3 knockdown increased the susceptibility of both H2030/DDP and H1775/DDP cells to DDP, while PLIN3 overexpression mitigated the effects of FOSL1 knockdown (Fig. 5G–I). Further survival assessments revealed that siFOSL1 and siPLIN3 treatments significantly impaired cell viability, whereas PLIN3 overexpression counteracted the detrimental effects of FOSL1 knockdown on cell survival (Fig. 5J,K). These results highlight the role of FOSL1 in promoting DDP resistance in LUAD cells through the regulation of PLIN3.

Fig. 5.

FOSL1 promotes DDP resistance in LUAD through mediation of PLIN3. The translation (A,B) and transcription (C) levels of FOSL1 in five NSCLC cell lines. The translation (D,E) and transcription (F) levels of PLIN3 in H2030/DDP cells transfected with siNC or siFOSL1. The cell vitality (G,H) and IC₅₀ values (I) in gradient DDP concentration of H2030/DDP and H1775/DDP cells treated with siFOSL1, siPLIN3, or siFOSL1+OE-PLIN3. (J,K) The cell vitality of H2030/DDP and H1755/DDP cells treated with siFOSL1, siPLIN3, or siFOSL1+OE-PLIN3. **p 0.01; ^#⁢#p 0.01 compared to si-NC; ^&&p 0.01 compared to si-NC; ^$⁡$p 0.01 compared to si-FOSL1.

DDP-resistant LUAD cell lines were treated with siFOSL1, siPLIN3, or siFOSL1+OE-PLIN3, and the number of cell clones, along with protein levels of Wnt3a, intracytoplasmic $\beta$-catenin, and nuclear $\beta$-catenin, were assessed. Results demonstrated that knockdown of FOSL1 and PLIN3 significantly reduced the number of cell clones (Fig. 6A,B) and lowered the levels of Wnt3a and nuclear $\beta$-catenin, while increasing cytoplasmic $\beta$-catenin levels (Fig. 6C,D). Conversely, PLIN3 overexpression reversed the effects of FOSL1 knockdown. These results suggest that FOSL1 promotes the Wnt3a/$\beta$-catenin signaling cascade by enhancing Wnt3a expression and facilitating $\beta$-catenin nuclear translocation through PLIN3.

Fig. 6.

FOSL1 enhances the clonogenic potential of DDP-resistant LUAD cells by triggering the Wnt3a/$\beta$-catenin signaling pathway via PLIN3. (A,B) The cell colony numbers of H2030/DDP and H1775/DDP cell lines treated with siFOSL1, siPLIN3, and siFOSL1+OE-PLIN3. (C,D) The protein levels of Wnt3a, intracytoplasmic $\beta$-catenin, and nuclear $\beta$-catenin in DDP-resistant LUAD cells treated with siFOSL1, siPLIN3, and siFOSL1+OE-PLIN3. *p 0.05, **p 0.01; ^#⁢#p 0.01 compared to si-FOSL1.

To further investigate the sequence sites through which FOSL1 regulates PLIN3 expression, a search of the JASPER database identified three potential binding sites of FOSL1 on the PLIN3 promoter (P1-P3, Fig. 7A). The profile summary and sequence logo for FOSL1 were retrieved from the JASPER database (Fig. 7B). Chromatin immunoprecipitation (ChIP) assays confirmed that FOSL1 directly binds to the P1 sequence of the PLIN3 promoter in DDP-resistant cells (Fig. 7C,D). Furthermore, luciferase reporter assays performed in 293T, H2030/DDP, and H1775/DDP cells revealed a significant increase in PLIN3 promoter-driven reporter activity upon FOSL1 overexpression and a marked decrease following FOSL1 knockdown (Fig. 7E–G). These results indicate that FOSL1 enhances PLIN3 expression by directly binding to the P1 sequence of the PLIN3 promoter.

Fig. 7.

The transcription factor FOSL1 promotes PLIN3 expression via direct binding to the P1 sequence of the PLIN3 promoter. (A) The potential binding sequences of FOSL1 to the PLIN3 promoter identified by the JASPER database. (B) The profile summary and sequence logo of FOSL1 from the JASPER database. (C,D) The validation of the potential binding sequences of FOSL1 to the PLIN3 promoter by chromatin immunoprecipitation assay in two cell lines. Luciferase reporter assays of PLIN3 transcriptional activity following FOSL1 overexpression and knockdown in 293T (E), H2030/DDP (F), and H1775/DDP (G) cells. *p 0.05, **p 0.01.

To assess the in vivo impact, H2030/DDP cells were treated with FOSL1 siRNA in combination with PLIN3 or Wnt3a overexpression plasmids (OE-PLIN3 or OE-Wnt3a) and subcutaneously implanted into nude mice. Tumor growth was monitored following intraperitoneal administration of DDP (2 mg/kg) twice a week. The results showed that FOSL1 knockdown significantly suppressed tumor growth and weight in the subcutaneous model, whereas overexpression of PLIN3 or Wnt3a reversed this effect (Fig. 8A–C). These in vivo data confirm that FOSL1 promotes DDP resistance in LUAD through upregulation of PLIN3 and Wnt3a.

Fig. 8.

Validation of FOSL1, PLIN3, and Wnt3a in mediating LUAD DDP resistance in vivo. (A,B) The growth rate of subcutaneous tumors following intraperitoneal administration of DDP in nude mice. (C) The weight of subcutaneous tumors following intraperitoneal administration of DDP in nude mice. **p 0.01; ^#⁢#p 0.01 compared to si-FOSL1.