The immortalized normal liver cell line THLE-3 (cat: GNHu40) and HCC cell lines Hep3B (Cat: TChu106), HepG2 (Cat: SCSP-510), Huh7 (Cat: SCSP-526), SK-Hep1 (Cat: TCHu109) and SNU-182 (Cat: SCSP-5047) were obtained from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Huh1 (Cat: CL-0811) was obtained from Procell (Wuhan, Hubei, China). SNU-475 (Cat: ZQ0706) was obtained from Zhong Qiao Xin Zhou Biotechnology (Shanghai, China). All the cell lines were maintained in DMEM supplemented with 10% fetal bovine (Cat: SH30084.03. FBS; Hyclone, Logan, UT, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Cat: P4333, Sigma-Aldrich, Saint Louis, MO, USA). These cells were authenticated by short tandem repeat (STR) analysis (Qingke Bio, Guangzhou, China). Mycoplasma testing was performed weekly using Mycolor One-Step Mycoplasma Detector (Cat. D201, Vazyme, Nanjing, China).

All the HCC tissues and adjacent normal tissues obtained from the HCC patients who were histopathologically and clinically diagnosed in the First Affiliated Hospital of Gannan Medical University were frozen and stored in liquid nitrogen until further use. Prior patient consent and approval were obtained from the Research Ethics Committee of the First Affiliated Hospital of Gannan Medical University (ethical approval number: LLSC-2022051901). The experiments were conducted in accordance with the Declaration of Helsinki. The patients were selected based on the following criteria: pathological diagnosis of HCC and primary resection without pre-operative anticancer treatment. Eight patients were included in the present research: five were female, and three were male. The mean age of the first diagnosis was 59 years (52–69 years). All patients were completely resected, and we collected the resected tissues. Non-cancerous tissues were defined as $>$2 cm distance from the margin of the resection.

The SSR2 overexpression, SSR2 knockdown, and corresponding control plasmids were designed and synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, Guangdong Province, China). For SSR2 overexpression, the Coding sequence (CDS) of SSR2 was subcloned into the pLVX-CMV-Puro. The shRNA sequences were cloned into PLKO.1-puro vector. The target sequences of SSR2 shNRAs were as follows: shSSR2#1: 5${}^{\prime }$-CCCTCTCAAGGCTGGTTATTT-3${}^{\prime }$; shSSR2#2: 5${}^{\prime }$-CCTCCAGAAGACTTTGGCATT-3${}^{\prime }$. The negative control Scramble sequence was: 5’ ATCTCGCTTGGGCGAGAGTAAG 3’. Stable cell line screening was performed using previously published methods [17]. Briefly, the plasmids were transfected into 293T cells (obtained from Shanghai Cell Bank of the Chinese Academy of Sciences, Shanghai, China) to generate lentiviral particles. A total of 48 hours after transfection, the lentiviral particles were collected and transfected into SNU-182 and Huh1 cells overnight. Then, the medium was replaced with normal cell culture media. The stable cells were constructed using 5 µg/mL puromycin.

Total protein was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Cat. P0013B, Beyotime, Shanghai, China). Nuclear proteins were isolated using a Nuclear and Cytoplasmic Protein Extraction kit (Cat. P0028, Beyotime). Western blotting was carried out according to previously described methods [18]. Briefly, 25 µg protein was separated by 10.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and subsequently transferred onto polyvinylidene Fluorid (PVDF) membranes. Then, the membranes were incubated with primary antibodies and subsequently horseradish peroxidase (HRP)-conjugated secondary antibodies (Cat: ab288151 or ab6728; 1:500; Abcam, Cambridge, UK). The luminescence of Western blotting bands was measured using an Ultra-sensitive ECL Chemiluminescence kit (Cat: P0018FS, Beyotime); GAPDH was used as the loading control. The used primary antibodies are as follows: anti-SSR2: (Cat: AT31G6; 1:400; GeneTex, Irvine, CA, USA); anti-p-YAP (Ser127); (Cat: 13008; 1:1000; Cell signaling Technology, Danvers, MA,USA); anti-YAP (Cat: ab205270; 1:1000; Abcam; Cambridge, UK); anti-GAPDH (Cat: ab8245; 1:2000; Abcam; Cambridge, UK); EF-1$\alpha$ (Cat: sc-21758; 1:1000; Santa Cruz Biotechnology, Dallas, TX, USA). The Western blotting bands were analyzed using the iBright CL750 imaging system (ThermoFisher Scientific; Waltham, MA, USA). The gray assay was performed by Image J version 1.46j (NIH, Bethesda, MD, USA).

The total RNA was isolated by TRIzol (Cat. 15596026, Invitrogen, Carlsbad, CA, USA). Total complementary DNA (cDNA) was synthesized using Transcriptor First Strand cDNA Synthesis kit (Cat. 0379012001, Roche, Basel, Germany) according to the manufacturer’s directions. Quantitative real time polymerase chain reaction (qPCR) was performed on a 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA, USA) using the SYBR Green PCR kit (Cat. 4309155, Invitrogen). The primers used were as follows: SSR2, forward, 5${}^{\prime }$-CACTGCTGAACAGATACGCCGT-3${}^{\prime }$, reverse, 5${}^{\prime }$-GCCAAAGTCTTCTGGAGGGAAG-3${}^{\prime }$; DIAPH1, forward, 5${}^{\prime }$-AGAATTTCCCAGCTGCCACA-3${}^{\prime }$, reverse, 5${}^{\prime }$-AGTACTCGCCCAGCTCCTTA-3${}^{\prime }$; BCL2L11, forward, 5${}^{\prime }$-GCCAGGCCTTCAACCACTAT-3${}^{\prime }$, reverse, 5${}^{\prime }$-TCCAATACGCCGCAACTCTT-3${}^{\prime }$; CCNE1, forward, 5${}^{\prime }$-TGTGTCCTGGATGTTGACTGCC-3${}^{\prime }$, reverse, 5${}^{\prime }$-CTCTATGTCGCACCACTGATACC-3${}^{\prime }$; GAPDH, forward, 5${}^{\prime }$-GTCTCCTCTGACTTCAACAGCG-3${}^{\prime }$, reverse, 5${}^{\prime }$-ACCACCCTGTTGCTGTAGCCAA-3${}^{\prime }$.

Colony formation assays were carried out according to previous protocols [19]. Briefly, 0.5 $\times$ 10³ cells were plated into a 6-well plate and cultured in an incubator at 37 °C for 12 h. Then, vehicle or 15 µg/mL DDP (CAS 15663-27-1, Sigma, Saint Louis, MO, USA) was added. Ten days later, cells were fixed using 4% paraformaldehyde and permeabilized PBS supplementaed with stained with 0.1% crystal violet. The stained colonies were counted under a light microscope (IXplore, Olympus, Tokyo, Japan). The overexpression cell treated with 10µm Peptide17 (Selleck Chemicals, Houston, TX, USA) for 2 hours.

Apoptosis analysis was performed using BD FITC Annexin V Apoptosis Detection Kit I (Cat. 556547, BD, San Jose, CA, USA) and detected by flow cytometer assay according to the previously described method [20]. Briefly, 0.5 $\times$ 10⁵ cells were plated into 10 cm plates and maintained in an incubator at 37 °C for 12 h. Vehicle or 15 µg/mL DDP were added into the well, then 48 h later, the cells were collected and washed twice using PBS and re-suspended in binding buffer. Next, the cells were incubated with FITC Annexin V and propidium iodide at room temperature and protected from light for 15 min. The apoptosis rate was determined by an EPICS XL flow cytometer (Beckman-Coulter, Brea, CA, USA).

Mouse xenograft tissues were minced and digested with collagenase (Sigma, Saint Louis, MO, USA) and DNase (Cat. 18047019, Thermo, Waltham, MA, USA) at 37 °C for 30 min and then filtered with 40-micron cell strainers (BD, San Jose, CA, USA). Then, the 0.5 $\times$ 10³ cells were fixed by 4% paraformaldehyde and permeabilized PBS supplementaed with 0.1% sodium citrate (Cat: ST1645, Beyotime) and 0.1% Triton X-100 (Cat: P0096, Beyotime). DNA fragmentation was probed by a TdT-mediated dUTP nick end labeling (TUNEL) kit (Cat. 11684795910, Roche, Basel, Switzerland) following the manufacturer’s instructions. Fluorescent images were captured using an EVOS fluorescent microscope (Advanced Microscopy Group, Seattle, WA, USA).

Anchorage-independent growth assay was performed according to the previous protocol [21]. The complete medium containing 1% agar was added to the cell plate. Subsequently, the mixture containing 0.5 $\times$ 10³ cells, 0.3% agar, and 2 mL complete medium was added to the top of the plate. The plates were maintained in a 37 °C incubator for 10 days. We finally counted the colonies with diameters larger than 0.1 mm.

In this study, 4-week-old male BALB/c nude mice were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and fed in aseptic conditions. The mice were randomly divided into five groups (n=5/group). Huh1 cells knockdown with shSSR2#1 group (Huh1/shSSR#1), Huh1 cells knockdown with shSSR2#2 group (Huh1/shSSR#2), negative control group (Huh1/Scramble) and the SSR2 overexpression cells (SNU-182/SSR2), the SSR2 overexpression treated with Peptide17 (Selleck Chemicals, Houston, TX, USA) group (SNU-182/SSR2/Peptide17) or with Vehicle. Four days later, 1 $\times$ 10⁶ Huh1 cells were suspended in a serum-free DMEM/Matrigel (1:1) mixture. Anesthesia was performed with isoflurane (Piramal Critical Care, PA, USA) through an anesthesia machine (RWD, Shenzhen, China). Each mouse was put into the induction box after filling it with isoflurane (3% induction concentration) for about 1 minute. Then, the induction box was closed, and the mouse was completely anesthetized (this process takes about 2–3 min). The induction box can be gently shaken to check whether the mouse is fully anesthetized. If the mouse is fully anesthetized, its body will be overturned into a side position and not restored from the lying position. Subsequently, the mouse is removed from the induction box. The concentration of isoflurane in the induction box is 1.5%, and the head of the mouse is fixed in the anesthesia mask, allowing the experiments to be performed. Under anesthesia, a 1 cm transverse incision was performed in the upper abdomen of each mouse. The cells was injected into the left hepatic lobe of the mice using a 28-gauge needle. Next, 3 mg/kg DDP (Cat: S1166, Selleck, Houston, TX, USA) was intraperitoneally injected into each mouse every 4 days. After 40 days, all mice were euthanasia via intraperitoneal injection of pentobarbital sodium at a dosage of 150 mg/kg and sacrificed. All experiment procedures were approved by the Institutional Animal Care and Use Committee of the First Affiliated Hospital of Gannan Medical University (ethical approval number: LLSC-2022051901).

Statistical analyses were carried out using SPSS version 19.0 (IBM Corp., Chicago, IL, USA). The data are presented as the mean $\pm$ standard deviation. Gene set enrichment analysis (GSEA) was performed using https://www.gsea-msigdb.org/gsea/index.jsp. Student’s paired t-test was used to analyze the statistical difference between paired tissues, and comparisons among more than two groups were analyzed using analysis of variance (ANOVA) followed by Dunnett’s test. p 0.05 was considered statistically significant.

We first determined SSR2 expression in HCC tissues. Using data from The Cancer Genome Atlas (TCGA) and Gene expression Omnibus (GEO: GSE14520, https://www.ncbi.nlm.nih.gov/gds), we found that SSR2 was significantly increased in HCC tissues compared with normal liver tissues (Fig. 1A). Subsequently, we validated the SSR2 level in an immortalized normal liver cell line THLE-3 and HCC cell lines Hep3B, HepG2, Huh1, Huh7, SK-Hep1, SNU-182, and SNU-475. The results showed SSR2 was dramatically upregulated in HCC cells compared with immortalized normal liver cells in both mRNA and protein levels (Fig. 1B). As expected, SSR2 expression was markedly enhanced in HCC tissues (T) compared with corresponding adjacent normal tissues (ANT; Fig. 1C). Collectively, these results inferred a substantial increase in SSR2 levels in HCC.

Fig. 1.

Signal sequence receptor subunit (SSR2) is upregulated in HCC tissues and cells. (A) SSR2 messanger RNA (mRNA) significantly increases in Liver Hepatocellular Carcinoma (LIHC) compared with normal liver tissues using The Cancer Genome Atlas (TCGA) (left panel) data and Gene expression (GEO) (right panel), *** p 0.001. (B) SSR2 mRNA (upper panel) and protein (lower panel) levels in immortalized normal liver cell line THLE-3 and HCC cell lines Hep3B, HepG2, Huh1, Huh7, SK-Hep1, SNU-182, and SNU-475, and the SSR2 expression compared with normal liver cell line and HCC cell lines. * p 0.05, ** p 0.01. (C) SSR2 level is increased in HCC tissues (T) compared with ANT. normal, normal liver tissue; HCC, hepatocellular carcinoma; T, HCC tissue; ANT, adjacent normal tissue; P1, pair 1 of T and ANT. Each the pair tissue were compared T with ANT. ** p 0.01.

Then, we investigated the correlation between SSR2 level and HCC outcome using the Kaplan–Meier plotter (https://www.kmplot.com). As illustrated in Fig. 2A, patients with higher SSR2 levels had shorter 5-year overall survival, disease-specific survival, relapse-free survival, and progression-free survival. Interestingly, the gene set enrichment analysis (GSEA) assay suggested that high SSR2 was associated with poor survival of HCC patients, while low SSR2 was associated with good survival of HCC patients based on TCGA data (Fig. 2B). Collectively, the analysis indicated that elevated SSR2 was associated with poor survival of HCC patients.

Fig. 2.

SSR2 is negatively correlated with good prognosis of HCC patients. (A) HCC patients with high SSR2 levels have shorter 5-year overall survival, disease-specific survival, relapse-free survival, and progression-free survival using data from the Kaplan–Meier plotter (https://www.kmplot.com). (B) gene set enrichment analysis (GSEA) shows that SSR2 is associated with HCC patients’ survival using the TCGA data. DN, downregulation. UP, upregulation.

To evaluate the SSR2 function in HCC DDP sensitivity, we first established the stable SNU-182 cell lines that overexpressed SSR2 (SNU-182 have a lower SSR2 basal expression level than other cell lines (Fig. 1B)) and inhibited SSR2 using Huh1 cells (which have a higher SSR2 expression than other cell lines (Fig. 1B)). Western blotting assay showed that SSR2 was overexpressed in SSR2-upregulated cells while inhibited in SSR2-downregulated cells (Fig. 3A).

Fig. 3.

Downregulation of SSR2 inhibited HCC cell viability in vitro. (A) Western blotting assay confirms the expression of SRR2 in SRR2-overexpressing and -knockdown HCC cells. (B) Colony formation is induced by SRR2 overexpression or knockdown (n=3). (C) Apoptosis in HCC cells induced by SRR2 noverexpression or knockdown (n=3). Scramble is used as a negative control for SRR2 shRNA. * p 0.05.

Since SSR2 is correlated with liver cancer survival (Fig. 2B), we first checked the effect of SSR2 on HCC cell viability using a colony formation assay. As shown in Fig. 3B, the colony number and volume formed by SSR2-upregulated cells were significantly elevated compared with the control. Moreover, DDP treatment could further increase this difference. Conversely, the downregulation of SSR2 resulted in the opposite result (Fig. 3B). In addition, the flow cytometry assay showed that SSR2 overexpression inhibited HCC apoptosis compared with control, and SSR2 knockdown showed the opposite results, but only administering drugs made a significant difference and in the untreated cells, there are no effect on the apoptosis rate (Fig. 3C).

Anchorage-independent colony formation assay displayed that in the absence of DDP, the colonies formed by SSR2-knockdown cells are fewer and smaller than those formed by the control. The use of DDP magnifies the difference, reaching levels of significance (Fig. 4A). In addition, to explore the role of SSR2 in the progression of HCC in vivo, the orthotopic animal transplant model was established using Huh1 cells. Our results showed that SSR2 knockdown inhibited HCC tumorigenesis, promoted the percentage of TUNEL⁺ cells (Fig. 4B), and prolonged the survival time of mice (Fig. 4C) under DDP treatment.

Fig. 4.

SSR2 downregulation increased the HCC sensitivity to Cisplatin (DDP) in vivo. (A) The HCC colonies in an anchorage-independent colony formation assay (n=3). (B) The orthotopic animal transplant model illustrates that SSR2 downregulation and DDP treatment inhibited tumorigenesis (upper panel) and induced apoptosis (lower panel) of HCC. The red arrow indicates the location of the tumor (n=5). (C) Downregulation of SSR2 prolonged the survival time of mice being treated with DDP. * p 0.05, ** p 0.01. Scale bar = 50 µm.

Collectively, these results showed that SSR2 knockdown inhibited the viability and tumorigenesis of HCC cells undergoing DDP treatment, suggesting that the downregulation of SSR2 can enhance HCC cell sensitivity to DDP.

Furthermore, we investigated the mechanisms of SSR2 in HCC. GSEA of the expression in HCC samples from the TCGA showed that SSR2 might be involved in the Hippo signaling pathway (Fig. 5A). We validated the prediction by detecting the transcription activity of TEAD, the main downstream transcription factor in the Hippo pathway. The luciferase reporter assay showed that the upregulation of SSR2 was significantly increased. At the same time, the downregulation of SSR2 inhibited the transcription of TEAD (Fig. 5B). The Western blotting assay revealed that SSR2 overexpression inhibited the phosphorylation of YAP but promoted its nuclear translocation. In contrast, the downregulation of SSR2 showed inverse (Fig. 5C). Moreover, the upregulation of SSR2 promoted the expression of downstream Hippo signaling genes such as CCNE1, DIAPH1, and BCL2L11. However, the downregulation of SSR2 inhibited their expression (Fig. 5D).

Fig. 5.

SSR2 regulates the Hippo signaling pathway. (A) GSEA for the correlation between SSR2 and Hippo signaling pathway. (B) The luciferase reporter assay for the effect of SSR2 on the transcriptional activity of TEA domain transcription factor (TEAD) (n=3). (C) Western blotting assay for the effect of SSR2 on yes-associated protein (YAP) activity. EF-1α is used as the internal control for nuclear protein (n=3). (D) The effect of SSR2 on the expression of Hippo signaling downstream genes such as CCNE1, DIAPH1, and BCL2L11. EF-1α is used as the internal control for nuclear protein (n=3). * p 0.05.

Then, cells expressing upregulated SSR2 were treated using peptide 17, a Hippo signaling inhibitor that interferes with the binding of TEAD to YAP/TAZ. A colony formation assay suggested that pharmacological inhibition of the Hippo pathway significantly blocked the colony number and size of HCC cells, and the presence of DDP amplified the difference (Fig. 6A). Additionally, peptide 17 also inhibited the tumorigenesis of HCC cells in an in vivo animal model (Fig. 6B), suggesting that activation of Hippo signaling is critical for SSR2 to promote tumorigenesis of HCC cells.

Fig. 6.

Hippo signaling activation is critical for SSR2 to promote tumorigenesis of HCC cells. (A) Colony formation assay shows that the Hippo pathway inhibitor, peptide 17, significantly blocks colony formation of HCC cells with upregulated SSR2 (n=3). (B) The Hippo pathway inhibitor inhibits the tumorigenesis of HCC cells in vivo. The red arrow indicates the location of the tumor (n=5). (C) Correlation analysis of SSR2 and nuclear YAP in fresh HCC tissues. T₁, HCC tumor sample 1. EF-1α is used as the internal control for nuclear protein. * p 0.05, ** p 0.01. Scale bar = 50 µm.

Finally, Western blotting determined the correlation between SRR2 and YAP in fresh 11 HCC tissues. As shown in Fig. 6C, nuclear YAP positively correlates with SSR2 protein levels.

Collectively, our results showed that SSR2 regulates hippocampal signaling, and hippocampal pathway activation is essential for SSR2 to promote cancer progression.