Male C57BL/6J mice (6–8 weeks old) were purchased from the Experimental Animal Center, Fourth Military Medical University (Xi’an, Shaanxi, China). Mice were randomly assigned to a control group and to a Type 1 diabetes mellitus (T1DM) group. An Streptozotocin (STZ) solution (Sigma-Aldrich, St. Louis, MO, USA, 60 mg/kg) was injected intraperitoneally for 5 consecutive days to construct a type 1 DCM mouse model. The control group was injected with an equal volume of citrate buffer. Blood samples were collected via the tail vein on days 3, 5 and 7 after the last injection. Mice with a random blood glucose level $\ge$16.7 mmol/L were considered to have type 1 DCM and were then maintained for another 6 weeks to develop myocardial injury. All animal experiments were performed in accordance with the guidelines of the Animal Experimentation Committee of the Second Affiliated Hospital of Xi’an Jiaotong University (Shaanxi, approved number XJTUAE2022-374), and all methods were carried out in accordance with Animal Research: Reporting in Vivo Experiments (ARRIVE) guidelines. The above-mentioned experiments were conducted at least three times.

Mice were anesthetized with 2% isoflurane. Echocardiography was used to calculate cardiac function with the UBM system (Vevo 770, Toronto, Canada). Left ventricular fractional shortening (FS) and the ejection fraction (EF) were assessed using Vevo Analysis software (version 3.0.0, VisualSonics, Toronto, Canada). To assess diastolic function, an apical four-chamber view of the left ventricle was obtained. Maximal early (E) and late (A) transmitral velocities in diastole were analyzed to measure the mitral inflow velocity spectrum. Echocardiography was conducted by investigators who were blinded to the study.

After the T1DM model was successfully constructed, mice were sacrificed by cervical dislocation. Left ventricular specimens were obtained, fixed with 4% paraformaldehyde and embedded in paraffin. Tissue samples from the myocardium were then cut into serial sections (5 µm thickness) from the mid-transverse area. The sections were heated to retrieve antigen and then incubated with anti-LC3 antibody overnight at 4 °C. After incubating with a universal two-step kit (anti-rabbit/anti-mouse PV-9000 secondary antibodies) at room temperature for 1 h, diaminobenzidine was used for color rendering and hematoxylin to stain the nuclei. Sections were then cleared in xylene and sealed with neutral gum. An isotype control antibody was used as the negative control. A digital scanner (Pannoramic MIDI, 3DHISTECH, Budapest, Hungary) was used to analyze the immunohistochemistry results. The sections were stained with picrosirus red to display the collagen components. Statistical analysis was carried out using the grading system described in the immunohistochemical technique method of the Chinese Pathological Society.

CY3-labeled STING, FITC-labeled LARP7, and 4′,6-diamidino-2-phenylindole (DAPI) were used in the immunofluorescence analysis. An anti-fluorescence quencher was used for mounting, and a laser confocal workstation was used for immunofluorescence photography. Semi-quantitative analysis of fluorescence images was performed using ImageJ software (version 1.6.0, National Institutes of Health (NIH), Bethesda, MD, USA).

Cardiomyocytes were obtained from the ventricles of 1–3-day old neonatal C57BL/6 mice. The mice were sterilized with 75% ethanol and the hearts removed and rinsed in ice-cold phosphate-buffered saline (PBS, Servicebio, Wuhan, China). The myocardial samples were then cut into small pieces and digested with collagenase type 2 (Sigma‒Aldrich, Saint Louis, MO, USA) until the tissue pieces had dissolved. The suspension was then mixed with dulbecco’s modified eagle medium (DMEM) (ScienCell, San Diego, CA, USA) to stop digestion. The mixture was centrifuged (800 $\times$g for 5 min) and the supernatant retained. The cardiomyocyte-enriched fraction was further resuspended in DMEM. Differential adhesion was used to separate cardiomyocytes and fibroblasts. The isolated cells were placed in a culture flask at 37 °C for 1 h so that fibroblasts could accumulate at the bottom. The cardiomyocytes remained suspended in the medium and were then cultured at 37 °C in 5% CO${}_2$ in DMEM supplemented with 10% fetal bovine serum (SV30087.02, Hyclone, Logan, UT, USA) and 1% penicillin/streptomycin. Cells were seeded in 6-well plates (for Western blot assay) or 20 mm confocal dishes (for immunofluorescence) prior to transfection.

For the knockdown or overexpression of LARP7, NMVCMs were infected with adenovirus carrying negative control (NC-small interfering RNA (siRNA)), knockdown of rat LARP7 gene (LARP7-siRNA), or overexpression of the LARP7 gene (m-LARP7) at an MOI of 100 from Hanbio Tech (Shanghai, China). STING was exogenously overexpressed in NMVCMs via plasmid transfection (m-3*Flag-STING). The corresponding sequences were: LARP7-siRNA (5${}^{\prime }$-3${}^{\prime }$): TGAGAGACCAAAGGACGAGGA, CTTCTTCTGGTGGGTTGTTCAG; m-LARP7 (5${}^{\prime }$-3${}^{\prime }$): CCCAAGGCCAAAAGCTAAGAA, CTCAATGGTATAACCTCCTCGC. Gene expression levels for LARP7 and STING were evaluated by real-time quantitative PCR, and the protein level by Western blot. Stably overexpressing STING, LARP7 and low expression LARP7 cells were selected for futher intervention with high glucose. NMVCMs were cultured with 33 mM glucose for 48 h to simulate a type 1 DCM model in vitro [23]. NMVCMs were treated for 2 h with the autophagy inhibitor 3-methyladenine (3-MA, 10mM) (A8353, APExBIO, Houston, TX, USA) to determine the effect of autophagy on apoptosis and STING expression. NMVCMs were also treated with 1 mM of C-176 (HY-112906, MedChemExpress, Shanghai, China), a potent covalent inhibitor of STING, to evaluate the role of STING in cardiomyocyte fibrosis and apoptosis. Cardiomyocytes were randomly divided into the following groups: (i) control; (ii) high glucose (HG); (iii) 3-MA; (iv) HG+C-176; (v) HG+LARP7-siRNA; (vi) HG+LARP7-siRNA+C-176; (vii) LARP7-siRNA; (viii) m-3*Flag-STING; (ix) m-3*Flag-STING+LARP7-siRNA; (x) HG+m-3*Flag-STING; (xi) HG+m-3*Flag-STING+LARP7-siRNA; and (xii) m-LARP7.

The cell medium from NMVCMs was discarded and the cells washed with PBS. The samples were then homogenized in pre-cooled protein lysis buffer containing phenylmethylsulfonyl fluoride (PMSF) (1 mM, pH = 7.4) (HY-B0496, MedChemExpress, Shanghai, China), lysed by ultrasound, and centrifuged for 30 min to extract total protein. Protein quantification was performed using the bicinchoninic acid assay (BCA) method. Total protein (20 µg) was electrophoresed on a 10% denaturing polyacrylamide gel and the separated proteines then transferred onto a polyvinylidene fluoride (PVDF) membrane. After blocking with 5% non-fat milk, the membrane was incubated overnight at 4 °C with the following primary antibodies: cGAS, p-STING (Ser365), STING, LARP7, INF-$\beta$, $\alpha$-SMA, Cl-Caspase3, LC3II/I, Beclin-1 and P62 (as shown in Supplementary Tables 1,2). The membrane was subsequently incubated with horseradish peroxidase (HRP)-labeled secondary antibody (1:5000, Cell Signaling, Danvers, MA, USA) at room temperature for 40 min. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and $\beta$-actin were used as loading controls. Blots were visualized with a chemiluminescence system (Amersham Bioscience, Buchinghamshire, UK) and semi-quantitative densitometry results obtained for the developed bands. The ratio of the gray value of the target band to that of the GAPDH band was calculated to evaluate the protein level.

To evaluate the extent of cardiomyocyte remodeling, $\alpha$-SMA and phalloidin staining were used to analyze the degree of myocardial fibrosis and the cytoskeletal morphology, respectively. Confocal dishes pre-seeded with NMVCMs were washed three times with precooled PBS, and the cardiomyocytes then fixed for 15–20 min with formaldehyde precooled to 4 °C. This was followed by 3 washes with precooled PBS, and incubation in permeabilization buffer (0.1% Triton X-100 in PBS) for 15 min to rupture the cell membranes. Cells were then incubated with a bovine serum albumin (BSA) solution for 90 min to block nonspecific binding. Next, primary antibody against $\alpha$-SMA was added and the cells incubated overnight at 4 °C. Fluorescent (FITC) secondary antibody (rabbit anti-mouse, 1:200, Boster) was then added and the cells incubated for 60 min at room temperature. DAPI was subsequently used for nuclear staining, while the expression of $\alpha$-SMA in each group of cells was estimated from the intensity of green fluorescence in the field of view. Phalloidin staining was used to visually assess the morphology of the myocardial cytoskeleton by laser confocal microscopy and use of the appropriate fluorescence channel.

Cardiomyocyte apoptosis was assessed using the DNA ladder assay, terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL) staining, and Western blot analysis of Cl-caspase3. TUNEL staining was used to stain myocardial tissue sections, as recommended by the instructions provided with the apoptosis detection kit (Roche, Basel, Switzerland). After mounting with an anti-fluorescence quenching agent, the sections were observed and photographed under a laser confocal microscope (Leica TCS SP8, Leica, Hessen, Germany), thus allowing the cell apoptosis rate to be determined [24].

In the DNA ladder assay, myocardial DNA was extracted using a nucleic acid extraction kit (IsoQuicks, Microprobe, Carlsbad, CA, USA). The extracted DNA (10 mg) was added to a 2% agarose gel containing ethidium bromide and electrophoresed in Tris-borate-EDTA (TBE) buffer at 100 V for 2 h. The DNA ladders were then photographed.

The colocalization in cardiomyocytes of STING and LC3, and of STING and LARP7, were evaluated separately by immunofluorescence. NMVCMs were seeded into confocal dishes and then treated. The culture medium was discarded and the cells washed three times with sterile PBS, incubated in permeabilization buffer (0.1% Triton X-100 in PBS) for 15 min to rupture cell membranes, and incubated in a BSA solution for 60 min to block nonspecific binding. The cells were then incubated overnight at 4 °C with rabbit-derived STING, LC3 and LARP7 antibodies. Subsequently, the cells were incubated with an appropriate secondary antibody for 90 min at room temperature. Different molecules are labeled with different fluorescence which was evaluated using a laser confocal microscope. The extent of merging of different groups of fluorescent particles was analyzed and calculated using Image-Pro PLUS software (Media Cybernetics, Silver Spring, MD, USA) to evaluate the colocalization of STING and LC3, as well as that of STING and LARP7.

COIP was conducted using a Proteintech immunoprecipitation (IP) kit (KIP-2). NMVCMs were pre-processed and grouped. To fully lyse cardiomyocytes, a total of 100 µL of precooled IP lysis buffer (containing 1$\times$ protease inhibitor) was added to 106 cells for 30 min. The cells were disrupted by ultrasonication for 1 min to fully lyse and fragment the DNA. They were then centrifuged at 12,000 rpm for 10 min at 4 °C and the supernatant collected. Washed Protein A-Sepharose beads (30 µL) were then added to each lysate tube, and the samples incubated for 120 min with slow rotation at 4 °C. This was followed by centrifugation at 12,000 rpm for 1 min, after which the supernatant was collected and 4 µg of IP antibody and 300 µL of incubation buffer were added to the supernatant. As a negative control, equal amounts of control IgG derived from the same species were added to the samples and incubated overnight at 4 °C. Resuspended Protein A-Sepharose beads were then added to the samples and incubated for 3 h at 4 °C with slow rotation to precipitate the immune complexes. The supernatant was discarded, and the precipitate was retained and washed 5 times. Finally, the precipitated complexes were eluted twice with 40 µL of elution buffer, to which 10 µL of alkaline neutralization buffer and 23 µL of 5 $\times$ sample buffer were then added. The samples were boiled in water for 8 min and subsequently stored at –80 °C for analysis by Western blot.

The immunoprecipitation (IP) procedure used for the preparation of samples for Mass Spectrometry (MS) was the same as that described above. The IP samples from each group were electrophoresed to obtain gel strips, and the peptides in these strips were then enzymatically hydrolyzed. The hydrolyzed peptides were separated by column chromatography and subsequently injected into a tandem MS for primary and secondary MS analyses.

Ventricular cardiomyocytes pretreated with high glucose were fixed with 3.0% glutaraldehyde and 1.5% paraldehyde, washed 3 times with PBS, and finally fixed with 1% osmium tetroxide for 1 h to produce osmium black. Samples were then dehydrated with ethanol and embedded in epoxy resin. A transmission electron microscope (H-7650, Tokyo, Japan) was then used to observe the number of myocardial autophagosomes and autophagolysosomes in myocardial tissue, as well as the damage to mitochondria, endoplasmic reticulum and other organelles.

Continuous variables were presented as the mean $\pm$ SEM. The t test was used for comparisons between two groups. Analysis of variance (ANOVA) was used for multiple comparisons, with the Bonferroni-corrected t test used for post-hoc testing. Tests for significance were always two-sided, and p 0.05 was considered statistically significant. Data analysis was performed using SPSS 14.0 (SPSS, Chicago, IL, USA).

The expression of STING and LARP7 was evaluated in myocardial cells from a mouse model of type 1 DCM, while cardiac systolic and diastolic function were evaluated by echocardiography. The systolic function index in the T1DM group was significantly lower than in the control group. High glucose levels induced LV enlargement. Meanwhile, the E/A ratio was markedly decreased in the T1DM group, indicated the mice had cardiac diastolic dysfunction (Fig. 1A). In addition, the expression of STING and LARP7 in the myocardial tissue of mice from the T1DM group was significantly higher than in the control group (Fig. 1B–E). This finding was further confirmed by Western blot analysis, which revealed significant upregulation of the upstream signaling molecule cGAS and downstream effector molecule INF-$\beta$ (Fig. 1H). Immunohistochemistry results showed significantly lower expression of LC3 in myocardial tissue from the T1DM group compared to the control group, indicating inhibition of autophagy (Fig. 1F). Importantly, the myocardial tissue showed myocardial fibrosis, which is a typical pathological feature of DCM (Fig. 1G). These results suggest that LARP7 and STING may play an important role in the pathogenesis of DCM.

Fig. 1.

Increased expression of STING and LARP7 in the myocardial tissue of mice with type 1 DCM, and inhibition of autophagy. (A) High glucose levels induced systolic and diastolic dysfunction in T1DM mice. Bar charts show decreased EF, FS, left ventricular end-diastolic internal diameter (LVEDD), left ventricular end-systolic internal diameter (LVESD) and E/A ratio after STZ injection. **p 0.01 and ***p 0.001, n = 6, (mean $\pm$ SEM). (B–E) The mouse model of type 1 DCM was established by continuous intraperitoneal injection of streptozotocin (STZ). The myocardial tissue was then harvested and immunofluorescently labeled with STING-CY3 and LARP7-FITC. Differential expression of STING-CY3 and LARP7-FITC between the T1DM and control groups was then evaluated. STING-CY3 emits red fluorescence, LARP7-FITC emits green fluorescence (scale bar = 500 µm). Two-tailed Student t test; *p 0.05 vs. the control group, n = 3, (mean $\pm$ SEM). (F) Immunohistochemistry was used to visualize the expression of LC3 in mouse cardiomyocytes (scale bar = 50 µm). Two-tailed Student t test; *p 0.05 vs. the control group, n = 3, (mean $\pm$ SEM). (G) Picrosirus red staining of mouse myocardial tissue (scale bar = 50 µm). (H) Western blot results for cGAS, STING, LARP7 and INF-$\beta$ in mice. Two-tailed Student t test; ***p 0.001, n = 6, (mean $\pm$ SEM). STING, Stimulator of Interferon Genes; LARP7, La ribonucleoprotein domain family member 7; DCM, Diabetic Cardiomyopathy; T1DM, Type 1 Diabetes Mellitus; EF, Ejection Fraction; FS, Fractional Shortening; STING-CY3, STING-Cyanine 3; LARP7-FITC, LARP7-Fluorescein Isothiocyanate; LC3, Light Chain 3; cGAS, cyclic GMP–AMP synthase; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; E/A ratio, Early peak/Artial peak ratio.

Western blot analysis showed that the expression and activation levels of STING were significantly upregulated in the HG group. This effect occurred in parallel with increases in $\alpha$-SMA and Cl-caspase3 (Fig. 2A). The expression of $\alpha$-SMA in cardiomyocytes was further evaluated by immunofluorescence, while cardiomyocyte apoptosis was evaluated using the DNA ladder assay. The results were similar to those of Western blot analysis. Interestingly, the inhibition of STING using C-176 significantly ameliorated high glucose-induced cardiomyocyte fibrosis and apoptosis (Fig. 2B,C). In summary, high glucose caused cardiomyocyte fibrosis and apoptosis via the accumulation and activation of STING.

Fig. 2.

High glucose enhanced the expression and activation of STING in cardiomyocytes. (A) Western blot results for STING, p-STING, $\alpha$-SMA and Cl-caspase3 in NMVCMs treated with high glucose. Two-tailed Student t test; **p 0.01 and ***p 0.001, n = 6, (mean $\pm$ SEM). (B) Immunofluorescence staining results for $\alpha$-SMA in cardiomyocytes treated with high glucose and the STING inhibitor C-176 (scale bar = 100 µm). One-way ANOVA with the Bonferroni-corrected t test; *p 0.05 vs. control group, ${}^{\mathrm{\#}}$p 0.05 vs. HG group, n = 8, (mean $\pm$ SEM). (C) DNA ladder assay was used to evaluate cardiomyocyte apoptosis under different treatment conditions, which was spliced together from two repeated experiments. $\alpha$-SMA, $\alpha$-smooth muscle actin; HG, High Glucose; DAPI, 4${}^{\prime }$,6-diamidino-2-phenylindole.

STING contains 7 regions (LIR1-7) that bind directly to the autophagy molecule LC3. This region induces LC3 lipidation and activates autophagy (Fig. 3A). To explore the effect of high glucose on autophagy, immunofluorescence colocalization was used to study the intracellular expression of LC3 and STING. LC3 expression and autophagy were lower in the HG group compared to the control group (Fig. 3B). COIP experiments further confirmed that high glucose reduced the binding ability of LC3 to STING (Fig. 3C). Transmission electron microscopy revealed the presence of significantly fewer autophagosomes, autophagolysosomes, and lysosomes in cardiomyocytes from the HG group compared to the control group. In addition, many of the mitochondria were swollen, damaged, and ruptured (Fig. 3D). Together, these results indicate that high glucose inhibits autophagy. This was further confirmed by Western blot analysis, which showed a significant decrease in the expression of autophagy signature proteins such as LC3II/I, Beclin-1 and P62 in NMVCMs treated with high glucose (Fig. 3E). Treatment of cardiomyocytes with the autophagy inhibitor 3-MA significantly increased the expression of STING in the cytoplasm. This was accompanied by cardiomyocyte shrinkage and poor cytoskeletal continuity. The number of apoptotic cardiomyocytes detected by the TUNEL assay was also significantly increased (Fig. 3F–I). In summary, high glucose interfered with STING degradation through the autophagy-lysosomal pathway by inhibiting the binding of STING to LC3. This resulted in accumulation of STING, leading to structural damage and increased cardiomyocyte apoptosis.

Fig. 3.

High glucose levels disrupted the STING-triggered autophagy “negative feedback loop”. (A) Molecular structure of STING. (B) Immunofluorescence colocalization of STING and LC3 in NMVCMs treated with high glucose: green fluorescent particles represent LC3, yellow fluorescent particles represent STING, and yellow fluorescent particles that overlap with green fluorescent particles suggest that STING directly interacts with LC3 (scale bar = 50 µm). (C) Coimmunoprecipitation (COIP) results for LC3 and STING. (D) TEM image of cardiomyocytes treated with high glucose. The black arrow represents autophagolysosomes (scale bar = 5 µm (overview); scale bar = 2 µm (inset)). (E) Western blot results for LC3II/I, Beclin-1 and P62 in NMVCMs treated with high glucose. Two-tailed Student t test; **p 0.01 and ***p 0.001, n = 6, (mean $\pm$ SEM). (F–I) NMVCMs were pretreated with the autophagy initiation inhibitor 3-methyladenine (3-MA). The expression of STING in cardiomyocytes was then assessed by immunofluorescence, and the morphology of the cardiomyocyte cytoskeleton was assessed by phalloidin staining (scale bar = 30 µm). Two-tailed Student t test, *p 0.05 vs. control group, n = 8, (mean $\pm$ SEM); apoptotic cardiomyocytes were detected using the TUNEL assay (scale bar = 300 µm). Two-tailed Student t test, *p 0.05 vs. control group, n = 6, (mean $\pm$ SEM).

To directly explore the role of free LARP7 in DCM, the expression of LARP7 and STING were inhibited with siRNA and C-176, respectively. Western blot results showed that STING expression was significantly upregulated in the HG group. In the groups in which LARP7 or STING were inhibited, activation of the STING pathway was attenuated compared with the HG group, and cardiomyocyte apoptosis was reduced. The inhibition of LARP7 by siRNA following the inhibition of STING by C-176 had a more obvious inhibitory effect on the STING pathway (Fig. 4A). In addition, cardiomyocyte apoptosis was further reduced. These findings suggest that a regulatory mechanism between free LARP7 and STING mediates the expression and activation of STING, thereby aggravating cardiomyocyte damage.

Fig. 4.

LARP7 translocates from the nucleus to the cytoplasm, where its interaction with STING results in the aggravation of myocardial injury. (A) Western blot results for LARP7, STING, p-STING, and Cl-caspase3 in NMVCMs in which the expression of LARP7 and STING was inhibited by siRNA and C-176, respectively. One-way ANOVA with the Bonferroni-corrected t test; *p 0.05 vs. control group, ${}^{\mathrm{\#}}$p 0.05 vs. HG group, ${}^{\mathrm{\S }}$p 0.05 vs. HG+LARP7-siRNA group, ${}^{\$}$p 0.05 vs. HG+NC-siRNA group, p 0.05 vs. HG+C-176 group, n = 4, (mean $\pm$ SEM). (B) Immunoprecipitation (IP) was performed for three important molecules in the STING signaling pathway: cGAS-STING-TBK1. The final solution obtained after IP was subjected to electrophoresis, and the gel strips obtained by electrophoresis were then subjected to mass spectrometry (MS). (C) COIP experiment results confirmed that both exogenously overexpressed STING (transfected with the 3$\times$Flag-STING plasmid, IP: Flag) and endogenous STING (IP: STING) interacted with LARP7. (D) After high glucose treatment, LARP7 and STING in cardiomyocytes were labeled using an immunofluorescence double-labeling colocalization method. The green fluorescent particles represent LARP7, the red fluorescent particles represent STING, and overlapping of the two appear as yellow fluorescent particles (scale bar = 50 µm). Two-tailed Student t test; *p 0.05 vs. control group, n = 6, (mean $\pm$ SEM).

MS analysis of three important molecules in the STING signaling pathway, cGAS-STING-TBK1, revealed a very high abundance of LARP7 in the final STING IP solution compared with the negative control (Fig. 4B). COIP experiments confirmed that both exogenously overexpressed STING and endogenous STING interacted with LARP7, and that high glucose enhanced this interaction (Fig. 4C). Next, LARP7 and STING were fluorescently labeled to visualize their intracellular localization. After high glucose treatment, a large amount of LARP7 was observed to translocate from the nucleus to the cytoplasm, where it colocalized with STING (Fig. 4D). Taken together, these results indicate that high glucose induced the intracellular translocation of LARP7, and that its interaction with STING led to accumulation in the cytoplasm where it mediated cardiomyocyte apoptosis.

To further explore the mechanism by which LARP7 and STING interact to induce myocardial injury, the expression of LARP7 was first inhibited with siRNA. STING was then overexpressed via 3$\times$ Flag-STING plasmid transfection. As shown in Fig. 5A–D, inhibition of LARP7 caused the expression and activation of STING to be significantly lower than in the control and HG groups. In addition, LARP7 inhibition mitigated the activation effect caused by exogenous overexpression of STING, and alleviated apoptosis induced by the upregulation of STING. These findings indicate that LARP7 regulates the STING pathway at an upstream location. Next, the expression and localization of LC3 and STING in cardiomyocytes were assessed following the upregulation of LARP7 expression. This revealed a significant decrease in LC3 in cardiomyocytes, accompanied by the accumulation of intracellular STING and reduced colocalization with LC3 (Fig. 5E). Together, the above results indicate that LARP7 blocks the degradation of STING by disrupting the STING-triggered autophagy-lysosomal “negative feedback loop”. This results in the accumulation and overactivation of STING in cardiomyocytes, eventually causing cardiomyocyte damage.

Fig. 5.

LARP7 mediates myocardial injury by inhibiting the autophagy-lysosomal degradation pathway. (A,C) Mouse cardiomyocytes were treated with siLARP7, m-3*Flag-STING, or siLARP7+m-3*Flag-STING. Western blot analysis was then performed on LARP7, STING, and p-STING (Ser365). One-way ANOVA with the Bonferroni-corrected t test; *p 0.05 vs. control, ${}^{\mathrm{\#}}$p 0.05 vs. si-LARP7, ${}^{\mathrm{\S }}$p 0.05 vs. m-3*Flag-STING, n = 6, (mean $\pm$ SEM). (B,D) An in vitro model of ventricular cardiomyocytes with type 1 diabetes mellitus was established with high glucose. The above procedures were then repeated to evaluate the expression of STING, p-STING (Ser365) and Cl-caspase3. One-way ANOVA with the Bonferroni-corrected t test; *p 0.05 vs. control group, ${}^{\mathrm{\#}}$p 0.05 vs. HG group, ${}^{\mathrm{\S }}$p 0.05 vs. HG+m-3*Flag-STING group, ${}^{\$}$p 0.05 vs. HG+STING control vector group, p 0.05 vs. HG+ LARP7-siRNA group, ${}^{\mathrm{\P }}$p 0.05 vs. HG+NC-siRNA group, n = 4, (mean $\pm$ SEM). (E) LARP7 was first upregulated and then the expression and localization of LC3 and STING in cardiomyocytes was detected using an immunofluorescence colocalization assay. Green fluorescent particles represent GFP-LC3 and GFP-LC3-labeled autophagosomes, red fluorescent particles represent STING, and yellow dots are the result of the overlapping of red dots and green dots, representing the colocalization of GFP-LC3 and STING (scale bar = 30 µm).