1 Obstetrics and Gynecology Center, Zhujiang Hospital, Southern Medical University, 510260 Guangzhou, Guangdong, China
2 Department of Obstetrics and Gynecology, Guangdong Provincial Key Laboratory of Major Obstetric Diseases, Guangdong Provincial Clinical Research Center for Obstetrics and Gynecology; Guangdong-Hong Kong-Macao Greater Bay Area Higher Education Joint Laboratory of Maternal-Fetal Medicine; The Third Affiliated Hospital, Guangzhou Medical University, 510150 Guangzhou, Guangdong, China
3 Department of Obstetrics and Gynecology, Shunde Hospital, The First People’s Hospital of Shunde, Southern Medical University, 528300 Foshan, Guangdong, China
†These authors contributed equally.
Abstract
N-acetyltransferase 10 (NAT10) mediates N4-acetylcytidine (ac4C) mRNA modification and promotes malignant tumor progression. However, there has been limited research on its role in cervical cancer. This study aimed to decipher the role of NAT10 in cervical cancer.
The prognostic value of NAT10 was explored using the cancer genome atlas (TCGA) database and immunohistochemistry of cervical cancer tissue. The biological actions of NAT10 in cervical cancer were investigated by cell proliferation, transwell, wound healing, and chicken chorioallantoic membrane assays. The therapeutic action of remodelin (a NAT10 inhibitor) was verified in a nude mouse model. Mechanistic analyses were conducted by RNA sequencing, ac4C dot blotting, acetylated RNA immunoprecipitation, quantitative PCR, and RNA stability experiments.
NAT10 was overexpressed in cervical carcinoma and its overexpression was associated with poor prognosis. NAT10 knockout impaired proliferative and metastatic potentials of cervical cancer cells, while its overexpression had the opposite effects. Remodelin impaired cervical cancer proliferation in vivo and in vitro. NAT10 acetylated solute carrier family 7 member 5 (SLC7A5) enhanced mRNA stability to regulate SLC7A5 expression.
NAT10 exerts a critical role in cervical cancer progression via acetylating SLC7A5 mRNA and could represent a key prognostic and therapeutic target in cervical cancer.
Keywords
- NAT10
- cervical cancer
- progression
- N4-acetylcytidine (ac4C)
- solute carrier family 7 member 5 (SLC7A5)
Cervical cancer, one of the major threats to women’s health globally [1, 2], has consistently high incidence and mortality rates [3], especially in low- and middle-income countries [4, 5]. Early-stage cervical cancer can be managed with radical surgery and adjuvant chemoradiotherapy. For recurrent and metastatic cervical cancer, effective treatment is lacking, leading to a 5-year survival rate of ~17% [6]. The addition of bevacizumab to conventional cisplatin plus paclitaxel chemotherapy can improve patients prognosis for cervical cancer, extending their life span by 3.7 months [7]. In addition, various immunotherapies have been developed to treat cervical cancer, which achieve a disease control rate reaching 52% [8, 9]. Despite these advances, the effective treatment of recurrent and metastatic cervical cancer remains a formidable challenge. Therefore, it is key for exploring mechanisms underlying the development and occurrence of cervical cancer, and identifying effective drugs to attenuate cervical cancer progression.
Acetylation of N4-acetylcytidine (ac4C) [10], an epigenetic modification [11], has become a research hotspot in recent years. N-acetyltransferase 10 (NAT10) is primary enzyme that catalyzes ac4C modification on RNA molecules, thereby enhancing RNA stability and promoting its translation and expression [12, 13, 14, 15]. An increasing number of literatures have reported that NAT10 is crucial in cancer development. For example, NAT10-mediated mRNA ac4C modification potentiates bladder cancer progression [13]. NAT10 facilitates cancer development via cell cycle modulation in non-small cell lung cancer [16]. NAT10 potentiates proliferative, migratory, invasive, and metastatic capacities of colorectal cancer cells by N4-acetylation and stabilizing ferroptosis inhibitor 1 mRNA [17]. NAT10 enhances cell proliferative ability by acetylating centrosomal protein 170 mRNA to increase translation efficiency in multiple myeloma [12]. Although mechanism of NAT10-mediated ac4C modification of RNA has been extensively explored, mechanisms by which NAT10 modulates cancer, especially cervical cancer, is not well understood. Remodelin is a NAT10 inhibitor that was first reported by Larrieu et al. in 2014 [18]. Remodelin can inhibit various tumors progression such as bladder cancer, and multiple myeloma [13, 19, 20]. Remodelin can also reverse adriamycin resistance in breast cancer [21, 22]; thus, it may be a promising anticancer agent. However, remodelin’s role in cervical cancer is poorly understood.
Solute carrier family 7 member 5 (SLC7A5) amino acid transporter is key for maintaining intracellular amino acid pool [23], which facilitates the uptake of nutrients by cancer cells. Recent evidence has implicated that SLC7A5 is overexpressed in several malignancies, such as colon and breast cancers, and its overexpression predicts poor prognosis [24, 25, 26, 27]. As an oncogene, SLC7A5 is key for cancer cell progression [26]. SLC7A5 is associated with inflammatory tumor immune microenvironment and can predict response of patients with bladder cancer to immunotherapy, radiotherapy, and chemotherapy. Targeting SLC7A5 along with immunotherapy may be a potentially suitable therapeutic strategy [28]. Loss of SLC7A5 in kirsten rat sarcoma virus (KRAS)-mutant colorectal cancer alters intracellular amino acid homeostasis and reduces protein synthesis and mammalian target of rapamycin complex 1 (mTORC1)-S6K signaling. Although KRAS-mutant cells are resistant to rapamycin, silencing SLC7A5 sensitizes cells to mTORC1 inhibitors [25]. SLC7A5 potentiates proliferative ability by activating the AKT/mTORC1 signaling in breast cancer [29]. Modulating glutamine metabolic reprogramming of SLC7A5 potentiates anti-programmed cell death protein 1 efficacy in triple-negative breast cancer [30]. However, SLC7A5’s role in cervical cancer is still unknown. Moreover, relationship between NAT10 and SLC7A5 in cancer has not been assessed.
To decipher underlying mechanisms of NAT10 in cervical cancer, we conducted a series of studies. Our research investigated the carcinogenic effects of NAT10 on cervical cancer by editing its expression. We demonstrated that NAT10 is overexpressed in cervical cancer and NAT10 overexpression is associated with poor prognosis in patients with cervical cancer. NAT10 overexpression markedly stimulated the proliferative and metastatic potentials of cervical cancer cells. Additionally, as a NAT10 inhibitor, remodelin attenuated proliferative and metastatic potentials of these cells, indicating its potential as an effective drug for treating cervical cancer. Mechanistic studies have suggested that NAT10 can positively regulate the ac4C acetylation level of SLC7A5 mRNA, thereby enhancing SLC7A5 mRNA stability and promoting the metastasis of cervical cancer. Therefore, NAT10 plays a key role in cervical cancer progression via the ac4C-SLC7A5 axis and thus may serve as a biomarker of cervical cancer.
We retrieved public gene expression data and full clinical annotations of Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma (CESC) from The Cancer Genome Atlas (TCGA) (https://portal.gdc.cancer.gov/). This study enrolled 297 patients with cervical cancer, including 245 with squamous cell carcinoma of the cervix, 48 with adenocarcinoma of the cervix, and 4 patients with other pathological types. The baseline data is shown in Supplementary Table 1. The transcripts per million (TPM) format was log2 transformed and processed for analysis using R version 4.2.2 (Lucent Technologies, Murray Hill, NJ, USA). Using the function “surv_categorize” of R package “survminer” (v0.4.9), the expression levels of NAT10 and SLC7A5 mRNA were divided into “high” or “low” groups. Survival analysis was carried out for patients with CESC using the expression data of tumors with “survminer” and the R package “survival” (v3.4.0), with ordinate representing survival rate and abscissa representing survival time. The p values were adjusted for multiple testing using the Benjamini–Hochberg method.
A cervical cancer tissue microarray (HUteS136Su01, Shanghai Outdo Biotech Co, China) was dewaxed in xylene for 20 minutes; then hydrated in different gradients of ethanol for 5 minutes each. Following this, it was subjected to high-pressure fixation with sodium citrate for 5 min followed by blocking with 5% bovine serum albumin (BSA, CCS30014.01, MRC, Cincinnati, OH, USA) for 1 hour. Slides were dried, and NAT10 monoclonal antibody (1:100, SC-271770, Santa Cruz, Dalas, TX, USA) was incubated at 4 °C overnight. Slides were incubated with the mouse secondary antibody (1:5000, SA00001-1, Proteintech, Chicago, IL, USA) at room temperature for 0.5 h. After incubation, DAB (DA1010, Beijing Solaibao Technology Co., LTD, Beijing, China) was added for 3–5 minutes to lightly counterstain with hematoxylin. Staining intensity was measured using H-score method as described previously [13]. In short, scoring was based on percentage and frequency of positive staining cells as follows: 0 indicates no positive staining cells; 1–100 indicates 1–100% of cells stained. Staining intensity was scored as follows: 0 represents no staining, 1 represents weak positive staining, 2 represents medium positive staining, and 3 representes strong positive staining.
SiHa and CaSki human cervical cancer cells were purchased from Procell Company (Wuhan, China). C33A and HeLa human cervical cancer cells were kindly donated by Professor Zhang Bingzhong. The cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Procell) and 5% CO2. All cell lines were validated by short tandem repeat (STR) analysis, and mycoplasma testing was negative.
The Cell Counting Kit-8 (CCK-8) assay (Dojindo, Kumamoto, Japan) was performed
to assess proliferative potential. Cells (3
Lentiviral vectors containing short hairpin RNA (shRNA) and the NAT10 coding sequence were purchased from Genechem (Shanghai, China). ShRNA sequence for NAT10 was: AGGGCCCTCCTTTCCTATAAG. HeLa and SiHa cells were infected with lentivirus. Small interfering RNA (siRNA; KeScience, Shanghai, China) was utilized to knock out NAT10 in cells using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA). The siRNA sequence was: GCUGUGGUGUUAUAAGAAATT.
Cell monolayer was scratched using a pipette tip, and wound width at 0, 24 h was captured using the DMC4500 digital microscope (Leica, Wetzlar, Germany). Migration distance was evaluated by ImageJ software (version 1.53t, National Institutes of Health [NIH], Bethesda, Rockville, MD, USA).
Transwell assays were performed with 8 µm chambers (Falcon; Corning Inc.,
Corning, NY, USA). 5
Total cell proteins were extracted, resolved by sodium dodecyl polyacrylamide gel electrophoresis (EpiZyme, Cambridge, MA, USA), and transferred electrophoretically to polyvinylidene fluoride (PVDF) membranes (MilliporeSigma, Burlington, USA). Then PVDF membranes were blocked in rapid sealing fluid (NCM Biotech, Suzhou, China), cut by predicted molecular weight, and incubated overnight at 4 °C with NAT10 monoclonal antibody or polyclonal antibodies against SCL7A5 (1:1000, 28670-1-AP; Proteintech, Chicago, IL, USA), vimentin (1:1000, 10366-1-AP; Proteintech), N-cadherin (1:1000, YT2988; Immunoway, Plano, TX, USA), GAPDH (1:20,000; AP0063; Bioworld, Minneapolis, MN, USA), and tubulin (1:30,000, AP0064; Bioworld, Irving, TX, USA). After washing, membranes were incubated at room temperature for 120 min with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (1:5000, AP0063; Bioworld) or HRP-conjugated anti-mouse secondary antibody (1:5000, SA00001-1; Proteintech). The Tanon 5200 Chemiluminescent Imaging System (ChampChemi 610; Sage Creation, Beijing, China) was used for immunoblot analysis. The original images of the western blot are presented as Supplementary Materials.
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) and reverse transcribed to cDNA using PrimeScript RT Master Mix (Yeasen Biotech, Shanghai, China). Quantitative PCR (qPCR) was performed using cDNA as the template and SYBR Premix Ex Taq (Yeasen Biotech). Data were normalized to GAPDH expression. The primers for qPCR (Generay Biotech Co., Shanghai, China) were as follows: GAPDH (forward): GGAGCGAGATCCCTCCAAAAT, GAPDH (reverse): GGCTGTTGTCATACTTCTCATGG; NAT10 (forward): ATAGCAGCCACAAACATTCGC, NAT10 (reverse): ACACACATGCCGAAGGTATTG; SCL7A5 (forward): CCGTGAACTGCTACAGCGT, SCL7A5 (reverse): CTTCCCGATCTGGACGAAGC.
We employed the phenol-chloroform method to isolate and purify the total RNA from the Siha ShNAT10 vector and its OE-NAT10 cell line. RNA-seq of the Siha ShNAT10 vector and its OE-NAT10 cell line was conducted by Guangzhou Epibiotek Co., Ltd., China. Prepare Epi™ mRNA Capture Beads (Epibiotek, cat. no. R2020-96) by balancing them at room temperature for 0.5 h. One µg RNA and Beads Binding Buffer were added to the beads, then heated at 65 °C for 5 minutes and 25 °C for another 5 minutes. After magnetically clarified with the beads, the supernatant was discarded. Tris Buffer was added and heated at 80 °C for 2 minutes. We re-added Beads Binding Buffer and repeated the heating process at 65 °C and 25 °C. After the reaction was over, the mixture was magnetically clarified, and supernatant was discarded. Beads were washed with Beads Wash Buffer, and finally, Elution Buffer was added, incubated at 95 °C for 5 minutes. Supernatant was collected, which contains the mRNA elution solution. The Epi™ mRNA Library Fast kit (Epibiotek, #R1810, Guangzhou, Chia) was used to prepare the library. The library quality with the Bioptic Qsep100 Analyzer was checked to ensure the size distribution matches theoretical expectations. Library preparation was done using the VAHTS Stranded mRNA-seq Library Prep Kit for Illumina V2 (Vazyme Biotech, Nanjing, China, NR612-02). Reads were aligned to the GRCh38 human genome using Hisat2 aligner with the “rna-strandness RF” parameter. Feature counts were utilized to calculate reads mapped to genome, and DEGSeq R-package (version 1.44.0) was applied for differential gene expression analysis.
Total RNA (5 µg) was heated at 75 °C for 5 min and then cooled to 0 °C for 1 min. Then the membranes were loaded with Amersham Hybond-N+ (0.22 µm, 66485; Pall Co., Port Washington, NY, USA) and crosslinked twice with ultraviolet light. After blocking membranes in 5% skim milk (BD Biosciences, Franklin Lakes, NJ, USA), they were incubated overnight at 4 °C with anti-ac4C antibody (1:1000, ab252215; Abcam, Cambridge, UK). Membranes were washed with Tris-buffered saline with Tween 20 (NCM Biotech) and incubated at room temperature with anti-rabbit secondary antibody (1:5000, AP0063; Bioworld). Proteins were detected by incubating the membranes with a chemiluminescent HRP substrate (NCM Biotech), followed by staining with methylene blue buffer (Solarbio) for 30 min.
We used the prediction of N4-acetylcytidine (ac4C) modification sites in mRNA (PACES) tool to analyze potential acetylation sites of SLC7A5 mRNA coding sequence (http://rnanut.net/paces).
For the ac4C RNA immunoprecipitation assay, cells were lysed using NP40 (Beyotime, Jiangsu, China) at 4 °C overnight. Twenty µL of solution was stored at –80 °C. Next, 200 µL lysate was mixed with anti-ac4C antibody (1:50, ab252215; Abcam), and another 200 µL lysate was mixed with normal rabbit IgG (1:50, 30000-0-AP; Proteintech) at 4 °C for 4 h. Protein A/G beads (MedChemExpress, Monmouth Junction, NJ, USA) were incubated with lysate at 4 °C overnight. Next morning, the beads were washed with buffer. Finally, the RNA was extracted and tested by qPCR.
Actinomycin D (a transcription inhibitor) was used to evaluate RNA stability. Actinomycin D at a concentration of 200 nM was added to culture medium and co-cultured with cells as the experimental group, whereas cells cultured in complete medium served as control group. At 0, 6, and 12 h after actinomycin D treatment, cells were collected for extracting RNA. Total RNA was used for qPCR, and the level of SLC7A5 was detected at each time point.
BALB/c nude mice have a mutation in the FOXn1 gene, which leads to the
absence or degeneration of the thymus and the lack of mature T cells, making them
able to accept foreign transplanted cells without producing an immune rejection
response. This characteristic makes BALB/c nude mice an ideal model for studying
tumor growth and metastasis. BALB/c nude mouse tumor models can retain the
morphological and genetic characteristics of the primary tumor, which is of great
significance for studying the biological characteristics of tumors and tumor
therapy. Therefore, we selected BALB/c nude mice as a xenograft model to explore
the anti-tumor effects of Remodelin in vivo. All animal experiments
followed rules of the Ethics Committee on Animal Experiments of Zhujiang Hospital
(Guangzhou, China). Female mice (BALB/c, 5–6 weeks old, 16–19 g; Gongsimingzi,
Zhaoqing, China) were housed under pathogen-free conditions. Animal experiments
were performed as previously reported [31]. Briefly, 12 mice were subcutaneously
injected in the right axillary fossa with SiHa cells (2
Fertilized eggs (Eggsiao, Suzhou, China) were developed for 10 days. Then they were laid on their side and the shell were punctured on the air bag side (the top side). After sucking the air from the airbag, the chicken chorioallantoic membranes (CAMs) were dropped. Next, 100 µL cell suspension containing 1,000,000 cells was inoculated per CAM. Tumors were collected after incubation at 37 °C in an incubator for 6 days.
Data were analyzed using GraphPad Prism 9 software (GraphPad Software Inc., San
Diego, CA, USA). Data are presented as the mean
We found that NAT10 mRNA high expression was closely correlated with shorter disease-free survival (DFS) and overall survival (OS) of patients with CESC in TCGA (Fig. 1A,B). Clinical characteristics of patients were shown Supplementary Table 1. Furthermore, association between NAT10 mRNA expression and OS of patients with cervical adenocarcinoma was assessed, and high expression of NAT10 mRNA was correlated with shorter OS of patients with cervical adenocarcinoma (Supplementary Fig. 1). To further explore NAT10 expression and its association with patient prognosis, a commercial cervical cancer tissue chip was used to detect NAT10 protein levels by immunohistochemistry (IHC). The chip included 110 cervical cancer tissues and 25 adjacent non-cervical cancer tissues. Results showed NAT10 protein expression in nuclei and cytoplasm of cervical cancer cells (Fig. 1C), which was significantly higher in cervical cancer tissues than in normal ones (Fig. 1C,D). Kaplan–Meier curves revealed that patients with high NAT10 expression had lower OS and DFS (Fig. 1E,F), suggesting that NAT10 might predict poor prognosis. Interestingly, we found that NAT10 was overexpressed in older patients compared with young patients (Table 1), consistent with evidence showing involvement NAT10’s involvement in age-related disorders [32]. However, we found that NAT10 was not correlated with lymph node metastasis, pathological stage, or pathological grade (Table 1).
Fig. 1.
NAT10 is overexpressed in cervical cancer. (A) Effect
of NAT10 expression level on DFS of patients with cervical cancer based on TCGA
dataset. (B) Effect of NAT10 expression level on OS of patients with cervical
cancer based on TCGA dataset. (C) Representative IHC images of cervical
microarrays showing NAT10 expression in cervical tumors and corresponding normal
tissues. Scale bar for the images is 20
| Clinical parameter | Total (cases%) | NAT10 expression level | χ2 | p | ||
| High expression | Low expression | |||||
| Total | 110 | 62 | 48 | |||
| Age (years) | 76 | 38 (50%) | 38 (50%) | 4.048 | 0.042 | |
| 34 | 24 (70.59%) | 10 (29.41%) | ||||
| Histological type | Squamous cell cancer | 100 | 56 (56%) | 44 (44%) | 0.137 | 0.934 |
| Adenocarcinoma | 3 | 2 (66.67%) | 1 (33.33%) | |||
| Others | 7 | 4 (57.14%) | 3 (42.86%) | |||
| Pathological stage | I–II | 91 | 52 (57.14%) | 39 (42.86%) | 0.13 | 0.72 |
| III–IV | 19 | 10 (52.63%) | 9 (47.37%) | |||
| Pathological grading | I/II/I–II | 14 | 10 (71.43%) | 4 (28.57%) | 0.38 | 0.76 |
| II–III/III | 78 | 49 (62.82%) | 29 (37.18%) | |||
| Lymph node metastatic | Negative | 92 | 52 (56.52%) | 40 (43.48%) | 0.0057 | 0.94 |
| Positive | 18 | 10 (55.56%) | 8 (44.44%) | |||
| Recurrent condition | Yes | 36 | 22 (61.11%) | 14 (38.89%) | 0.49 | 0.48 |
| No | 74 | 40 (54.05%) | 34 (45.95%) | |||
NAT10, N-acetyltransferase 10.
To evaluate NAT10’s role in cervical cancer, four cervical cancer cell lines (SiHa, CaSki, C33A, and HeLa) were used to detect NAT10 expression. NAT10 was detected in all of these cell lines and was overexpressed in Caski and SiHa cells (Fig. 2A). ShNAT10 and SiNAT10 were used to repress NAT10 expression in CaSki and SiHa cells, respectively. NAT10 expression was significantly reduced after NAT10 knockdown (Fig. 2B,C). The proliferative ability of SiHa and CaSki cells was decreased after silencing NAT10 (Fig. 2D). Wound healing assays showed that NAT10 downregulation slowed wound healing in these cells (Fig. 2E). Silencing of NAT10 also decreased the migratory and invasive abilities of SiHa and CaSki cells (Fig. 2F,G). Subsequently, we found that NAT10 knockdown attenuated cervical cancer cell proliferation in vivo in CAMs (Fig. 2H,I).
Fig. 2.
Knockout of NAT10 expression impaired proliferative and
metastatic potentials of cervical cancer cells. (A) Expression of NAT10 in four
cervical cancer cell lines. (B) Knockdown efficiency of NAT10 determined by
Western blotting. (C) Validation of NAT10 mRNA knockdown by qPCR (n = 3). (D)
NAT10 silence impaired proliferative potential of SiHa (n = 4) and CaSki cells (n
= 3). (E) NAT10 silence inhibited wound healing of SiHa (n = 3) and CaSki cells
(n = 3). Scale bar = 200 µm. (F) Cell migratory capacity was reduced after
NAT10 knockdown) (n = 3). Scale bar = 200 µm. (G) Knockdown of NAT10
expression reduced the invasion capability of SiHa (n = 3) and CaSki cells (n
=3). Scale bar = 200 µm. (H) Representative images of tumors in CAMs after
knockdown of NAT10 expression in SiHa cells. (I) Knockout of NAT10 expression in
SiHa cells inhibited the proliferation of tumors in CAMs (n = 3–5). NAT10,
N-acetyltransferase 10; ShNC, negative control short hairpin RNA; ShNAT10, short
hairpin RNA targeting NAT10; SiNC, negative control small interfering RNA;
SiNAT10, small interfering RNA targeting NAT10; OD, optical density; CAMs,
chicken chorioallantoic membranes; qPCR, quantitative PCR. Note: *p
We explored the role of NAT10 by overexpressing NAT10 in a SiHa NAT10-knockdown cell line (ShNAT10 cell line) using the lentivirus method. NAT10 expression in the SiHaShNAT10 overexpression (OE) cell line was significantly increased after transfection with OE lentivirus (Fig. 3A,B). Cell proliferative ability was significantly enhanced after NAT10 overexpression (Fig. 3C). Moreover, overexpression of NAT10 promoted wound healing in SiHa cells (Fig. 3D). NAT10 overexpression promoted SiHa cell metastasis and invasion in transwell assays (Fig. 3E,F). We also overexpressed NAT10 in HeLa cervical cancer cells. Similarly, NAT10 expression in the HeLa-NAT10 OE cell line was increased after transfection with OE lentivirus (Fig. 3A,B). Together, NAT10 overexpression promoted proliferation, wound healing, invasion, and metastasis abilities of HeLa cells (Fig. 3C–F), indicating that NAT10 is an oncogene in cervical cancer.
Fig. 3.
Upregulation of NAT10 expression in SiHa and HeLa cells promoted
proliferative and metastatic potentials of cervical cancer cells. (A) NAT10
protein overexpression as confirmed by Western blotting. (B) Determination of
NAT10 mRNA overexpression by qPCR (n = 3). (C) Promotion of cell proliferation
after overexpressing NAT10 in SiHa (n = 5) and HeLa cells (n = 3). (D) Effect of
NAT10 overexpression on migration of SiHa (n = 3, scale bar = 200 µm) and HeLa
cells (n = 3, scale bar = 200 µm) was evaluated using a wound healing assay. (E)
Migration capability of SiHa and HeLa cells overexpressing NAT10 as evaluated by
transwell assays (n = 3, scale bar = 200 µm). (F) Invasion capability of SiHa and
HeLa cells overexpressing NAT10 as evaluated by transwell assays (n = 3, scale
bar = 200 µm). NAT10, N-acetyltransferase 10; OE-NAT10, NAT10 overexpression; OD,
optical density. Note: *p
NAT10 acts as an acetyltransferase that can catalyze ac4C modification on mRNA, thereby improving mRNA stability and translation efficiency [13, 17, 33]. We performed an acetylation dot blot assay to investigate whether NAT10 exerts its biological effects by acetylating mRNA in cervical cancer cells. Inhibiting NAT10 in SiHa cells significantly reduced the mRNA ac4C acetylation level (Fig. 4F), consistent with previous reports [13, 17]. Increased ac4C acetylation level was detected when NAT10 was overexpressed in SiHa cells (Fig. 4F).
Fig. 4.
Exploration of the impact of NAT10 on downstream
factors. (A) Transcriptomic comparison was carried out to analyze the
dysregulated genes between the vector control and OE-NAT10 (NAT10 overexpressing)
SiHa cells. (B) Representative pathway analysis terms according to Gene Ontology
analysis. (C) Representative pathway analysis terms according to Kyoto
Encyclopedia of Genes and Genome analysis. (D) Scatter plot of TPM values of
NAT10 and SLC7A5 mRNA in TCGA-CESC data. Spearman’s correlation
analysis showed the association between NAT10 mRNA and SLC7A5
mRNA expression levels (log2 [TPM + 1]) (R = 0.26, p = 4.3
To decipher mechanisms by which NAT10 affects cervical cancer cell progression, RNA-seq was performed on NAT10-overexpressing SiHa and control cells. The sequencing results showed that 1146 genes were upregulated and 1097 genes were downregulated after NAT10 overexpression in SiHa cells (Fig. 4A). The top 10 significantly enriched gene ontology terms are summarized in Fig. 4B. The results showed that NAT10 was related to several biological processes such as “the C21-steroid hormone metabolic process”, “progesterone metabolic process”, “homophilic cell adhesion via plasma membrane adhesion molecules”, and “carboxylic acid transport”. Kyoto encyclopedia of genes and genomes pathway enrichment analysis indicated that the differentially expressed genes were significantly enriched in “ATP-binding cassette transporters”, “neuroactive ligand-receptor interactions”, and “protein digestion and absorption” (Fig. 4C).
SLC7A5 upregulation is correlated with increased activity in the carboxylic acid transport and organic anion transport pathways [23]. Based on data from TCGA website, NAT10 mRNA expression was positively correlated with SLC7A5 mRNA expression (Fig. 4D). NAT10 can reportedly function by acetylating target mRNA [34]. Therefore, we consulted an acetylation site prediction website, which showed that there are acetylation sites at nucleotides 120 and 134 of SLC7A5 mRNA, with a specificity of 99% (Fig. 4E). Consequently, we speculate that SLC7A5 mRNA is a potential downstream target of NAT10.
By analyzing the public database, SLC7A5 mRNA was highly expressed in cervical cancer tissues (Fig. 5A). Overexpression of SLC7A5 was associated with a low OS rate in cervical cancer (Fig. 5B), both in squamous cell carcinoma (Fig. 5C) and adenocarcinoma (Fig. 5D). Moreover, patients with high NAT10 and SLC7A5 mRNA expression had worse OS than those with low levels according to bioinformatics analysis (Fig. 5E), both in squamous cell carcinoma (Fig. 5F) and adenocarcinoma (Fig. 5G). We also found that samples with overexpressed NAT10 and SLC7A5 had a higher degree of M2 macrophage infiltration and lower degree of M1 macrophages (Fig. 5H). Knockdown of SLC7A5 (Fig. 5I,J) in SiHa cells significantly reduced wound healing (Fig. 5K), migration, and invasion abilities (Fig. 5L).
Fig. 5.
SLC7A5 is a carcinogenic factor in cervical cancer. (A)
SLC7A5 mRNA was overexpressed in cervical cancer compared with normal cervical
tissue. (B) Overexpression of SLC7A5 mRNA corelated with poor OS in
cervical cancer. (C) Overexpression of SLC7A5 mRNA corelated with poor
OS in squamous cell carcinoma of the cervix. (D) Overexpression of
SLC7A5 mRNA corelated with poor OS in cervical adenocarcinoma. (E)
Patients with high NAT10 and SLC7A5 mRNA expression had worse
OS than those with low levels according to bioinformatics analysis. (F) Patients
with high NAT10 and SLC7A5 mRNA expression in cervical squamous
cell carcinoma had worse OS than those with low levels according to
bioinformatics analysis. (G) Patients with high NAT10 and SLC7A5
mRNA expression in cervical adenocarcinoma had worse OS than those with low
levels according to bioinformatics analysis. (H) Differences in abundance of 10
immune cell types enriched in the TCGA-CESC dataset based on quanTIseq algorithm;
blue indicates the “low NAT10 & low SLC7A5” group, red
indicates the “high NAT10 & high SLC7A5” group; the
horizontal axis indicates the 10 immune cell types, and the vertical axis the
abundance of immune cell infiltration. (I) Validation of SLC7A5 mRNA
knockdown level by qPCR in SiHa cells (n = 3). (J) Knockdown efficiency of SLC7A5
determined by Western blotting in SiHa cells. (K) Knockdown of SLC7A5 expression
inhibited the wound healing of SiHa cells (n = 3, scale bar = 200 µm). (L) Cell
migratory and invasive capacities of SiHa cells were reduced after SLC7A5
knockdown (n = 3, scale bar = 200 µm). OS, overall survival; NAT10,
N-acetyltransferase 10; SLC7A5, solute carrier family 7 member 5; TCGA-CESC, the
cancer genome atlas cervical squamous cell carcinoma and endocervical
adenocarcinoma; qPCR, quantitative PCR; ns, not significant. Note: *p
Next, qPCR was performed for verification purposes. SLC7A5 was significantly decreased after knockdown of NAT10 but was significantly increased after overexpression of NAT10 (Fig. 6A). Western blot analysis showed similar results (Fig. 6B). The acetylated RNA immunoprecipitation-qPCR results further showed that NAT10 downregulation in cervical cancer cell lines significantly decreased acetylation level of SLC7A5 mRNA (Fig. 6C). The results of the mRNA stability assay showed that knocking down NAT10 expression reduced SLC7A5 mRNA stability (Fig. 6D).
Fig. 6.
NAT10 affected the biological behavior of cervical
cancer cells by ac4C acetylation of SLC7A5 mRNA. (A) Validation of the
mRNA level of SLC7A5 by qPCR after regulating NAT10 expression (n = 3).
(B) Detection of SLC7A5 protein levels by western blotting after regulating NAT10
expression in cervical cancer cells. (C) Detection of SLC7A5 mRNA level
by acetylated RNA immunoprecipitation-qPCR after knocking down NAT10 in SiHa
cells (n = 3). (D) Reducing NAT10 expression in SiHa decreased the stability of
SLC7A5 mRNA (n = 3). (E) Determination of the knockout efficiency of
SLC7A5 mRNA by qPCR in SiHa OE NAT10 cell lines (n = 3). (F)
Determination of the knockout efficiency of SLC7A5 by western blotting in SiHa OE
NAT10 cell lines. (G) The cell migration capability, which increased by NAT10
overexpression, decreased to a certain extent after SLC7A5 knockdown, as
determined by wound healing assays (n = 3, scale bar = 200 µm). (H) The cell
migration/invasion capability, which increased after NAT10 overexpression,
decreased to a certain extent after knocking down SLC7A5 by transwell assays (n =
3, scale bar = 200 µm). SLC7A5, Solute carrier family 7 member 5; ac4C,
N4-acetylcytidine; NAT10, N-acetyltransferase 10; OE, overexpression; ShNC,
Negative control short hairpin RNA; ShNAT10, short hairpin RNA targeting NAT10;
SiSLC, small interfering RNA targeting SLC7A5; qPCR, quantitative PCR. Note:
*p
We speculated that NAT10 exerts its biological function by acetylating SLC7A5 mRNA. To further explore SLC7A5’s role, we silenced SLC7A5 in cervical cancer NAT10overexpressing stable cell lines (Fig. 6E,F). The results showed that after downregulating SLC7A5, the wound healing ability, which increased by NAT10 overexpression, decreased to a certain extent (Fig. 6G). Migration capacity of cervical cancer cells was also reduced to some extent following SLC7A5 downregulation (Fig. 6H).
Remodelin is a NAT10 inhibitor [35, 36]. Thus, we used remodelin to determine if NAT10 could be used as a therapeutic target for cervical cancer. CCK-8 assays revealed that remodelin significantly attenuated SiHa, CaSki, and C33A cell proliferation (Fig. 7A). Remodelin significantly weakened the wound healing ability of Siha, CaSki, and C33A cells compared to controls (Fig. 7B–D). Remodelin decreased migratory (Fig. 7E–G) and invasive abilities of SiHa, CaSki, and C33A cells (Fig. 7H–J). These results further confirmed that NAT10 is a potential target for cervical cancer, and that remodelin is a promising therapeutic drug that might attenuate cervical cancer progression.
Fig. 7.
Remodelin, inhibitor of NAT10, impaired proliferative
and mestatic potentials of cervical cancer cells. (A) Remodelin impaired
proliferation of cervical cancer cells (SiHa, CaSki, and C33A) as shown by CCK-8
assays (n = 3). (B) Remodelin impaired the migration capability of SiHa cells by
wound healing assays (n = 3, scale bar = 200 µm). (C) Remodelin impaired the
migration capability of CaSki cells as shown by wound healing assays (n = 3,
scale bar = 200 µm). (D) Remodelin impaired the migration capability of C33A
cells as shown by wound healing assays (n = 3, scale bar = 200 µm). (E) Remodelin
impaired the migration capability of SiHa cells as shown by transwell assays (n =
3, scale bar = 200 µm). (F) Remodelin impaired the migration capability of CaSki
cells as shown by transwell assays (n = 3, scale bar = 200 µm). (G) Remodelin
impaired the migration capability of C33A cells as shown by transwell assays (n =
3, scale bar = 200 µm). (H) Remodelin impaired the invasion capability of SiHa
cells as shown by transwell assays (n = 3, scale bar = 200 µm). (I) Remodelin
impaired the invasion capability of CaSki cells as shown by transwell assays (n =
3, scale bar = 200 µm). (J) Remodelin impaired the invasion capability of C33A
cells as shown by transwell assays (n = 3, scale bar = 200 µm). CCK-8, cell
counting kit-8; NAT10, N-acetyltransferase 10. Note: *p
We found that remodelin attenuated growth and reduced the weight of cervical tumors (Fig. 8A–C). IHC showed that Ki67 expression (marker of tumor proliferation) was reduced after remodelin treatment (Fig. 8F). Western blotting showed that remodelin significantly decreased N-cadherin and vimentin levels (Fig. 8E), indicating that remodelin inhibits the epithelial–mesenchymal transition in cervical cancer tumors in vivo. More importantly, treatment with remodelin had little effect on organ damage in mice (Fig. 8G), indicating its safety. SLC7A5 expression was reduced after remodelin treatment in vivo by qPCR and IHC (Fig. 8D,F).
Fig. 8.
Remodelin prevented cervical cancer growth in
vivo. (A) Tumor images of a xenograft nude mouse model subcutaneously injected
with SiHa cells and treated with remodelin or NC. (B) Weight of tumors in the
remodelin and NC groups at the experiment endpoint. (C) Growth rate of the tumors
with or without remodelin treatment. (D) Validation of SLC7A5 mRNA levels in
samples with or without remodelin treatment. (E) Expression of vimentin and
N-cadherin after treatment with remodelin or NC as assessed by Western blotting.
(F) Representative images for H&E and IHC staining of the Ki-67 (marker of
proliferation) and SLC7A5 in nude mouse sections. Scale bar = 20
NAT10 is a member of epigenetic modifications and exerts essential functions in cancer development. Here, we confirmed that NAT10 is overexpressed in cervical cancer, which predicted poor DFS and OS. Functionally, we showed that NAT10 plays an oncogenic role by promoting their proliferation and migration. By this mechanism, NAT10 induces the ac4C acetylation of mRNA in cervical cancer cells. We further showed that NAT10 N4-acetylates SLC7A5 mRNA and enhances its mRNA stability in cervical cancer, thus positively regulating the expression of SLC7A5. Remodelin may serve as a promising targeted agent by inhibiting cervical cancer progression both in vitro and in vivo.
Through mRNA-seq analysis, SLC7A5 mRNA was upregulated in cervical cancer cells after overexpression of NAT10. We further found that SLC7A5 and NAT10 mRNA levels were closely related in cervical cancer, indicating that NAT10 and SLC7A5 might have a mutual regulatory relationship. An acetylation site on SLC7A5 mRNA was predicted to have a probability of 0.76. Based on this, we hypothesize that SLC7A5 mRNA may be a downstream target of NAT10. Through analysis of public databases, we found that SLC7A5 mRNA is overexpressed in cervical cancer tissues and is a predictor of poor OS in cervical cancer. Patients with high NAT10 and SLC7A5 mRNA expression had the lowest OS. By downregulating SLC7A5 in SiHa cervical cancer cells, it can inhibit migratory and invasive abilities.
We investigated the relevant mechanisms of NAT10 and SLC7A5 in cervical cancer. The results of qPCR and Western blotting confirmed that NAT10 positively regulated SLC7A5 expression. Further, ac4C RNA immunoprecipitation-qPCR analysis revealed that NAT10 silence reduced SLC7A5 mRNA acetylation, indicating that SLC7A5 mRNA is an ac4C target of NAT10.Through RNA stability experiments, silencing NAT10 in cervical cancer cells reduced SLC7A5 mRNA stability. Together, these results showed that NAT10 can induce ac4C modification of SLC7A5 mRNA, thereby enhancing its mRNA stability and positively regulating the expression of SLC7A5. Furthermore, by knocking down the expression of SLC7A5 in cervical cancer NAT10overexpressing stable cell lines, we found that the wound healing, migration, and invasion abilities, which were increased by NAT10 overexpression, decreased to a certain extent. NAT10 can induce ac4C modification of SLC7A5 mRNA, enhance its mRNA stability, and promote SLC7A5 expression, thereby promoting the metastasis of cervical cancer. However, contrary to expectations, the proliferative ability of cervical cancer cells enhanced by NAT10 overexpression was not reduced after SCL7A5 knockdown. We speculated that other ac4C targets might exist to promote the proliferative ability of cells. Indeed, Nat10-mediated modification of mRNA acetylation is a complex biological process involving multiple molecular mechanisms and possible cofactors or cellular conditions. NAT10 is the only known enzyme that catalyzes ATP-dependent RNA acetylation to form ac4C [37]. It belongs to G-protein subunit alpha transducing protein superfamily of N-acetyltransferases and catalyzes the acetylation of histone and non-histone proteins [38]. Cofactors required for ac4C formation in mRNA have not been identified. The expression and activity of NAT10 may be regulated by a variety of transcription factors. In addition, NAT10 activity may be affected by cell energy state. For example, deacetylase sirtuin 1 was found to promote the shift of NAT10 from ribosomal RNA biosynthesis to autophagy, suggesting that the function of NAT10 may change under conditions of energy stress [15, 38]. In summary, NAT10-mediated mRNA acetylation modification is a complex process involving multiple molecular levels and cellular conditions, and its specific mechanisms and influencing factors are still being studied and discovered.
According to the literature, NAT10 facilitates the acetylation of ac4C to affect the stability and translation efficiency of mRNA, thus playing a role in cervical cancer. Specifically, NAT10 can stimulate the ac4C modification of forkhead box protein P1 (FOXP1) mRNA to enhance its translation efficiency, leading to the induction of glucose transporter 4 and ketohexokinase, which are related to glycolysis metabolism. The active NAT10/ac4C/FOXP1 axis results in increased glycolysis and sustained lactate secretion in cervical cancer cells, amplifying immunosuppressive characteristics of tumor-infiltrating regulatory T cells (Tregs) in lactate-rich tumor microenvironment (TME) [39]. Another study demonstrated that NAT10’s target in cervical cancer is heterogeneous nuclear ribonucleoprotein U-like 1 (HNRNPUL1). NAT10 regulates HNRNPUL1 expression in cervical cancer cells by catalyzing ac4C formation and increasing HNRNPUL1 mRNA stability [40]. Our study reveals the novel regulatory mechanism of NAT10-SLC7A5 axis in cervical cancer cells. Based on quanTIseq algorithm, there were more B cells, M2 macrophages and Tregs in tumor tissues of “high NAT10 & high SLC7A5”, and less M1 macrophages. M2 macrophages appear to contribute to cancer initiation and malignant progression and immune suppression [41], whereas M1 macrophages can phagocytose tumor cells and plays a role in antitumor [42]. Consistent with previous research, we found that samples with high NAT10 expression and SLC7A5 had higher degree of M2 macrophages infiltration and lower degree of M1 macrophages. B cells in the TME may exert key functions in immunotherapy [43]. B cell-derived metabolites such as gamma-aminobutyric acid [44] and adenosine [45] have been shown to suppress the immune response against cancer. We suspect that elevated B cells in the “high NAT10 & high SLC7A5” group contribute to tumor development by suppressing anti-tumor immunity. Tregs are a double-edged sword as they regulate immune homeostasis and inhibit cancer immune responses [46]; thus, the function of elevated Tregs in the “high NAT10 & high SLC7A5” group needs further exploration. Accordingly, we hypothesize that NAT10 may affect the expression of SLC7A5, and that SLC7A5 may play a pro-cancer role by regulating the TME, which still needs further investigation.
Remodelin, a NAT10 inhibitor, was used to decipher NAT10’s therapeutic potential in cervical cancer. Our results showed that remodelin effectively inhibited progression of cervical cancer cells in vitro and inhibited the growth of cervical cancer cells in vivo. We also found that remodelin functions independently of NAT10 protein levels. Our results showed that remodelin acted as a tumor suppressor even in C33A cells with low NAT10 expression, possibly because remodelin acts by blocking the action of the lysine acetyltransferase activity of NAT10 according to the literature [18]. Nat10-targeted therapy, especially the use of remodelin, has shown potential clinical significance and therapeutic potential in the treatment of cervical cancer. However, more studies are needed to validate these findings and further explore the specific mechanisms and efficacy of remodelin in cervical cancer treatment.
Our study has demonstrated that NAT10 promotes cervical cancer progression through the acetylation of SLC7A5 mRNA, offering valuable insights for ongoing and future clinical trials in the fields of metabolic diseases and cancer treatment. NAT10 is upregulated in cervical cancer tissues and correlates with poor prognosis. Consequently, the expression level of NAT10 may serve as a biomarker to predict the prognosis of cervical cancer patients, aiding clinicians in developing personalized treatment plans. Additionally, this finding indicates that NAT10 could be a potential therapeutic target, and inhibiting its activity or the acetylation it mediates may suppress cervical cancer progression. As a key enzyme in mRNA acetylation, NAT10 opens new avenues for drug development in the context of cervical cancer. Future research could focus on developing small molecule inhibitors (like remodelin) or RNA interference (RNAi) technologies to block the oncogenic role of NAT10 in cervical cancer. The promotion of cervical cancer progression by NAT10 through the acetylation of SLC7A5 mRNA underscores the critical role of amino acid metabolism in tumor development. This suggests that future clinical trials should investigate inhibitors of tumor metabolic pathways, such as the glutamine metabolism inhibitor JPH203, to enhance the efficacy of tumor therapy. Bioinformatics analysis further suggests that the acetylation of SLC7A5 mediated by NAT10 may influence the tumor microenvironment, promoting cervical cancer progression. This provides scientific evidence for future clinical trials to explore strategies to improve the tumor microenvironment and enhance immune responses.
This study had some limitations. The research tools used in the study were mainly mature cervical cancer cell lines. Although they were all identified by STR and mycoplasma detection, cultured cells may undergo dedifferentiation and selection, causing cells to lose some of their biological characteristics of the original cells and affecting the accuracy of the research results. In addition, the in vitro culture environment is not completely the same as in vivo, especially the lack of regulation by the nervous and endocrine systems, which may cause changes in cell metabolism and function. In the study, we adopted strict simulation of in vivo environmental conditions, (e.g., controlling the number of passages of tumor cells) to reduce the degree of dedifferentiation of cervical cancer cells. We confirmed the role of remodelin in vivo through nude mouse experiments. Future experiments should use patient-derived tumor xenograft models to study mechanisms of NAT10 in cervical cancer and establish a more accurate and reliable experimental platform for tumor research and drug development.
In summary, we confirmed that high NAT10 expression is a poor prognostic indicator of cervical cancer and NAT10 expression affects cervical cancer cell progression. Furthermore, NAT10 potentiates proliferative and metastatic potentials of cervical cancer cells via ac4C acetylation of SCL7A5 mRNA. Remodelin is a promising therapeutic agent for inhibiting progression of cervical cancer cells.
Public gene expression data and full clinical annotations of cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) were retrieved from The Cancer Genome Atlas (TCGA) (https://portal.gdc.cancer.gov/). RNA-Seq data of the Siha ShNAT10 vector and its OE-NAT10 cell lines were uploaded to NCBI with ID SUB 13813349. The details of the data used in this study can be obtained from the corresponding author.
YW: Conceptualization, Investigation, Supervision, Project administration and Review & Editing; XS: Conceptualization, Investigation, Supervision, Funding acquisition and Review & Editing; PL: Conceptualization, Methodology, Formal analysis, Investigation, Data Curation and Writing—Original Draft; DZ: Investigation, Resources and Data Curation; JL: Software, Validation and Formal analysis; WL: Software, Writing—Reviewing and Editing. All authors have approved the final version to be published; All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work. All authors contributed to editorial changes in the manuscript.
The animal study was conducted in accordance with the Guide for the Care and Use of the Animal Ethics Committee of Zhujiang Hospital (Guangzhou, China). The registration No. in this study was LAEC-2022-103. The animal research has followed the ARRIVE guidelines. Cervical cancer tissue microarray study was approved by the Ethics Committee of Shanghai Outdo Biotech Co., Ltd., (No. SHYJS-CP-1801014). The study was carried out in accordance with the guidelines of the Declaration of Helsinki. Informed consent was obtained from the patients or their families/legal guardians.
Thanks to all the peer reviewers for their comments and suggestions. We extend our thanks to Zhang Bingzhong for generously donating to us C33A and HeLa cell lines.
This project is supported by Guangzhou Municipal Health Science and Technology General Guidance Project (No. 20251A010068), Science and Technology Foundation of Linzhi City (SYQ2024-09), Guangzhou University-Enterprise Joint Funds (High-Level University) for Basic Research (2023A03J0375), Guangzhou University-Enterprise Joint Funds for Basic and Applied Basic Research (2024A03J0182), Guangzhou Municipal Health Science and Technology General Guidance Project (No. 20241A010068), Guangzhou City science and technology plan project (20220101465).
The authors declare no conflict of interest.
Supplementary material associated with this article can be found, in the online version, at https://doi.org/10.31083/FBL26756.
References
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.









