Academic Editor

Article Metrics

  • Fig. 1.

    View in Article
    Full Image
  • Fig. 2.

    View in Article
    Full Image
  • Fig. 3.

    View in Article
    Full Image
  • Fig. 4.

    View in Article
    Full Image
  • Fig. 5.

    View in Article
    Full Image
  • Fig. 6.

    View in Article
    Full Image
  • Information

  • Download

  • Contents

Abstract

Background: Diabetic nephropathy (DN) is a common microvascular complication of diabetes mellitus (DM). Ferroptosis is an atypical form of iron-dependent, modulated cell death that has been shown to occur in human umbilical vein endothelial cells (HUVECs). Leonurine (LEO) is a single active ingredient extracted from Leonurus japonicus Houtt. It has various biological activities, including anti-inflammatory and anti-cancer effects. However, whether LEO affects ferroptosis in DN has yet to be investigated. Methods: An animal model of DN was established by subjecting C57/BL6 mice to a high-fat diet (HFD) while being induced with Streptozotocin (STZ). A cellular model of DN was established by exposing HUVECs to a high glucose (HG) concentration of 30 mM. Results: LEO was found to improve DN and to attenuate the degree of glomerulosclerosis and tubular atrophy in the mouse model. Additionally, it markedly decreased the levels of ferroptosis markers. Molecular analyses revealed that LEO inhibited HG-induced oxidative stress in HUVECs, thereby decreasing endothelial cell (EC) dysfunction. Furthermore, LEO was found to reduce ferroptosis and reverse EC dysfunction by increasing the expression of glutathione peroxidase 4 (GPX4) and nuclear factor erythroid 2-related factor 2 (Nrf2). The suppression of Nrf2 in HG-induced HUVECs inhibited LEO-GPX4 axis-mediated ferroptosis and increased EC dysfunction. Conclusions: LEO exerts anti-DN effects both in vivo and in vitro by suppressing GPX4-mediated EC ferroptosis. Mechanistically, LEO appears to induce Nrf2-mediated GPX4 expression to inhibit ferroptosis, thereby reducing EC dysfunction. This study provides a new perspective on the treatment of diseases using natural medicines. It involves a novel form of cell death that could potentially lead to better treatment of DN.

Graphical Abstract

1. Introduction

Diabetic nephropathy (DN) represents one of the most common microvascular complications and a leading causes of end-stage renal disease (ESRD). Approximately 30% to 40% of patients with diabetes show DN [1]. Long-term metabolic disorders and persistent hyperglycemia can lead to progressive kidney impairment, resulting invarious complications [2]. Notably, the combination of hyperglycemia and insulin resistance [3] induces microvascular complications. Hyperglycemia is the main etiological factor in the development of diabetic kidney disease [4]. Although current treatments such as renin-angiotensin system (RAS) blockade, vitamin D receptor activators, incretin-related drugs, and target inflammation therapies of diabetic nephropathy to a certain extent, they are unable to stop the development of end-stage renal disease [5]. Microvascular endothelial cells (ECs) are believed to be the primary target of hyperglycemic damage [4]. During hyperglycemia, damaged ECs impair the vascular endothelium through several pathophysiological mechanisms, including exocytosis, podocyte/fenestrated EC extracellular matrix crosstalk, and inflammatory responses [6]. The pathophysiology of DN is multifactorial, with EC death playing a crucial role in its onset and progression. Although current treatments can delay the development of DN, they do not protect against progression to ESRD. Therefore, there is an imperative for further research into the targeting endothelial cells to improve DN.

Ferroptosis, a newly named mode of programmed cell death in 2012, differs from existing apoptosis, autophagy, and necrotic apoptosis, among others, in that ferroptosis is driven by iron-dependent lipid peroxidation of unsaturated fatty acids, especially phospholipids, on cell membranes. Ferroptosis is regulated by the system Xc--glutathione (GSH)–glutathione peroxidase 4 (GPX4) metabolic pathway, which is a cellular anti-oxidative defense system [7]. Extracellular cystine imported by system Xc- is subsequently reduced to cysteine and used to synthesize glutathione (GSH), an essential cofactor for the antioxidant enzyme GPX4 in the detoxification of lipid hydroperoxides [8]. As the activity of GPX4 diminishes, GSH synthesis is reduced. This triggers increased production of lethal reactive oxygen species (ROS) and phospholipid peroxides, as well as intracellular accumulation of ferrous ions, leading to the onset of cellular ferroptosis. It was recently reported that lack of GPX4 was associated with a significantly higher risk of developing ESRD [9]. Accumulating evidence also shows that ferroptosis has key pathophysiological functions in kidney injury, glomerular injury [10], and tubular necrosis [11]. Intervention against the ferroptosis of glomerular or tubular cells may be an effective treatment for DN.

Traditional Chinese medicine is widely used to treat diabetes and its complications. Leonurine (LEO) is a natural chemical compound extracted from the traditional Chinese herbal medicine Herba Leonuri [12]. The strong anti-inflammatory [13] and antioxidant [14] effects of LEO have been extensively demonstrated. This agent can reduce the damage caused by excessive ROS in many diseases, including cardiovascular diseases [15], ischemic stroke [16], and atherosclerosis [17]. However, the possible effects of LEO in diabetes-induced DN and the underlying mechanisms remain unknown.

In light of the above described data, the goal of this investigation was to examine how LEO affects ferroptosis in DN. To validate our hypothesis, we used high glucose (HG)-induced human umbilical vein endothelial cells (HUVEC) and diabetic mice models for in vivo and in vitro experiments, respectively. Our study found that LEO inhibited ferroptosis in glomerular endothelial cells of DN mice and improved the DN process. And in vitro experiments, LEO protects HUVECs against HG-induced endothelial cell dysfunction and oxidative stress. Additionally LEO inhibited ferroptosis and reduced lipid peroxidation in HUVECs. Mechanistically, we found that the inhibition of ferroptosis in HUVEC by LEO was through nuclear factor erythroid 2-related factor 2 (Nrf2)-GPX4 axis mediated effects. Our findings provided a therapeutic strategy depended on ferroptosis to reduce kidney damage in DN.

2. Metarials and Methods
2.1 Drugs and Reagents

The reagents that were utilized were leonurine (20220301, Xinxiang Olan Biotechnology Co., Ltd, Shijiazhuang, Hebei, China), Fer-1 (HY-100579, MedChemExpress, Rahway, NJ, USA), and fetal bovine serum (M1043150S, BBI Solutions, south Wales, UK).

2.2 Mice and Treatments

There are three treatment groups overall as a result of the randomized animal division. Allpro cedures were conducted under protocols approved by the Institutional Animal Care and Use Committee of Guilin Medical University. (Approved No. GLMC202105049). C57BL/6J mice, aged four weeks, were procured from Cavens Biotechnology Co., Ltd. (Nanjing, China) (SCXK2021-0013) and housed in a dedicated pathogen-free facility with a relative humidity of 55 ± 5%, room temperature of 22 ± 2 °C, and a 12 h light/dark cycle. Three groups of mice: (1) control group (control; n = 5), (2) Streptozotocin (STZ) intraperitoneally injected mice treated with vehicle (STZ; n = 10), and (3) STZ intraperitoneally injected mice treated with LEO at 60 mg/kg (LEO; n = 10). Diabetes mellitus was induced in mice at 6 weeks of age (weight 18–20 g) by 5 consecutive days of intraperitoneal (IP) injection of STZ at a dose of 50 mg/kg dissolved in 100 mM citrate buffer (pH 4.5). This caused the mice to develop diabetes. Five control mice received the same volume of citrate buffer. After continuing two weeks fed with high-fat diet, blood was measured glucose using a Glucometer. Ten mice were deemed diabetic if their fasting blood glucose level was greater than 12 mmol/L. The onset of frank diabetes was followed by the start of LEO treatment (60 mg/kg). Diabetic mice were treated with LEO (60 mg/kg) by gavage 12 weeks (n = 5 in each group). Urine and blood samples were collected at 12 weeks post-treatment, at which time all mice were sacrificed. Mice were anesthetized using an isoflurane inhalation mask (Lunan Better Pharmaceutical Co. Ltd., H20020267#, Shandong, China) from an anesthesia machine (Shenzhen Ruiwode Life Technology Co., Ltd, China). Isoflurane was administered at a concentration of 1.6%, with an oxygen flow rate of 1.2 L/min. Following anesthesia, kidney tissues were collected for further analysis.

2.3 Cell Culture and Treatment

Human HUVECs (Chinese Academy of Sciences, Shanghai, China) were grown in DMEM supplemented with 10% fetal bovine serum (FBS), and penicillin/streptomycin (100 U/mL). We established cellular model of DN by treating HUVECs with HG at a concentration of 30 mM for 24 h in a 37 °C humidified incubator. Cells were co-treated with LEO at a concentration of 40 µM and HG at 30 mM as a treatment group. The cells were incubated in a cell culture incubator with 5% CO2 and 37 °C. All cell lines were validated by STR profiling and tested negative for mycoplasma. Using lipofectamine 3000 TM regent (Invitrogen, Carlsbad, CA, USA), HUVECs cells were transfected with GPX4 siRNA or a negative control after 24 hours, after which they were exposed to HG and LEO in order to investigate the function of GPX4.

2.4 Cell Viability Assay

Cell viability was evaluated using the Cell Counting Kit-8 assay kit (Beyotime, Songjiang, Shanghai, China) as recommended by the manufacturer. Cells were grown in 96-well plates for 24 h. They were then treated with HG at concentrations of 10, 20, 30, 40, 50, or 60 µM, and subsequently with LEO at doses of 5, 10, 20, 40, 80, or 100 µM. Following the appropriate treatment, cell counting kit-8 (CCK8) detection reagent was added and allowed to incubate for two hours before reading the absorbance at 450 nm with a microplate reader.

2.5 JC-1 Detection

Using 5,5′,6,6′-Tetrachloro-1,1′,3,3′-tetraethylimidacarbocyanine (JC-1) fluorochrome (C2006, Beyotime), to detect mitochondrial membrane potential (MMP) in HUVEC under different treatment conditions. HUVECs were seeded at 10 × 104/well in 24-well plates, rinsed twice with PBS, then incubated with 5 µM JC-1 for 30 min away from light at 37 °C. The cells were then washed gently three times with JC-1 staining buffer, in that order. Lastly, an inverted fluorescence microscope was used to quantify fluorescence. The Image J program (version 1.48; National Institute of Health, Bethesda, MD, USA) was used to quantify the intensity of the cellular fluorescence.

2.6 Western Blot Analysis

Protein concentrations were measured using a bicinchoninic acid assay (BCA) protein assay kit (CWBIO, Beijing, China). Proteins (20 µg per lane) were loaded onto an 8% sodium dodecyl sulfate (SDS)-polyacrylamide electrophoresis gel (Solarbio Co., Beijing, China) and separated by running at 80 V for 30 min and then 120 V for 1 h. The proteins were subsequently transferred onto a 0.45 µM polyvinylidene fluoride membrane (PVDF, Merck Millipore, Darmstadt, Germany). The PVDF membranes were blocked using QuickBlock™ (P0252, Beyotime Biotechnology) for 30 min at room temperature, and then incubated overnight at 4 °C with gentle shaking with a 1:1000-dilution of specific primary antibody. The antibodies used were as follows: anti-GAPDH (60004, Proteintech, Wuhan, Hubei, China), anti-GPX4 (6773-1-lg, Proteintech, Wuhan, Hubei, China), anti-FTH (DF6278, Affinity, Liyang, Jiangsu, China), anti-FTL (10727-1-AP, Proteintech, Wuhan, Hubei, China), anti-CD31 (AF3628, R&D, Minneapolis, MN, USA), and anti-VE-cadherin (sc-9989, Santacruz, Pudong New Area, Shanghai, China).

2.7 RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

Total RNA was isolated from aortic tissues or cells using TRIzol reagent (15596026, Invitrogen, Carlsbad, CA, USA) and reverse-transcribed into cDNA with StarScript II RT Mix and gDNA Remover (A224-10, Genstar, Changping, Beijing, China). Real-time PCR analysis was performed using 2×RealStar Fast SYBR qPCR Mix (A304, Genstar, Changping, Beijing, China). RT-qPCR was performed on cDNA using the CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA). β-actin expression was used to normalize relative mRNA expression, which was ascertained using the 2-ΔΔCT method. The primer sequences are listed in Table 1.

Table 1.Primer for quantitative real-time PCR.
Gene Species Sequence for primers
TGF-β1 Human Forward: GGCCAGATCCTGTCCAAGC
Reverse: GTGGGTTTCCACCATTAGCAC
CD31 Human Forward: AACAGTGTTGACATGAAGAGCC
Reverse: TGTAAAACAGCACGTCATCCTT
CD44 Human Forward: CTGCCGCTTTGCAGGTGTA
Reverse: CATTGTGGGCAAGGTGCTATT
TNF-α Human Forward: CCTCTCTCTAATCAGCCCTCTG
Reverse: GAGGACCTGGGAGTAGATGAG
IL-6 Human Forward: ACTCACCTCTTCAGAACGAATTG
Reverse: CCATCTTTGGAAGGTTCAGGTTG
MCP-1 Human Forward: CAGCCAGATGCAATCAATGCC
Reverse: TGGAATCCTGAACCCACTTCT
GPX4 Human Forward: GAGGCAAGACCGAAGTAAACTAC
Reverse: CCGAACTGGTTACACGGGAA
FTH-1 Human Forward: CCCCCATTTGTGTGACTTCAT
Reverse: GCCCGAGGCTTAGCTTTCATT
SLC40A1 Human Forward: CTACTTGGGGAGATCGGATGT
Reverse: CTGGGCCACTTTAAGTCTAGC
SLC11A2 Human Forward: TGGAGATCATGGGGAGTCTG
Reverse: AAGAAAACCTGGTCCGGTGAA
GAPDH Human Forward: GCACAGTCAAGGCCGAGAAT
Reverse: GCCTTCTCCATGGTGGTGAA
Gpx4 Mouse Forward: TGTGCATCCCGCGATGATT
Reverse: CCCTGTACTTATCCAGGCAGA
Tgf-β1 Mouse Forward: TGGAGCAACATGTGGAACTC
Reverse: CGTCAAAAGACAGCCACTCA
Tnf-α Mouse Forward: CAGGCGGTGCCTATGTCTC
Reverse: CGATCACCCCGAAGTTCAGTAG
Cd31 Mouse Forward: ACGCTGGTGCTCTATGCAAG
Reverse: TCAGTTGCTGCCCATTCATCA
Cd44 Mouse Forward: TCGATTTGAATGTAACCTGCCG
Reverse: CAGTCCGGGAGATACTGTAGC
Slc39a14 Mouse Forward: GAGTGGGCCGGGATAATGTTT
Reverse: GAGATCGCTCGCTCAAGTTGT
Slc40a1 Mouse Forward: TGGAACTCTATGGAAACAGCCT
Reverse: TGGCATTCTTATCCACCCAGT
Fth-1 Mouse Forward: CAAGTGCGCCAGAACTACCA
Reverse: ACAGATAGACGTAGGAGGCATAC
Gapdh Mouse Forward: AGGTCGGTGTGAACGGATTTG
Reverse: GGGGTCGTTGATGGCAACA

PCR, Polymerase chain reaction; TGF-β1, transforming growth factor-β1; CD31, platelet endothelial cell adhesion molecule 1; CD44, standard CD44; TNF-α, tumour necrosis factor-alpha; IL-6, Interleukin 6; MCP-1, monocyte chemoattractant protein 1; GPX4, Glutathione peroxidase 4; FTH-1, Ferritin Heavy Chain 1; SLC40A1, Solute Carrier Family 40 Member 1; SLC11A2, solute carrier family 11 member 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

2.8 HE & Masson Staining

The kidneys from mice were dissected and fixed in formalin. Mouse kidneys were dissected and embedded in optimal cutting temperature compound (Sakura Tissue-Tek, Torrance, CA, USA). Sections (5 µM thickness) of mouse glomerulus were cut using a Leica CM3050 S Research Cryostat (Leica, Weizler, Hesse, Germany). Mouse kidneys underwent Masson staining to identify the area and extent of the lesion respectively, while hematoxylin-eosin staining (HE) staining was used to identify glomerulosclerosis. En face images of the glomerulus were captured using a digital camera and analyzed using ImageJ software (win64, National Institutes of Health, Bethesda, MD, USA).

2.9 Immunofluorescence Staining of Cells and Tissues

After fixing the cells and frozen sections with 4% paraformaldehyde, the antigen was extracted using Quick Antigen Retrieval Solution for Frozen Sections (P0090, Beyotime). The cells were then blocked with 5% QuickBlockTM Blocking Buffer (P0260, Beyotime) at room temperature for an hour, and primary antibodies were incubated at 4 °C for an overnight period. Following a PBS wash, the samples were incubated for two hours at room temperature in the dark with Alexa Flour 488 or 594 secondary antibodies. The stain used on nuclei was DAPI (28718-90-3, Solarbio Co.). Finally, an anti-fluorescence quencher (S2100, Solarbio Co.) was used to seal and mount the sections.

2.10 Measurement of Iron, Malondialdehyde (MDA) and Glutathione (GSH)

The levels of iron, MDA and GSH in the glomerulus of mice were determined using the corresponding kits (Abcam, Pudong New Area, Shanghai, China) according to the manufacturer’s instructions. The iron, GSH, and MDA levels in HUVECs were determined using colorimetry. GSH and MDA in the glomeruli of mice and in HUVECs were reacted with kit reagents to determine the absorbance of the sample. The sample levels were then determined by comparison with the standard.

2.11 Cell scratch Assay

In 6-well plates, 5 × 105 cells were planted per well, and the HUVECs were grown for 24 hours. Once the cells were treated as described above, a 200 µL sterile micropipette tip was used to scuff the middle of each well’s cell layer. Following three PBS washes, the cells were cultivated on an FBS-free medium. The independent field photos of each group were randomly gathered under an Olympus bright field microscope at 0 and 24 hours after the scrape. Using ImageJ software, the scratch width was objectively measured.

2.12 Lillie’s Ferrous Iron Staining

The samples were embedded in paraffin and treated with 4% paraformaldehyde. The sections had a thickness of 9 µM. Using Lillie staining (Solarbio Co.), variations in ferrous iron levels in tissues were identified. Following deparaffinization, the tissue sections were soaked for 27 min in Lillie staining solution and then 5 min in deionized water. Then nuclear fast red stained solution for 7 min, finally dehydrated and transparented with anhydrous ethanol and sealed with neutral gum. Images were captured using a fluorescence microscope (BS.3153-PLi, Handelsen, Hamburg, Germany).

2.13 Evaluation of ROS

As directed by the manufacturer, DCFH-DA (Beyotime Biotechnology, Shanghai, China) examined the reactive oxygen species levels of HUVECs. Following the seeding of HUVECs cells into 24-well plates, fluorescent probes were added and diluted 1:1000 using serum-free media. The cells were then incubated for 20 min at 37 °C in a cell culture incubator. After three rounds of serum-free DMEM washing, the cells were examined under a fluorescence microscope. The Image J program was used to quantify the intensity of the cellular fluorescence.

2.14 Statistical Analysis

Results are presented as the mean ± SEM. Statistical analysis was performed using GraphPad prism 9.0 software (9.0, GraphPad Software, San Diego, CA, USA). Two-tailed unpaired Student’s t test was used to compare groups that followed a normal distribution. For comparison of three or more groups, one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test was performed. A p-value < 0.05 was selected as the threshold for statistical significance. All experiments were performed at least three times.

3. Results
3.1 LEO Attenuates Kidney Injury in STZ-Induced DN Mice

The therapeutic effect of LEO on DN was investigated in a mouse model of type 2 diabetes mellitus (T2DM) established by IP injection of STZ (50 mg/kg). Blood glucose levels were higher in both STZ and STZ+LEO (60 mg/kg) mice than in the control group (no STZ injection). Oral glucose tolerance tests (OGTT) revealed that mice administered STZ or STZ+LEO had reduced glucose tolerance, as evidenced by a faster rise in blood glucose, higher 30-min blood glucose values, and a slower decrease in blood glucose compared to the control group. These results indicate successful establishment of a mouse model of T2DM (Fig. 1A). After 12 weeks, STZ-induced DN mice showed significantly increased albuminuria, but this was attenuated by treatment with LEO (Fig. 1B). Serum creatinine and blood urea nitrogen (BUN) levels were markedly decreased by LEO treatment (Fig. 1C,D). HE staining revealed that LEO mitigated the extent of glomerulosclerosis and tubular atrophy in STZ-induced DN mice (Fig. 1C). Masson’s trichrome staining also showed that LEO alleviated renal interstitial fibrosis in these mice (Fig. 1E). Expression of the inflammatory factor tumor necrosis factor-α (TNF-α) and of the renal fibrosis-related factor transforming growth factor-β (TGF-β) were evaluated in the kidneys of STZ-induced DN mice. qPCR results showed that LEO treatment reversed the elevated expression levels of TNF-α and TGF-β observed in the T2DM mouse model (Fig. 1F). Taken together, these results indicate that LEO may be beneficial for the treatment of pathological lesions typical of DN in T2DM mice.

Fig. 1.

LEO treatment exerts protective effects against renal damage in DN mice. (A) Fasting blood glucose and OGTT. (B–D) Levels of blood urea nitrogen (BUN), serum creatinine and urinary albumin in renal tissues were evaluated using the corresponding kits. (E) HE and Masson staining of kidney sections. Scale bar: 25 µm. (F) The mRNA expression of TNF-α and TGF-β1 was determined by RT-qPCR. Values shown are the mean ± SD. *p < 0.05, **p < 0.01 vs. control. LEO, Leonurine; DN, Diabetic nephropathy; OGTT, Oral glucose tolerance tests; HE, Haematoxylin & Eosin; TNF-α, Tumor Necrosis Factor-alpha; TGF-β1, transforming growth factor-β1; RT-qPCR, Quantitative reverse transcription polymerase chain reaction; SD, standard deviation.

3.2 LEO Treatment Mitigated Ferroptosis in STZ-Induced DN Mice

Ferroptosis plays a crucial role in the onset and progression of DN, with GPX4, ferritin light chain (FTL) and and recombinant ferritin, heavy polypeptide (FTH) being central regulators of this process. Treatment with LEO significantly restored GPX4, FTL and FTH protein levels in ECs (Fig. 2A). Additionally, the mRNA levels of GPX4, FTH-1 and SLC40A1 were lower in mice with DN, while that of SLC39A14 was increased. However, these levels were restored by LEO (Fig. 2B). We next determined the iron content in kidney tissues using the corresponding kit. As shown in Fig. 2C, the iron level was notably increased in the DN group, but decreased in the LEO group. The GSH content was lower in the DN group. However, after LEO administration, the MDA content was markedly reduced and the GSH level increased, indicating the suppression of lipid peroxidation by LEO in DN mice (Fig. 2C–E). To further validate the inhibitory effect of LEO on ferroptosis in the DN model, another index of ferroptosis, Lillie’s ferrous iron stain, was also investigated. Thisrevealed that STZ-induced DN resulted in kidney iron deposition, and that LEO could reverse this iron accumulation in the glomerulus (Fig. 2F). Furthermore, LEO treatment increased the expression of endothelial and ferroptosis markers in DN. Decreased expression of GPX4, FTL and FTH was observed in glomerular vascular ECs (Fig. 2G). LEO treatment promoted VE-cadherin and CD31 protein expression tomarkedly higher levels than observed in the STZ-induced DM group (Fig. 2I). RT-qPCR also showed that LEO treatment significantly restored the expressionof Cd31 and Cd44 (Fig. 2H). Collectively, these results indicate that LEO exerts a protective effect by inhibiting ferroptosis in mice with DN. LEO therefore appears to protect against HG-induced dysfunction and oxidative stress in ECs.

Fig. 2.

LEO treatment reduces ferroptosis and endothelial dysfunction in DN mice. (A) Protein expression of GPX4, ferritin light chain (FTL) and recombinant ferritin, heavy polypeptide (FTH) was determined by Western blot. (B) mRNA expression of Fth-1, Gpx4, Slc39a14 and Slc40a1 was determined by RT-qPCR. (C–E) Iron, glutathione (GSH) and malondialdehyde (MDA) levels in renal tissue were determined using the appropriate assay kit. (F) Results of Prussian blue (ferric) and Lillie dye (ferrous) staining in the mouse renal glomerulus in each group. The arrow points to stained ferrous iron. Scale bar: 25 µm. (G) Sections of renal glomerulus were co-stained for cluster of differentiation 31 (Cd31) (green) and Gpx4 (red), FTH (red) or FTL (red). Scale bar: 20 µm. (H) The mRNA expression of Cd31 and Cd44 molecule (Indian blood group) was determined by RT-qPCR. (I) Protein expression of CD31 and VE-cadherin was determined by Western blot. Values shown are the mean ± SD. *p < 0.05, **p < 0.01 vs. control.

3.3 LEO Protects HUVECs against HG-Induced EC Dysfunction and Oxidative Stress

To further explore protective role of LEO in ECs and to elucidate the underlying mechanism, the effects of varying doses of high hyperglycemia (HG) on HUVEC were assessed by measuring cell viability using the CCK8 assay. The CCK8 data demonstrated a significant decrease in cell viability at HG concentrations greater than 30 mM (Fig. 3A). After that, HUVEC were exposed to escalating LEO doses, and the viability of the cells was evaluated. Cell viability was significantly decreased at 80 µM of LEO and higher, as shown in (Fig. 3B). Subsequent experiments were therefore performed using 40 µM LEO. To investigate the protective effect of 40 µM LEO on HUVECs, MDA and GSH levels were evaluated to determine lipid peroxidation. LEO inhibited MDA production and increased the level of antioxidant GSH in HUVECs under oxidative stress (Fig. 3C,D). Intracellular ROS generation was evaluated using the 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) probe. Exposure to 30 mM HG led to excessive accumulation of ROS, whereas LEO treatment reduced ROS levels (Fig. 3E). Hence, LEO appears to exert a protective effect against HG-induced oxidative stress in HUVECs. In addition, Western blot results showed that HG reduced the expression levels of cluster of differentiation 31 (CD31) and VE-cadherin in HUVECs, whereas LEO restored their expression (Fig. 3F). Furthermore, the scratch assay showed that HG reduced cell migration, but this was enhanced by treatment with LEO (Fig. 3G). The above results suggest that HG increases EC damage and oxidative stress, whereas LEO protects HUVEC endothelial function.

Fig. 3.

LEO protects human umbilical vein endothelial cells (HUVECs) against HG-induced toxicity and dysfunction. (A,B) The cell viability of HUVEC cells treated with different high glucose (HG) or LEO concentrations was determined using the cell counting kit-8 (CCK8) assay. (C,D) The level of GSH and MDA in HUVECs was determined using the corresponding kit. (E) Reactive oxygen species (ROS) staining and fluorescence intensity in the control, HG, and HG+LEO groups. Scale bar: 100 µm. (F) Protein expression of CD31 and vascular endothelial (VE)-cadherin was determined by Western blot. (G) The migration of HUVECs was evaluated with the scratch assay. Scale bar: 500 µm. Values shown are the mean ± SD. *p < 0.05, **p < 0.01 vs. control.

3.4 LEO Inhibits HUVEC Ferroptosis to Protect against HG-Induced EC Dysfunction

We next examined whether LEO could restore EC function by reducing HG-induced deposition of ferritin. Fer-1 is a typical ferroptosis inhibitor and has been used to inhibit ferroptosis by attenuating lipid peroxidation and endothelial dysfunction in ECs [18]. HUVECs were treated for 24 h with HG (30 mM), HG+LEO (40 µM), or ferroptosis inhibitor HG+Fer-1 (2 µM). Similar to Fer-1, LEO inhibited HG-mediated ferroptosis. Representative microscopy and Western blot images show the rescue of GPX4, FTL and FTH protein expression by LEO and Fer-1 (Fig. 4A,B). Following induction by HG, iron accumulation was also observed in HUVECs (Fig. 4C). However, this HG-induced deposition of iron was significantly reduced by LEO. Ferroptosis is often accompanied by excessive intracellular lipid peroxidation, with MDA being the end product of lipid peroxidation. The MDA level was significantly higher in the HG group than in the control group, indicating that HG increased the cellular level of lipid ROS (Fig. 4D). The production of MDA induced by HG was significantly reduced by treatment with LEO and Fer-1. GSH is a crucial defence mechanism against lipid peroxidation and ferroptosis, and was also found to be lower in the HG group (Fig. 4E). However, the GSH level was effectively restored by treatment with LEO and Fer-1, and ferroptosis was inhibited (Fig. 4D). Moreover, LEO and Fer-1 reversed the decrease in GPX4, FTH1 and SLC40A1 expression induced by HG, and increased SLC11A2 expression (Fig. 4F). In actuality, ferroptosis is linked to serious impairments in the metabolism, bioenergetics, and morphology of the mitochondria. In the present study, HG treatment of HUVECs decreased the mitochondrial membrane potential (MMP) (Fig. 4G), leading to mitochondrial damage. Moreover, the HG-induced reduction in MMP was attenuated by LEO and Fer-1, indicating they have protective functions in mitochondria. HUVECs were treated with LEO and Fer-1 to further explore whether LEO repairs endothelial dysfunction via ferroptosis. As expected, this restored the mRNA levels of CD31, CD44, VE-cadherin and TGF-β in HG-treated HUVECs (Fig. 4I). The expression levels of the EC function markers CD31 and VE-cadherin were also increased by LEO and Fer-1 (Fig. 4H). In addition, LEO and Fer-1 promoted HUVEC migration, as shown by cell scratch experiments (Fig. 4J). These results suggest that LEO restores endothelial dysfunction via ferroptosis.

Fig. 4.

LEO suppresses HG-induced ferroptosis in HUVECs. (A) Protein expression of GPX4, FTH and FTL was determined by Western blot. (B) Expression of GPX4 (red), FTH (green) and FTL (green) proteins was detected by immunofluorescence (IF). Nuclei were stained with DAPI (blue) in HG-induced HUVECs treated with or without LEO. Scale bar: 100 µm. (C–E) The level of iron, GSH and MDA in HUVECs was determined using the corresponding kit. (F) The mRNA expression of FTH-1, GPX4, SLC11A2 and SLC40A1 was determined by RT-qPCR. (G) JC-1 staining and the fluorescence ratio of mitochondrial membrane potential (MMP) in the control, HG, and HG+LEO groups. Scale bar: 200 µm. (H) Protein expression of CD31 and VE-cadherin was determined by Western blot. (I) The mRNA expression of CD31, VE-cadherin, TGF-β and CD44 was determined by RT-qPCR. (J) The migration of HUVECs was evaluated with the scratch assay. Scale bar: 500 µm. Values shown are the mean ± SD. ns, no significance. *p < 0.05, **p < 0.01 vs. control.

3.5 The Anti-Ferroptosis Activity of LEO is Partly Dependent on GPX4

Lipid peroxide is produced in significant quantities when GPX4 activity is suppressed, and this is thought to be an important factor in preventing ferroptosis. We next studied the mechanism by which LEO protects HG-induced HUVECs against ferroptosis. HUVECs were first transfected with specific GPX4 siRNA. The knockdown of GPX4 expression was demonstrated by immunofluorescence (IF) (Fig. 5A). Intriguingly, silencing of GPX4 blocked the inhibitory effect of LEO on HG-induced ferroptosis, decreased the generation of GSH, and increased the iron content in HUVECs (Fig 5B,C). LEO reduced the HG-induced accumulation of lipid peroxide MDA, but this was abolished by transfection with si-GPX4 (Fig. 5D). GPX4 silencing also partially abrogated the effects of LEO on the protein expression of markers for vascular endothelial dysfunction (CD31 and VE-cadherin) (Fig. 5E). Knockdown of GPX4 also abrogated the increase in MMP caused by LEO treatment of HG-treated HUVECs (Fig. 5F). The mRNA levels of CD31 and CD44 showed the same trend. si-GPX4 also reversed the decrease in the levels of inflammation-related factors (interleukin-6 (IL-6), monocyte chemotactic protein 1 (MCP-1), TNF-α) and in the fibrosis-related factor TGF-β induced by LEO (Fig. 5G). Furthermore, cell scratch experiments showed that GPX4 silencing inhibited the migration of HUVECs when compared to LEO treatment alone (Fig. 5H). These results suggest that GPX4 is a key target protein for LEO inhibition of HG-induced ferroptosis.

Fig. 5.

GPX4 is involved in the anti-ferroptosis effect of LEO in HG-induced HUVECs. (A) Expression of GPX4 (red) protein was detected by IF, and nuclei were stained with DAPI (blue) in HUVECs treated with LEO and siGPX4 or NC. Scale bar: 100 µm. (B–D) The levels of iron, GSH and MDA in HUVECs were determined using the corresponding kit. (E) Protein expression of GPX4, CD31 and VE-cadherin was determined by Western blot. (F) JC-1 staining and the fluorescence ratio of MMP in the presence or absence of siGPX4. Scale bar: 200 µm. (G) mRNA expression of CD31, CD44, IL-6, MCP-1, TGF-β and TNF-α was determined by RT-qPCR. (H) The migration of HUVECs was determined with the scratch assay. Scale bar: 500 µm. Values shown are the mean ± SD. *p < 0.05, **p < 0.01 vs. control.

3.6 LEO Inhibits EC Ferroptosis via the Nrf2/GPX4 Axis

Nuclear factor-E2 related factor 2 (Nrf2) is a transcription factor that can regulate GPX4. To further investigate whether LEO affects GPX4 through Nrf2 to subsequently inhibit ferroptosis, we evaluated the expression of Nrf2 following LEO treatment. HG treatment (30 mM) reduced Nrf2 expression, but this increased after the administration of LEO (40 µM) (Fig. 6A). The Nrf2 inhibitor ML385 (5 µM) significantly inhibited GPX4 expression compared to LEO treatment (Fig. 6B,C). ML385 also significantly attenuated the LEO-induced reduction in iron and MDA content, while significantly decreasing the GSH content (Fig. 6D–F). To further examine whether the inhibition of Nrf2 could prevent LEO inhibited EC dysfunction, western blot was used to evaluate CD31 and VE-cadherin expression. ML385 partially abrogated the expression of CD31 and VE-cadherin compared to LEO alone (Fig. 6G). Furthermore, the increase in MMP following LEO treatment of HG-treated HUVECs was abrogated by ML385 (Fig. 6H). Cell scratch experiments also showed that ML385 inhibited HUVEC migration compared with LEO treatment alone (Fig. 6I). These results suggest that LEO inhibits ferroptosis in HG-induced HUVEC by activating the Nrf2/GPX4 signaling pathway.

Fig. 6.

LEO attenuates endothelial impairment via the nuclear factor erythroid 2-related factor 2 (Nrf2)-GPX4 axis in HG-induced HUVECs. (A) Protein expression of Nrf2 was determined by Western blot. (B) Protein expression of Nrf2 and GPX4 was determined by Western blot. (C) Expression of GPX4 (red) protein was detected by IF, and nuclei were stained with DAPI (blue) in HUVECs treated with LEO and ML385 or not. Scale bar: 100 µm. (D–F) The levels of iron, GSH and MDA in HUVECs were determined using the corresponding kit. (G) Protein expression of CD31 and VE-cadherin was determined by Western blot. (H) JC-1 staining and the fluorescence ratio of MMP in the presence or absence of ML385. Scale bar: 200 µm. (I) The migration of HUVECs was determined with the scratch assay. Scale bar: 500 µm. Values shown are the mean ± SD. *p < 0.05, **p < 0.01 vs. control.

4. Discussion

LEO has shown good efficacy in the treatment of cardiovascular diseases such as myocardial infarction and atherosclerosis. There is also increasing evidence supporting the clinical value of LEO in the treatment of diabetes [19] and kidney injury [20]. DN is the most common microvascular complication of diabetes and contributes to renal failure and high mortality rates. Injury to the ECs plays a key role in the early development and progression of DN. Endothelial dysfunction leads to vasoconstriction, vascular inflammation, and several other vascular abnormalities. LEO can reduce histopathological inflammation and act as an anti-oxidant [20], anti-inflammatory [21], and angiogenesis-promoting agent [22]. However, it is not known whether LEO can also exert anti-inflammatory and anti-oxidant effects to slow the progression of DN. The present study therefore investigated whether LEO is involved in the progression of HG/STZ-induced DN.

We first assessed whether LEO inhibits ferroptosis in STZ-induced mice. Interestingly, our results showed that LEO significantly reduced glomerular injury and renal fibrosis in STZ-induced T2DM mice (Fig. 1). Additionally, LEO significantly decreased the levels of BUN, serum creatinine (SCr) and urinary albumin (ALB) compared to control STZ-induced mice. In particular, LEO alleviateed glomerulosclerosis and renal tubular atrophy. LEO was also observed to suppress the in vitro and in vivo expression of the fibrosis-related factor TGF-β1 and inflammatory factor TNF-α, indicating that it can reduce renal fibrosis and damage. Elucidating the mechanism by which LEO improves endothelial dysfunction may therefore reveal key new targets for the clinical treatment of DN.

Ferroptosis was recently implicated in the progression and therapeutic response of DN. Previous studies reported that increased levels of Fe2+ and MDA (a product of lipid peroxidation) in diabetic patients, together with lower GSH levels, resulted in ferroptosis which consequently aggravates diabetic complications [23, 24]. Targeting of ferroptosis is therefore a promising strategy for the treatment of complications from diabetes. Mechanistically, free iron (Fe2+) can react with hydrogen peroxide (H2O2) via the Fenton reaction to generate ROS [25]. Polyunsaturated fatty acids (PUFA) can then undergo spontaneous peroxidation to generate oxidation products such as MDA [24, 26]. Lipid peroxidation is normally prevented by antioxidants, such as system XC-/GPX4 and its reductant GSH. Several studies have confirmed that LEO exerts a strong inhibitory effect on ferroptosis. LEO can for example inhibit ferroptosis in cisplatin-induced acute kidney injury [20]. LEO can also activate the Nrf2 signaling pathway to inhibit endoplasmic reticulum (ER) stress-associated ferroptosis by regulating ATF4/CHOP/ACSL [27]. Furthermore, LEO activates the p62/Nrf2/HO-1 signaling pathway in renal tubular epithelial cells [28]. However, it is not yet known whether LEO inhibits ferroptosis in ECs. The present study found that LEO clearly attenuates the decrease in anti-oxidant GSH, inactivation of GPX, increased production of Fe2+ and MDA (Fig. 2), and the decrease in FTH and FTL levels in DN. Cytoplasmic iron is stored inside a ferritin nanocage composed of 24 subunits of ferritin light chain (FTL) and ferritin heavy chain (FTH). Ferroxidase activity maintains iron in the ferric (Fe3+), non-toxic form [29, 30]. LEO was found to increase the expression of FTH, FTL, and GPX4 compared with the STZ-induced control group (Fig. 3D–G). Therefore, our results indicate that ferroptosis is restored in STZ-induced ECs.

Previous studies have reported the physiological functions of ECs in DN, with VE-cadherin and CD31 being well-known markers of EC dysfunction [31, 32]. In DN, the downregulation of VE-cadherin and CD31 in the glomeruli is related to endothelial dysfunction [33, 34]. The current study found that LEO increased the expression of GPX4, FTL, and FTH in CD31-positive cells (Fig. 2), indicating that LEO-mediated ferroptosis might affect EC activity and function in the kidney during the initiation and development of DN. The viability of HUVECs was impaired by glucose concentrations as low as 30 mM, but this was attenuated by LEO. Under normal conditions, ECs form a barrier to prevent leukocytes such as monocytes from infiltrating the vascular wall and stopping the entry of glucose [4]. However, endothelial dysfunction can generate biomolecules such as inflammatory factors that contribute to the development of DN. GPX4 can reduce ferroptosis in DN through the SIRT3 pathway [35]. The present results showed that siGPX4 reduced CD31 and VE-cadherin expression in HG-treated HUVECs, but this was reversed by LEO. We also assessed the effects of LEO-mediated ferroptosis on EC dysfunction using the scratch test and siGPX4 (Fig. 5). During the development of DN, endothelial dysfunction of ECs can be triggered by oxidized lipids and ROS, leading to increased expression of several inflammatory factors, such as IL-6, TNF-α, TGF-β and MCP-1 [36]. Our results showed that LEO inhibits the siGPX4-induced upregulation of inflammatory factors in HUVECs. This is probably because inhibition of GPX4 causes the accumulation of ROS, thus promoting lipid peroxidation [37]. The present work also found that LEO activates GPX4 to prevent cell death, although it is still unclear whether LEO acts directly on GPX4, or indirectly by blocking the import of cystine and thus depriving cells of cysteine [38]. GPX4 expression is tightly regulated and is boosted by Nrf2 and SP1- and TFAP2c-dependent regulation [39]. Other transcription factors that have been reported to regulate GPX4 expression include CEBP1 and C/EBP in enterocytes [40], and NF-Y in some cancer cell types [41]. However, prior to the current study it was not known whether LEO regulates transcription factors that modulate GPX4 expression, thus inhibiting ferroptosis in ECs. We therefore used an inhibitor of Nrf2 to investigate whether it could reduce LEO-activated GPX4 expression and hence exacerbate EC dysfunction. Inhibition of Nrf2 was indeed found to reduce GPX4 expression and to inhibit EC migration [41]. These results suggest that LEO acts on the transcription factor Nrf2 to regulate GPX4 expression, thereby inhibiting ferroptosis in ECs (Fig. 6). Furthermore, many studies have demonstrated a connection between DN and ferroptosis in renal tubular epithelial cells. For instance, endoplasmic reticulum stress initiates ferroptosis-related epithelial-mesenchymal transition (EMT) through the XBP1-Hrd1-Nrf2 route, thus delaying EMT progression in DN [11]. Quercetin inhibits ferroptosis in renal tubular epithelial cells by modulating the Nrf2/HO-1 signaling pathway [42]. Consequently, it will be important to determine whether LEO protects against DN by acting on the renal tubules.

5. Conclusions

In conclusion, the present results from STZ-induced mice showed that ferroptosis occurs in DN, and that inhibition of ferroptosis by LEO can protect against lipid peroxidation and further aggravation of DN. In addition, the inhibition of ferroptosis by LEO suppressed HG-induced lipid peroxidation and endothelial dysfunction in HUVECs in vitro. GPX4-mediated inhibition of ferroptosis by LEO can therefore attenuate DN by suppressing lipid peroxidation and endothelial dysfunction in HUVECs. Moreover, LEO was found to regulate Nrf2, thereby activating GPX4 to protect against endothelial dysfunction in HUVECs. These results contribute further to our understanding of DN pathogenesis and suggest a therapeutic target for this condition.

Availability of Data and Materials

All data points generated or analyzed during this study are included in this article and there are no further underlying data necessary to reproduce the results.

Author Contributions

XY, KY and YL conducted the experiments. XY, XC and YZ analyzed the data. XY and XZ designed the experiments and wrote the paper. All authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content and agreed to be ac-countable for all aspects of the work in ensuring that questions related to its accuracy or integrity. All authors read and approved the final manuscript. All authors contributed to editorial changes in the manuscript.

Ethics Approval and Consent to Participate

Institutional Animal Care and Use Committee of Guilin Medical University (Approved No. GLMC202105049).

Acknowledgment

Not applicable.

Funding

This work was supported by the grants from the Natural Science Foundation of Guangxi Zhuang Autonomous Region Nos. GuikeAD20238024 and Nos. 2021GXNSFBA196042).

Conflict of Interest

The authors declare no conflict of interest.

References

Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.