Cervical cancer cell lines (HeLa and SiHa), were obtained from Procell Life Science & Technology Co., Ltd (Wuhan, China). The normal cervical cell HcerEpic was purchased from BIOESN Technology Co., Ltd (Shanghai, China). Dulbecco’s Modified Eagle Medium (DMEM), RPMI 1640 basic medium, Opti-MEM medium (11058021), Fetal bovine serum (FBS), 0.05% Trypsin-Ethylenediaminetetraacetic acid (EDTA) (1X), Penicillin-streptomycin solution (100X) (penicillin content of 10⁴ U/mL, streptomycin content of 10 mg/mL), and phosphate buffered saline (PBS) were obtained from Gibco (Carlsbad, CA, USA). Whole protein extraction assay, Total RNA extraction kit, and Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel preparation kit were acquired from Beyotime Biotechnology Co., Ltd (Shanghai, China). Secondary antibodies labeled by Horseradish Peroxidase (HRP), Cell Counting Kit-8(CCK-8), PBS, Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) protein loading buffer (5X) and Bovine serum albumin (BSA) were obtained from Fude Biological Technology Co., Ltd (Hangzhou, China). Enhanced chemiluminescence (ECL) luminescence solution was obtained from Epizyme Biomedical Technology Co., Ltd (Shanghai, China). Primary antibodies, including: PTBP1, Sequestosome I (p62), Light chain 3-Ⅰ (LC3-Ⅰ), LC3-II, and GAPDH were purchased from Proteintech Group Inc. (Wuhan, China); Bax, Bcl2, Cytochrome C, phospho-Protein kinase B (p-AKT) and AKT were bought from Abcam (Cambridge, UK). Annexin V-FITC/PI Apoptosis Detection Kit was obtained from Keygen Biotechnology Co., Ltd (Nanjing, China). Real-Time-Polymerase Chain Reaction (RT-PCR) reverse transcription kit and fluorescence quantitative amplification kit were purchased from Takara Biomedical Technology Co., Ltd (Beijing, China). 740 Y-P was acquired from MedChemExpress (Shanghai, China). Lipofectamine 3000 was obtained from Thermo Fisher Scientific Inc. (Waltham, MA, USA). Formaldehyde, Paraffin, Ethanol, Chloroform, and Isopropanol were purchased Macklin Biochemical Technology Co., Ltd (Shanghai, China). EDTA-free trypsin, 0.1% Crystal violet, BSA, Diaminobenzidine (DAB), Hematoxylin, Neutral gum, and Diethyl Pyrocarbonate (DEPC) water were bought from Solarbio Science & Technology Co., Ltd (Beijing, China).

This experiment was conducted with the consent of the patient’s family or the patient themselves, and was reviewed and approved by the Ethics Committee of Fujian Cancer Hospital (NO: SQ2022-197). From January 2022 to October 2022, the cancer tissues of 10 patients with cervical cancer who underwent surgical resection were collected at Fujian Cancer Hospital, and confirmed as cervical cancer tissues by pathological examination. Meanwhile, normal cervical tissue (as the control patients) was collected from 10 patients with uterine leiomyoma who underwent surgical resection. The basic information about patients is shown in Table 1 (Detailed information including patient names, initials, and hospital numbers can be obtained from the corresponding author, if necessary). Inclusion criteria for cervical cancer tissue: Patients were diagnosed and treated for the first time with cervical cancer at Fujian Cancer Hospital, and diagnosed as cervical squamous cell carcinoma through histopathological biopsy. According to the pathology, they were classified as high, medium, and low differentiated squamous cell carcinoma. All patients have complete clinical data and their Karnovfsky Performance Status (KPS) is $\ge$70. Exclusion criteria for cervical cancer tissue: severe cardiopulmonary dysfunction, obvious surgical contraindications, combined with malignant tumors or major diseases, and receiving other surgical or drug treatments. After the tissue was isolated, it was processed by professionals, and immediately placed in a 5 mL tube, cooled in liquid nitrogen for 5 minutes, and then stored in a refrigerator (–80 °C).

The Gene Expression Profiling Interactive Analysis (GEPIA) web (http://gepia2.cancer-pku.cn/#index.) server serves as a highly beneficial resource for conducting gene expression analysis on both tumor and normal samples obtained from the Genotype-Tissue Expression (GTEx, https://www.gtexportal.org/home/) and the Cancer Genome Atlas Program (TCGA, https://portal.gdc.cancer.gov/) databases. Survival analyses were conducted on cancer patient data from publicly accessible portals, namely the GEPIA2 portal (at http://gepia2.cancer-pku.cn/#index) [13]. In our study, GEPIA was used to verify the prognostic value of different expression levels of PTBP1 in cervical cancer. The GEPIA2 portal was utilized to conduct survival analyses through the ‘Survival Analysis’ tool. This tool examines overall survival data and median expression in order to calculate the hazard ratio (HR) accompanied by 95% confidence intervals.

We declared that HeLa, SiHa, and HcerEpic were validated by Short Tandem Repeat (STR) profiling and tested negative for mycoplasma. Cells were all cultured in a humidified incubator at 37 °C and 5% CO₂.

Frozen cells, including HeLa, SiHa and HcerEpic, were quickly taken from the liquid nitrogen and placed in a 37 °C water bath for thawing, following which 5 mL of the prepared medium (90% basic medium, 10% FBS, and 1% penicillin-streptomycin solution) (SiHa and HeLa were cultivated in 1640 medium; HcerEpic was cultured in DMEM medium) was added to the cells in a biosafety cabinet. The cells were centrifuged at room temperature (800 rpm, 3 minutes), and the supernatant was removed. Next, 6 mL of prepared culture medium was used to gently resuspend the cells. The cells were then incubated in a 5% CO₂, 37 °C, incubator. Passaging was performed every 2–3 days according to growth of the cells. When the cells reach the logarithmic growth phase, it can be used for other validation experiments.

After the HeLa and SiHa cells were dissociated from the culture flask wall, a specific amount of cell suspension was taken for cell counting, and 1.0 $\times$ 10⁵ cells/well were plated into a six-well plate. The plate was then returned to the cell incubator for further culture. After 24 hours (h), small interfering RNA (siRNA) (siPTBP1-ss: GGCACAGUGUUGAAGAUCATT; siPTBP1-as: UGAUCUUCAACACUGUGCCTT) (Synthesized by Ruibo Biotechnology Co., Ltd, Guangzhou, China) and Lipofectamin3000 transfection working fluid were prepared using Opti-MEM medium. Then, the transfection solution was standly kept for 10 minutes before being added to the six-well plate for transfection. After 6 h, the normal medium was replaced, and the cells were continued to be cultured for 48 h [14]. After HeLa and SiHa were transfected, Phosphoinositide 3-kinase (PI3K) agonist 740 Y-P (30 µM) [15] was co-treated for different time. Finally, the cells were collected for other tests.

The dissociated cells (HeLa and SiHa) were counted, and placed in 96-well plates at 10⁴ cells/well. The plates were gently shaken and placed back into the cell incubator for further culture. After 24 h, 10 µL of CCK-8 solution was added to each well of 96 well plates, which were then returned to the cell incubator for 1 h. Subsequently, the optical density (OD) value of each well was measured using a microplate reader (BioTek, Winooski, VT, USA) at a 450 nm wavelength.

Cervical cancer tissues and normal tissues were fixed in formaldehyde and embedded in paraffin to prepare sections with a thickness of 4 µm. The sections were dewaxed, then a gradient of ethanol was used to hydrate and wash them with PBS. After antigen retrieval, the sections were incubated with a primary antibody PTBP1, then washed with PBS, incubated with a secondary antibody, washed with PBS, and stained with DAB. Hematoxylin re-staining was performed, followed by dehydration using a gradient of ethanol. Finally, the sections were made transparent and sealed with neutral gum. Positive staining was observed as brownish-yellow under an optical microscope, and the expression level was determined based on the intensity of the color. ImageJ software (National Institutes of Health, Bethesda, MD, USA) was used to quantify and compare the differences.

According to the instructions, the total RNA was extracted using total RNA extraction kit from Beyotime, in brief, treated cells were collected, and 1 mL of Beyozol was added to the cells. The mixture was transferred to an Eppendorf (EP) tube and kept at room temperature (5 minutes). Next, the above was mixed with 0.2 mL of chloroform and was shaken using a vortex instrument (15 seconds). The tube was centrifuged at 1.2 $\times$ 10⁴ $\times$g (15 minutes, 4 °C), and the water phase (upper colorless section) containing total RNA was drawn into a new EP tube. Then, the water phase containing total RNA was mixed with 0.5 mL of isopropanol several times, and precipitated at room temperature (10 minutes). The solution was centrifuged at 1.2 $\times$ 10⁴ $\times$g (10 minutes, 4 °C), and RNA precipitation was observed at the bottom of the tube. After removing the supernatant, 1 mL of 75% ethanol (prepared with Diethyl Pyrocarbonate (DEPC) water) was added to the tube. The mixture was vortexed for mixing and then centrifuged at 7500 $\times$g (5 minutes, 4 °C). After removing the supernatant, 20 µL of DEPC water was used to dissolve the RNA. The RNA was frozen at –80 °C. Reverse transcription was performed to obtain cDNA using the TAKARA reverse transcription kit (Takara Bio group, Osaka City, Japan), and the cDNA was quantitatively amplified using a fluorescence quantitative PCR kit (Takara Bio group, Osaka City, Japan) and Light Cycler ® 480 automatic fluorescence quantitative PCR system (Roche, Basel, Switzerland). According to the formula: $△$$△$Ct = $△$Ct_{treated group} – $△$Ct_{normal group}, $△$Ct = Ct (target gene) – Ct (internal reference), relative expression level = 2^-⁣△△Ct, the expression level of the target gene was calculated [14]. The experiment was repeated three times. (PTBP1-F: TTCGGCACAGTGTTGAAGATCAT; PTBP1-R: TCACGGCTCTTGTCATTGTTGTA; GAPDH-F: AATGCATCCTGCACCACCAA; GAPDH-R: GTAGCCATATTCATTGTCATA)

Total protein was extracted from the treated cells using the whole protein extraction kit. Briefly, after the cells were washed and centrifuged, the supernatant was removed, and the Lysis Buffer (containing phosphatase inhibitor, PMSF, and protease inhibitor; Beyotime Biotechnology Co., Ltd, Shanghai, China) was added. After sufficient lysis, the lysed cells were centrifuged at 1.2 $\times$ 10⁴ $\times$g (4 °C, 15 minutes), and the supernatant was collected. The extracted protein was quantified through the bicinchoninic acid (BCA) kit (Beyotime Biotechnology Co., Ltd, Shanghai, China), then boiled for 10 minutes with loading buffer, and stored at –80 °C. SDS-PAGE gel was prepared according to the kit instructions, and 30 µg of the protein sample was loaded per well. After SDS-PAGE separation, the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (0.45 µm) and blocked with 5% BSA. The primary antibodies solution was prepared, including PTBP1, p62, LC3-I, LC3-II, p-AKT and AKT, Cytochrome C, and GAPDH, the membranes were incubated in the above solution overnight at 4 °C. The membranes were washed and incubated in the HRP labeled secondary antibody solution (1:5000) at room temperature for 1h. The membranes were washed again [16]. The ECL kit (Epizyme Biomedical Technology Co., Ltd, Shanghai, China) was used to prepare the luminescent solution, and the membrane was immersed in the solution and placed in a chemiluminescence system (Thermo Fisher Scientific Inc., Waltham, MA, USA) for observation and image collection. The protein signal value of the band on the membrane was quantified using ImageJ software (1.40, National Institutes of Health, Bethesda, MD, USA). The relative expression of each protein was determined through calculating the ratio of band densities of the target protein to GAPDH (internal reference). The experiment was repeated three times.

In this experiment, 5.0 $\times$ 10⁵ cells were placed in six-well plates. After 48 h, the HeLa and SiHa were dissociated with EDTA-free trypsin, centrifuged at 1000 rpm/min (5 minutes, 4 °C), and washed twice with PBS. The PBS was removed, and 500 µL Binding Buffer was added to gently blow the cells. 5 µL Propidium Iodide (100$\times$) was added and mixed, followed by the addition of 5 µL Annexin V-FITC (100$\times$), and mixed at room temperature (10 minutes, in the dark). Flow cytometry (Becton & Dickinson, Franklin Lake, NJ, USA) was used to observe and detect the cells, and the collected data was analyzed by FlowJo_V10 software (Tree Star, Mountain View, CA, USA), and the early and late apoptosis rates were quantified.

Here, 5.0 $\times$ 10⁶ cells were placed in six-well plates. After 24 h, when the cells had grown to confluence, scratches were created with a 200 µL pipette tip in the center of each well. The fallen cells were removed through washing with PBS. Microscopic images of the scratch were taken at different fields of view as control at 0 h. After 60 h, images of the scratch were taken again, and the migration of the cells was compared to the 0-h control [17]. The change in scratch spacing was analyzed using Image J software (1.40, National Institutes of Health, Bethesda, MD, USA).

The cells (1.0 $\times$ 10⁶ cells/well) were plated in a transwell chamber (without extracellular matrix (ECM) coating). The chamber was placed in a 24-well plate and cultured with serum-free medium. The lower chamber was cultured with 30% FBS cell medium. After 60 h of culture in the cell incubator, the cells on the upper surface of the chamber membrane were gently removed with a cotton swab. The cells on the lower surface of the chamber membrane were then fixed with the 0.1% crystal violet staining solution for 5 minutes. After staining, the chamber was washed with double-distilled water and dried at room temperature [17]. Microscopic images of the transwell chamber were randomly taken for counting the number of cells. Then, the Image J software (1.40, National Institutes of Health, Bethesda, MD, USA) was used to analyze the data and compare the differences between the experimental and control groups.

For statistical analysis, the collected data was analyzed with GraphPad Prism7.0 software (GraphPad Software Co., Ltd, San Diego, CA, USA). Data are presented as mean $\pm$ standard deviation ($\overline{X}$ $\pm$ SD). Differences between groups were analyzed using one-way ANOVA, and comparisons between two groups were analyzed with a t-test [18]. A p-value of 0.05 was regarded as statistically significant.

As seen in Fig. 1A–E, immunohistochemistry results indicated that the expression level of PTBP1 in cervical cancer tissues was significantly different from that in normal tissues (p 0.05), and the expression level in cervical cancer tissues was 11.3 times higher than that in normal tissues (comparison of mean values); Western blot results indicated that the expression level of PTBP1 in cervical cancer tissues was markedly higher than that in normal tissues (p 0.05) (Fig. 1F,G). The cervical cancer cells (HeLa and SiHa) had obviously higher expression level of PTBP1compared to normal cells (the normal cervical cell HcerEpic) (Fig. 1H,I). Additionally, survival analysis of 292 cervical cancer patients collected from the GEPIA dataset revealed that patients with high expression of PTBP1 had poor survival prognosis (Fig. 1J), suggesting a positive correlation between PTBP1 expression level and malignant development of cervical cancer.

Fig. 1.

Polypyrimidine tract binding protein 1 (PTBP1) is highly expressed in cervical cancer tissues and cells, and its expression is associated with prognosis. (A) Immunohistochemical staining of PTBP1 (normal tissues) (100$\times$). Scale bars: 500 µm. (B) Immunohistochemical staining of PTBP1 (cervical cancer tissues) (100$\times$). Scale bars: 500 µm. (C) An enlarged version of (A) (200$\times$). Scale bars: 250 µm. (D) An enlarged version of (B) (200$\times$). Scale bars: 250 µm. (E) Relative quantification of PTBP1 immunohistochemical staining (tissues). (F) Relative quantification of PTBP1 protein expression (tissues). (G) Protein bands of PTBP1 (tissues). (H) Protein bands of PTBP1 (cells). (I) Relative quantification of PTBP1 protein expression (cells). (J) Correlation analysis of PTBP1 expression level and overall survival. Protein levels were quantified by densitometry using Image J and normalized to GAPDH levels. Data was shown as mean $\pm$ SD from three independent experiments. vs. normal, *p 0.05.

In HeLa cells (Fig. 2A,B), the protein expression level of PTBP1 in the si-PTBP1 group was significantly reduced after 48 h of si-PTBP1 interference, compared with the siRNA-negative control (si-NC) group (p 0.05). The mRNA expression level of PTBP1 in the si-PTBP1 group was also significantly decreased, compared with the si-NC group (Fig. 2C) (p 0.05). Similarly, in SiHa cells, both protein and mRNA expression levels of PTBP1 were significantly reduced after 48 h of si-PTBP1 interference (p 0.05) (Fig. 2E–G). These results demonstrated that PTBP1 expression was remarkably decreased in cervical cancer cells after siRNA interference, and confirmed the effectiveness of the siRNA interference in suppressing PTBP1 gene expression. Furthermore, the CCK-8 results showed that, compared with the si-NC group, the cell viability of HeLa and SiHa cells was markedly decreased after transfection of si-PTBP1 for 48 h, as shown in Fig. 2D,H (p 0.05). It was indicated that PTBP1 silencing can inhibit the proliferation of cervical cancer cells.

Fig. 2.

PTBP1 silencing can effectively downregulate PTBP1 expression and inhibit the proliferation of cervical cancer cells. (A) Representative protein bands (HeLa). (B) Relative quantification of PTBP1 protein expression (HeLa). (C) Relative mRNA expression level of PTBP1 (HeLa). (D) HeLa cell viability. (E) Representative protein bands (SiHa). (F) Relative quantification of PTBP1 protein expression (SiHa). (G) Relative mRNA expression level of PTBP1 (SiHa); (H) SiHa cell viability. Protein levels were quantified by densitometry using Image J and normalized to GAPDH levels. Data was shown as mean $\pm$ SD (n = 3) from three independent experiments. vs. Control (CON), *p 0.05; si-NC, siRNA-negative control.

After transfecting cells with si-PTBP1 for 48 h, as shown in the results of flow cytometry detection, the lower left quadrant represents normal ventricular cells; the lower right quadrant represents cells undergoing early apoptosis; the upper right quadrant represents cells undergoing advanced apoptosis; the upper left quadrant represents necrotic cells; cells undergoing early and late apoptosis were collectively regarded as apoptotic cells. In HeLa cells, the si-PTBP1 group (apoptosis rate: 18.96% $\pm$ 0.57%) had a significantly higher apoptosis rate compared to the si-NC group (apoptosis rate: 5.46% $\pm$ 0.33%) (p 0.05) (Fig. 3A,B). Similar results were observed in SiHa cells with si-PTBP1 transfection (apoptosis rate: 16.68% $\pm$ 0.32%) (p 0.05) (Fig. 3C,D). In the PI3K agonist group (HeLa, 3.03% $\pm$ 0.18%; SiHa, 2.25% $\pm$ 0.22%), the apoptosis rates were remarkably reduced in both HeLa and SiHa cells, compared to the si-NC group (HeLa, 5.46% $\pm$ 0.33%; SiHa, 5.29% $\pm$ 0.19%) (p 0.05). Compared to the si-PTBP1 group (HeLa, 18.96% $\pm$ 0.57%; SiHa, 16.68% $\pm$ 0.32%), the apoptosis rate was significantly decreased in the si-PTBP1+PI3K agonist group (HeLa, 5.73% $\pm$ 0.26%; SiHa, 4.94% $\pm$ 0.43%) (p 0.05), while the apoptosis rate in the si-PTBP1+PI3K agonist group was not statistically different from the si-NC group (p $>$ 0.05) (Fig. 3A–D). These results indicated that PTBP1 silencing can induce apoptosis of cervical cancer cells.

Fig. 3.

PTBP1 silencing effectively promotes cervical cancer cell apoptosis. (A) Representative plots of apoptosis (HeLa). (B) Quantification of early and late apoptosis rates (HeLa). (C) Representative plots of apoptosis (SiHa). (D) Quantification of early and late apoptosis rates (SiHa). Phosphoinositide 3-kinase (PI3K) agonist was co-cultured for 48h. Data was presented as mean $\pm$ SD (n = 3) from three independent experiments. vs. si-NC, *p 0.05.

The transwell assay showed that si-PTBP1 markedly reduced the migration ability of HeLa cells after 60 h of transfection, compared with the si-NC group (Fig. 4I) (p 0.05). Similar results were observed in SiHa cells (Fig. 4J) (p 0.05). The addition of a PI3K agonist promoted the migration ability of both HeLa and SiHa cells (Fig. 4I,J) (p 0.05). However, compared with the si-PTBP1 group, the migration ability was obviously upregulated in the si-PTBP1+PI3K agonist group, and was not statistically different from that in the si-NC group (Fig. 4I,J) (p $>$ 0.05). In cell scratch test, compared with 0 h (Fig. 4A,C,E,G), the scratch spacing of each group obviously reduced after 60 h of culture (Fig. 4B,D), in both HeLa and SiHa cells, but the degree of reduction in scratch spacing varies. After 60 h of transfection, the scratch spacing of si-PTBP1 interference was markedly wider than that of the si-NC group in both HeLa and SiHa cells (p 0.05) (Fig. 4B,D,F,H). In contrast, scratch spacing of the PI3K agonist group was significantly smaller than that of the PI3K agonist group (p 0.05) (Fig. 4B,D,F,H). Compared with the si-PTBP1 group, the migration ability of the two cervical cells was remarkably upregulated in si-PTBP1+PI3K agonist group (p 0.05), and was not statistically different from that in the si-NC group (p $>$ 0.05) (Fig. 4B,D,F,H). These results suggested that PTBP1 silencing could inhibit the migration of cervical cancer cells.

Fig. 4.

PTBP1 silencing prevented the migration of cervical cancer cells. (A) Representative images of scratches (HeLa) at 0 h (200$\times$). Scale bars: 250 µm. (B) Representative images of scratches (HeLa) at 60 h (200$\times$). Scale bars: 250 µm. (C) Representative images of scratches (SiHa) at 0 h (200$\times$). Scale bars: 250 µm. (D) Representative images of scratches (SiHa) at 60 h (200$\times$). Scale bars: 250 µm. (E) Quantification of scratch spacing at 0 h (HeLa). (F) Quantification of scratch spacing at 60 h (HeLa). (G) Quantification of scratch spacing at 0 h (SiHa). (H) Quantification of scratch spacing at 60 h (SiHa). (I) Representative images of HeLa cell transwell at 60 h and the quantification of cells (200$\times$). Scale bars: 250 µm. (J) Representative images of SiHa cell transwell at 60 h and the quantification of cells (200$\times$). Scale bars: 250 µm. Phosphoinositide 3-kinase (PI3K) agonist was co-cultured for 60 h. Data was presented as mean $\pm$ SD (n = 3) from three independent experiments. vs. si-NC, *p 0.05.

Compared to the si-NC group, si-PTBP1 markedly reduced the phosphorylation level of AKT (p 0.05) (Fig. 5A,B), while si-PTBP1 showed no effect on the expression level of AKT (p $>$ 0.05) (Fig. 5E,F). Immunofluorescence showed that si-PTBP1 significantly reduced the fluorescence brightness of p-AKT (Fig. 5O). In terms of mitochondrial apoptotic proteins, silencing of PTBP1 upregulated the expression of pro-apoptotic protein Bax, and the mitochondrial apoptotic protein Cytochrome C, while downregulated the expression of anti-apoptotic protein Bcl2 (Fig. 5A,C,D,G) (p 0.05). The Bax/Bcl2 ratio was remarkably increased (p 0.05). Similarly, in SiHa cells, the results were consistent with those observed in HeLa cells (Fig. 5H–N). Overall, these findings suggest that PTBP1 may regulate the AKT pathway and mitochondrial apoptosis of cervical cancer cells.

Fig. 5.

PTBP1 silencing inhibits the AKT pathway and induces mitochondrial apoptosis in cervical cancer cells. (A) Representative protein bands (HeLa). (B) Relative quantification of phospho-Protein Kinase B (p-AKT) protein expression (HeLa). (C) Relative quantification of Bcl2 protein expression (HeLa). (D) Relative quantification of Bax protein expression (HeLa). (E) Representative protein bands (HeLa). (F) Relative quantification of AKT protein expression (HeLa). (G) Relative quantification of Cytochrome C protein expression (HeLa). (H) Representative protein bands (SiHa). (I) Relative quantification of p-AKT protein expression (SiHa). (J) Relative quantification of Bcl2 protein expression (SiHa). (K) Relative quantification of Bax protein expression (SiHa). (L) Representative protein bands (SiHa). (M) Relative quantification of AKT protein expression (SiHa). (N) Relative quantification of Cytochrome C protein expression (SiHa). (O) p-AKT immunofluorescence images of HeLa and SiHa cells (400$\times$). Scale bars: 10 µm. Protein levels were quantified by densitometry using Image J and normalized to GAPDH levels. Data was expressed as mean $\pm$ SD (n = 3) from three independent experiments. vs. CON, *p 0.05. Bcl2, B-Cell Leukemia/Lymphoma 2; Bax, Bcl-2-associated x.

Regarding the effect on autophagy, silencing of PTBP1 obviously elevated the expression of LC3-II (an autophagy protein), and the ratio of LC3-II/LC3-Ⅰ (p 0.05), while si-PTBP1 significantly decreased the expression of p62 (an autophagy substrate) (Fig. 6A–E) (p 0.05). Similarly, in SiHa cells, the results were consistent with those observed in HeLa cells (Fig. 6F–J). These results suggested that PTBP1 is involved in autophagy of cervical cancer cells.

Fig. 6.

PTBP1 silencing promotes autophagy in cervical cancer cells. (A) Representative protein bands (HeLa). (B) Relative quantification of Sequestosome I (p62) protein expression (HeLa). (C) Representative protein bands (HeLa). (D) Relative quantification of LC3-Ⅱ protein expression (HeLa). (E) Ratio of LC3-Ⅱ/LC3-Ⅰ (HeLa). (F) Representative protein bands (SiHa). (G) Relative quantification of p62 protein expression (SiHa). (H) Representative protein bands (SiHa). (I) Relative quantification of LC3-Ⅱ protein expression (SiHa). (J) Ratio of LC3-Ⅱ/LC3-Ⅰ (SiHa). Protein levels were quantified by densitometry using Image J and normalized to GAPDH levels. Data was expressed as mean $\pm$ SD (n = 3) from three independent experiments. vs. CON, *p 0.05. LC3, Light chain 3.

To further investigate the role of PI3K/AKT pathway in PTBP1 regulation of mitochondrial apoptosis and autophagy, we treated both HeLa and SiHa cells with a PI3K agonist. The results showed that the PI3K agonist significantly upregulated Bcl2 expression, while downregulated Bax expression and the mitochondrial apoptotic protein Cytochrome C in both cell lines, compared with the si-NC group (Fig. 7A,C,D,F,H,K,M,N,P,R). Moreover, in the si-PTBP1+PI3K agonist group, the Bax/Bcl2 ratio and Cytochrome C expression were markedly reduced compared with the si-PTBP1 group (p 0.05) but were not statistically different from those in the si-NC group (p $>$ 0.05) (Fig. 7A,C,D,F,H,K,M,N,P,R). In regard to autophagy, the PI3K agonist significantly increased p62 expression, while decreased LC3-II expression and ratio of LC3-II/LC3-I (p 0.05), compared with the si-NC group (Fig. 7A,E,F,I,J). Similarly, in the si-PTBP1+PI3K agonist group, p62 was significantly upregulated, LC3-II and ratio of LC3-II/LC3-I were downregulated, compared with the si-PTBP1 group (p 0.05), while those were not statistically different from the si-NC group (p $>$ 0.05) (Fig. 7A,E,F,I,J). Similarly, in SiHa cells, the results were consistent with those observed in HeLa cells (Fig. 7K,O,P,S,T). Furthermore, both in HeLa and SiHa cells, PI3K agonist significantly upregulated p-AKT expression, compared with the si-NC group (Fig. 7A,B,K,L). What’s more, in the si-PTBP1+PI3K agonist group, the p-AKT expression was markedly elevated compared with the si-PTBP1 group (p 0.05) but was not statistically different from that in the si-NC group (p $>$ 0.05) (Fig. 7A,B,K,L), while both si-PTBP1 and PI3K agonist had no effect on the expression level of AKT (p $>$ 0.05) (Fig. 7F,G,P,Q). Collectively, these results suggested that PTBP1 silencing may induce apoptosis and autophagy of cervical cancer cells by regulating the PI3K/AKT pathway.

Fig. 7.

PI3K agonists reverse the effects of PTBP1 silencing on autophagy and mitochondrial apoptosis in cervical cancer cells. (A) Representative protein bands (HeLa). (B) Relative quantification of p-AKT protein expression (HeLa). (C) Relative quantification of Bcl2 protein expression (HeLa). (D) Relative quantification of Bax protein expression (HeLa). (E) Relative quantification of p62 protein expression (HeLa). (F) Representative protein bands (HeLa). (G) Relative quantification of AKT protein expression (HeLa). (H) Relative quantification of Cytochrome C protein expression (HeLa). (I) Relative quantification of LC3-Ⅱ protein expression (HeLa). (J) Ratio of LC3-Ⅱ/LC3-Ⅰ (HeLa). (K) Representative protein bands (SiHa). (L) Relative quantification of p-AKT protein expression (SiHa). (M) Relative quantification of Bcl2 protein expression (SiHa). (N) Relative quantification of Bax protein expression (SiHa). (O) Relative quantification of p62 protein expression (SiHa). (P) Representative protein bands (SiHa). (Q) Relative quantification of AKT protein expression (SiHa). (R) Relative quantification of Cytochrome C protein expression (SiHa). (S) Relative quantification of LC3-Ⅱ protein expression (SiHa). (T) Ratio of Light chain 3-Ⅱ (LC3-Ⅰ)/LC3-Ⅰ (SiHa). PI3K agonist was co-cultured for 24 h. Protein levels were quantified by densitometry using Image J and normalized to GAPDH levels. Data was shown as mean $\pm$ SD (n = 3) from three independent experiments. vs. CON, *p 0.05.