Baby Hamster Kidney (BHK-21) and Human Embryonic Kidney 293 (HEK-293) cells were acquired from ATCC (Manassas, VA, USA). All cell lines were validated by STR profiling and tested negative for mycoplasma. Cells were cultured in high glucose Dulbecco’s modified Eagle medium (DMEM, CGM101.05, Bailing, Lanzhou, China) with 10% newborn bovine serum (NBS, SA301.02.V, Cellmax, Beijing, China) at 37 ℃ in a 5% CO${}_2$ incubator (BB150, Thermofisher, Waltham, MA, USA). The EMCV PV21 strain (GenBank Accession no. X74312) was propagated in BHK-21 cells and preserved at –80 ℃ in a freezer.

All antibodies were bought from specified suppliers. Sangon Biotech (Shanghai, China) provided horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (D110058) and HRP-conjugated goat anti-mouse IgG (D110087). Antibodies for MAVS (14341-1-AP), HA-tag (51064-2-AP), and IRF3 (11312-1-AP) were bought from Proteintech (Wuhan, China). Cell Signaling Technology (Beverly, MA, USA) provided the antibodies for STING (13647S), TBK1 (3013S), and Myc-tag (2276S). Beyotime Biotechnology (Shanghai, China) provided the monoclonal antibody for $\beta$-actin (AA128). Green conjugated Donkey anti-mouse IgG (128-545-003) or Red conjugated Donkey anti-rabbit IgG (128-165-160) were purchased from Jackson Immuno Research (Bar Harbor, ME, USA).

In-house construction of plasmids containing VP3 (Myc-tag) was completed. The SYBR Green Pro Taq HS qPCR kit (ROX plus) (AG11718) and Pro Taq HS Premix Probe qPCR kit (AG11704) were bought from Accurate Biology (Changsha, China). Invitrogen sold Lipofectamine® 3000 (L3000008, Invitrogen, Carlsbad, CA, USA).

The Myc-VP3 plasmid was introduced into HEK293 cells through Lipofectamine® 3000 reagent following the guidelines provided by the manufacturer. Radio-Immunoprecipitation Assay Lysis Buffer (RIPA) from Solarbio (Beijing, China) was added to collected cells to prepare whole-cell extracts. Cell lysates underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and polyvinylidene fluoride (PVDF) membranes from Millipore were used for protein trans-blotting. PBS/Tween® 20-diluted skim milk (P1033, Solarbio, Beijing, China) was utilized to prevent non-specific antibody binding, and then unambiguous primary and secondary antibodies labeled with HRP were applied. Proteins were detected using an electrochemiluminescence (ECL) reagent from BioRad in the Hercules, CA, USA, with $\beta$-actin applied as the loading control.

Transfection of HEK293 cells was carried out using Lipofectamine® 3000 following the producer’s guidelines. A total of 100 50% tissue culture infectious dose (TCID${}_{50}$) EMCV was used for cell infection. Two hours later, cells were cultured with 3% NBS DMEM. Supernatants and lysates from cell-free cultures were collected 24 hours after infection to assess how VP3 impacts EMCV replication.

Real-time quantitative polymerase chain reaction (RT-qPCR) was performed for IFN-$\beta$ mRNA detection. Cellular total RNA was extracted as previously described [7]. The primer sequences of IFN-$\beta$ and GAPDH are listed as follows: IFN-$\beta$: (forward: 5${}^{\prime }$-TTGTTGAGAACCTCCTGGCT-3${}^{\prime }$, reverse: 5${}^{\prime }$-TGACTATGGTCCAGGCACAG-3${}^{\prime }$); GAPDH: (forward: 5${}^{\prime }$-GTCTCCTCTGACTTCAACAGCG-3${}^{\prime }$, reverse: 5${}^{\prime }$-ACCACCCTGTTGCTGTAGCCAA-3${}^{\prime }$).

Viral RNA was isolated using the Viral Genomic RNA Extraction kit (TIANGEN, Beijing, China) and performed as previously described [7]. The standard curve method was used to quantify EMCV genomic numbers. The 3D gene was used to design primers and probes targeted for RT-qPCR assay. The primer sequences of EMCV 3D gene and viral probe are listed as follows: 3D: (forward: 5${}^{\prime }$-GTCATACTATCGTCCAGGGACTCTAT-3${}^{\prime }$, reverse: 5${}^{\prime }$-CATCTGTACTCCACACTCTCGAATG-3${}^{\prime }$); probe: 5${}^{\prime }$-(FAM)CACTTCGATCACTATGCTTGCCGTT (Eclipse)-3${}^{\prime }$.

BHK-21 cells were used in these experiments. Five replicates of BHK-21 cells were infected with 10-fold serial dilutions of EMCV, and fresh DMEM was added after 1 h at 37 °C. The virus titers were determined after 72 h at 37 °C using the Reed–Muench method.

Cells were lysed using NP40 (Beyotime, Shanghai, China) and phenylmethylsulfonyl fluoride (PMSF; Beyotime, Shanghai, China) and then exposed to specified antibodies at 4 °C for 10 hours. Afterward, the lysates were exposed to 10 µL of protein G agarose slurry (P2053) from Beyotime in Shanghai China. Following a 4-hour incubation at 4 °C, the samples were spun at 2500 revolutions per minute (rpm) for 5 minutes. The beads were collected after being rinsed five times in ice-cold PBS. The solid was coupled with SDS loading buffer (P1040, Solarbio, Beijing, China) and heated at 95 °C for 5 minutes. After centrifugation at 6000 rpm for 1 minute, the liquid above the sediment was examined.

HEK293 cells were seeded into a 12-well cell plate. Cells were fixed with 4% paraformaldehyde at room temperature, rinsed with 1 $\times$ PBS, and permeabilized with 100% methanol before being incubated at –20 ℃ for 20 minutes. Next, the cells were treated with 2% BSA (A8020, Solarbio, Beijing, China) in 1 $\times$ PBS at room temperature for 1 hour. This was followed by exposure to specific primary antibodies (Proteintech, Wuhan, China) at 4 ℃ overnight. Following that, the cells underwent three washes with 1 $\times$ PBS-T before exposure to a suitable secondary antibody (Jackson Immuno Research, Bar Harbor, ME, USA) at an ambient temperature for 1 hour. After that, the cells were treated with 4′,6-diamidino-2-phenylindole (DAPI) at room temperature for 10 minutes. Images were taken under a Zeiss laser scanning confocal microscope (LSM 900) (Zeiss, Oberkochen, Germany), and the fluorescent intensity was read using ZEN Blue software version 3.10 (Zeiss, Oberkochen, Germany). The graph was drawn using GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA).

GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA) was used to analyze the data. Data were expressed as the mean $\pm$ standard deviation (SD) of at least three independent experiments. Asterisks indicate a significant difference (*** p 0.001, ** p 0.01, and * p 0.05).

The impact of VP3 on EMCV replication was investigated by transfecting a Myc-tagged VP3 expression plasmid into HEK293 cells (Fig. 1A), followed by EMCV infection for 24 hours. The findings indicated that VP3 overexpression notably boosted EMCV copy numbers (Fig. 1B) and titers (Fig. 1C), indicating an ability of VP3 to enhance EMCV proliferation within host cells.

Fig. 1.

VP3 overexpression promotes EMCV replication. (A) HEK293 cells were seeded in 6-well plates and transfected with Myc-VP3 (1 µg). After 24 h, samples were collected for Western blot analysis. (B,C) HEK293 cells were cultured in 6-well plates, followed by Myc-VP3 (1 µg ) or empty vector (1 µg) transfection for 24 h. Cells were infected with EMCV (100 TCID${}_{50}$) for another 24 h. RT-qPCR was performed to determine the viral copy number (B). EMCV titer was observed by TCID${}_{50}$ assay (Reed–Muench method) (C). Data were listed as the mean $\pm$ standard deviation (SD) of three independent experiments. ***, p 0.001, **, p    0.01. HEK293, human embryonic kidney 293 cells; VP3, viral protein 3; EV, empty vector; EMCV, encephalomyocarditis virus; RT-qPCR, real-time quantitative polymerase chain reaction; TCID${}_{50}$, 50% tissue culture infectious dose.

To further discuss the effect of EMCV VP3 on the type I IFN signaling cascade, we monitored the IFN-$\beta$, ISG15, and ISG56 transcription. For this purpose, HEK293 cells were transfected with VP3 or control plasmid and then treated with EMCV. Samples were collected at specified time intervals. Cellular RNA was extracted and used for RT-qPCR detection. Fig. 2 shows that mRNA levels for IFN, while IFN-related anti-virus genes were decreased in HEK293 cells with VP3 expression, demonstrating that the diminished anti-virus reaction was due to the repression of IFN-$\beta$, ISG15, and ISG56 gene expression by EMCV VP3.

Fig. 2.

VP3 inhibits EMCV-induced type I IFN signaling activation. (A) HEK293 cells were transfected with Myc-tagged VP3 plasmid (1 µg) or pCMV-Myc empty plasmid (EV, 1 µg) for 24 h and then stimulated with EMCV (100 TCID${}_{50}$) for 12 h. Cellular RNA was extracted, and the mRNA levels of IFN-$\beta$ (A), ISG15 (B), and ISG56 (C) were analyzed by RT-qPCR. Data were presented as the mean $\pm$ SD of three independent experiments. **, p   0.01. IFN-$\beta$, interferon beta; ISG15, interferon-stimulated gene 15; ISG56, interferon-stimulated gene 56; SD, standard deviation.

The structural protein VP3 of EMCV has a crucial function in inhibiting antiviral reactions, yet the specific molecular mechanism remains unknown. Host sensor molecules are known to recognize a viral infection and trigger the IFN pathway, leading to the initiation of antiviral defenses. We assessed the impact of EMCV VP3 on innate immune reactions by examining the expression levels of components associated with the IFN signaling pathway. In the case of VP3 overexpression, only the expression level of MAVS was affected, regardless of EMCV infection (Fig. 3A–C). Additionally, we investigated how VP3 impacts the transcription of IFN triggered by Polyinosinic-polycytidylic acid (poly(I:C)). Following transfection of HEK293 cells with varying amounts of the VP3 plasmid, the suppressive impact of VP3 on IFN production exhibited a correlation with dosage (Fig. 3D). These findings indicate that EMCV VP3 inhibits antiviral reactions, leading us to believe that VP3 may target MAVS signaling to suppress IFN responses.

Fig. 3.

VP3 inhibits type I IFN signaling by targeting MAVS. (A,B) HEK293 cells were transfected with pCMV-Myc (1 µg) or Myc-VP3 (1 µg) for 24 h; then cells were collected for p50, p65, I$\kappa$B$\alpha$, MDA5, MAVS, TBK1, IRF3 and Myc-tagged VP3 detection. For all experiments, $\beta$-actin served as the loading control. The grayscale protein expression analysis is displayed in the lower panel. (C) HEK293 cells were transfected with Myc-tagged VP3 (1 µg) or pCMV-Myc (1 µg) for 24 h, followed by EMCV (100 TCID${}_{50}$) infection for another 24 h. The STING, MAVS, p65, and Myc-tagged VP3 expression levels were determined. $\beta$-actin was used as the loading control. (D) HEK293 cells were transfected with pCMV-Myc (1 µg) or different concentrations of Myc-tagged VP3 plasmid (0.5 µg, 1 µg, 1.5 µg) for 24 h and stimulated with poly(I:C) (1 µg/mL) for another 12 h. Cellular RNA was extracted for IFN-$\beta$ mRNA analysis. Data are shown as the mean $\pm$ SD of three independent experiments. ***, p 0.001; ns, no significant difference. The VP3 expression was also confirmed by immune blotting. $\beta$-actin served as the loading control. I$\kappa$B$\alpha$, an inhibitor of kappa B alpha; MDA5, melanoma differentiation-associated protein 5; MAVS, mitochondrial antiviral signaling protein; TBK1, TANK-binding kinase 1; IRF3, interferon regulatory factor 3; STING, stimulator of interferon genes; SD, standard deviation; poly(I:C), Polyinosinic-polycytidylic acid.

MAVS was confirmed as the target of EMCV VP3 by co-transfecting VP3 and MAVS expression plasmids into HEK293 cells and detecting the IFN-$\beta$ mRNA levels. The findings indicated that VP3 effectively suppressed the activation of IFN-$\beta$ by MAVS, suggesting that MAVS is the specific target of VP3, as demonstrated in Fig. 4A. The protein level alterations additionally validated that VP3 successfully suppressed the MAVS expression in a dosage-dependent manner (Fig. 4B).

Fig. 4.

MAVS is the target molecule of EMCV VP3. (A) HEK293 cells were co-transfected with HA-MAVS (500 ng) and Myc-VP3 (1 µg) for 24 h; HA-MAVS (500 ng) and pCMV-Myc (1 µg) were transfected as the positive control. Then, cells were collected, and Myc-tagged VP3 and HA-tagged MAVS protein expression was assessed. $\beta$-actin served as the loading control. RT-qPCR detected the IFN-$\beta$ mRNA level. Data are shown as the mean $\pm$ SD of three independent experiments. ***, p 0.001. (B) HEK293 cells were transfected with pCMV-Myc (1 µg) or different concentrations of Myc-tagged VP3 expression plasmids (0.5 µg, 1 µg, 1.5 µg). Cellular proteins were extracted 24 h post-transfection for MAVS and VP3 expression detection. $\beta$-actin served as the loading control. MAVS, mitochondrial antiviral signaling protein; SD, standard deviation.

Based on previous findings indicating the role of VP3 in MAVS degradation, we hypothesized a potential interaction between VP3 and MAVS. As anticipated, an interaction was detected in HEK293 cells between EMCV VP3 and endogenous MAVS. Following immunoprecipitation using an anti-MAVS antibody, VP3 can be detected by an anti-Myc antibody (Fig. 5A). Subsequently, after immunoprecipitation with an anti-Myc antibody, MAVS was identified via Western blotting (Fig. 5B). Furthermore, we verified the co-localization of VP3 and MAVS using confocal microscopy (Fig. 5C).

Fig. 5.

VP3 interacts with MAVS. (A,B) MAVS and VP3 immunoprecipitation (IP) assay. All these experiments were performed in HEK293 cells transfected with Myc-VP3 (1 µg) or pCMV-Myc empty vector (EV, 1 µg). An anti-MAVS or anti-Myc antibody was incubated with protein G agarose, and IgG was used as the control. Input and IP complexes were analyzed using Western blotting. (C) Confocal laser scanning microscopy images of VP3 (anti-Myc (red)) and MAVS (anti-MAVS (green)). Nuclei were stained with DAPI (blue). Scale bars = 10 µm. MAVS, mitochondrial antiviral signaling protein; DAPI, 4′,6-diamidino-2-phenylindole.

Various degradation pathway inhibitors were introduced to the cultured cells transfected with VP3 to determine the specific pathway involved in EMCV infection. Fig. 6A–C demonstrates that the presence of chloroquine (CQ), an autophagy–lysosomal pathway inhibitor, resulted in a notable increase in MAVS expression. In contrast, the presence of MG132, an inhibitor of the ubiquitin–proteasome pathway, did not lead to a noticeable improvement in MAVS expression. However, Z-VAD-FMK-treated cells also rescued the MAVS expression. Then, we used caspase 3 (Ac-DEVD-CHO), caspase 8 (Z-IETD-FMK), and caspase 9 inhibitors (Z-LEHD-FMK TFA) to treat cells with VP3 overexpression. Results showed that VP3-mediated MAVS degradation was rescued by caspases 3 and 8 (Fig. 6D–F). These data showed that the EMCV VP3 protein promotes the breakdown of MAVS through an autophagic process and caspase-dependent manner.

Fig. 6.

VP3 promotes MAVS degradation via autophagy. MAVS degradation pathway screening was performed in HEK293 cells transfected with Myc-VP3 (1 µg) or pCMV-Myc (1 µg). Proteasomal inhibitor MG132 (7.5 µM) (A), autophagy–lysosomal inhibitor CQ (50 µM) (B), caspase inhibitor Z-VAD-FMK (50 µM) (C), caspase 3 inhibitor Ac-DEVD-CHO (20 nM) (D), caspase 8 inhibitor Z-IETD-FMK (20 nM) (E) or caspase 9 inhibitor Z-LEHD-FMK TFA (20 nM) (F) were used to treat related cells. MAVS and Myc-tagged VP3 expressions were detected. $\beta$-actin served as the loading control. (G) Confocal laser scanning microscopy images of VP3 (anti-Myc (red)) and LC3 (anti-LC3 (green)) in A549 cells. Nuclei were stained with DAPI (blue). Scale bars = 10 µm. (H) Confocal laser scanning microscopy images of VP3 (anti-Myc (red)) and p62 (anti-p62 (green)) in A549 cells. Nuclei were stained with DAPI (blue). Scale bars = 10 µm. (I–J) p62 and VP3 immunoprecipitation (IP) assay were conducted in HEK293 cells. Antibodies specific to Myc, p62, NDP52, Tollip, or $\beta$-actin were used for input and IP complexes analyses. (K) p62 siRNA was transfected into Myc-VP3 (1 µg) or pCMV-Myc (1 µg) overexpression HEK293 cells. Cells were lysed for MAVS, p62, and Myc-tagged VP3 detection. $\beta$-actin served as the control. ***, p 0.001. DMSO, dimethyl sulfoxide; LC3, microtubule-associated protein 1 light chain 3; CQ, chloroquine; DAPI, 4′,6-diamidino-2-phenylindole.

The transformation of soluble microtubule-associated protein 1 light chain 3 (LC3) to membrane-bound LC3 plays a crucial role in autophagy. LC3, which is attached to the membrane, regulates various important functions within autophagy, such as the development and enlargement of the phagophore, the gathering of materials, and the merging of autophagosomes with lysosomes [21]. Confocal microscopy analysis was performed to verify the expression of LC3 and investigate if VP3 promotes autophagy. As shown in Fig. 6G, the expression of LC3 in VP3-transfected cells transferred from the cytoplasm to the perikaryon and exhibited punctate distribution compared to the control group, implying the formation of autophagosomes. Further, confocal images also directly revealed the obvious co-localization between VP3 and LC3.

In addition to LC3, autophagy can be monitored by assessing p62 levels. p62 is specifically included in autophagosomes by directly binding to LC3 and is effectively broken down by autophagy, leading to an inverse relationship between the overall cellular levels of p62 and autophagic activity. The p62 protein level notably decreases when VP3 is transfected compared to the control group (Fig. 6H). Subsequently, an interaction between VP3 and p62 was identified through immunoprecipitation tests (Fig. 6I,J). Furthermore, siRNA knockdown of p62 alleviated the inhibitory effect of VP3 on MAVS (Fig. 6K). The above data showed that VP3 triggers MAVS autophagic degradation through the p62-mediated autophagy pathway.