Four samples that met the standards for GST were collected in Peking (a is from the Chinese Tea Company Guangxi Branch ‘Chinese Tea Brand’, China), Guangxi (b is from the Guangxi Wuzhou Qianyuan Green Leaf Tea Company ‘Farmer’s Brand’, China), Yunnan (d is from the Yunnan Menghai Chunfurun Tea Company ‘Chunfurun Brand’, China), and Guangdong (e is from the Chinese Tea Company Yunnan Branch ‘Chinese Tea Brand’, China). They were all kept in dark, relatively sealed, ventilated and odor-free places under controlled temperature (30 °C) and humidity (50%) for more than twenty years. Every three months, specialists regularly checked the moisture, contamination and other sensory qualities of the tea samples, the fever phenomenon in the tea stacks and the temperature, humidity and ventilation in the warehouses. Two samples generated from the branches and leaves of C. sinensis plants, which were the same species as the plant used to produce the GST samples, were picked and produced in the same year; these samples were considered the raw material for GST but had not been stored and were selected as controls (NC, c is from the Chinese Tea Company Guangxi Branch ‘Chinese Tea Brand’, China, and f is from the Chinese Tea Company Yunnan Branch ‘Chinese Tea Brand’, China). The Guangdong Institute of Microbiology, China, detected physicochemical properties, such as aflatoxin and heavy metal levels, and performed microbial tests, such as testing for Staphylococcus aureus. The Guangdong Provincial Center for Disease Control and Prevention, China, performed acute toxicity tests. All test results were in line with Chinese food hygiene standards. The China National Analytical Center, Guangzhou (Guangdong Institute of Analysis), and the School of Traditional Chinese Medicine at Southern Medical University undertook the formal identification of these samples. Voucher specimens were deposited in the Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Southern Medical University (No. GST001). Experimental studies performed with these samples, including their collection, complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Convention on the Trade in Endangered Species of Wild Fauna and Flora.

After being crushed and passed through a 20-mesh sieve, 50 g of experimental sample was placed in a headspace-solid phase microextraction device at 80 °C for 20 min. The GC inlet mode was set in the split mode with a split ratio of 5:1. The inlet temperature was 250 °C. The carrier gas (He) was set in the constant flow mode with a flow velocity of 1.0 mL/min. The analytical column was a TG-5MS capillary quartz column (30 m $\times$ 250 $\mu$m $\times$ 0.25 $\mu$m, Thermo, Waltham, MA, USA). The heating program was a 3-min hold at an initial temperature of 60 °C, a 10-min hold at 150 °C after increasing the temperature by 5 °C/min, and then a 9-min hold at 250 °C after increasing the temperature by 5 °C/min; the protocol took a total of 60 min. MS detection was performed under electron impact (EI) ionization conditions by operating in the full-scan acquisition mode in the 30–550 amu range. The electron energy was 70  eV with the temperatures of the ion source and transfer line set to 230 °C and 250 °C, respectively. The sample was subjected to the above chromatographic conditions to obtain the total odor profile of the volatile molecules in the sample, and the relative content of each compound was obtained by area normalization. The Wiley275 and NIST14 databases were used to automatically and manually search the peaks of the integrals, and relevant literature was used to identify the chemical components.

After being crushed and passed through a 20-mesh sieve, 0.2 g of experimental sample was extracted at 70 °C with 5 mL of preheated 70% methanol solution for 20 min. The extraction process was repeated twice. Then, the extract solutions were combined, cooled to room temperature, and centrifuged at 3500 r/min for 10 min. The supernatant was decanted, diluted to volume with a 70% methanol solution in a 10-mL volumetric flask and then filtered through a 0.45-$\mu$m PTFE syringe filter into HPLC vials as the test solution.

The chromatographic conditions applied were the result of optimization of the elution mode, pH of the mobile phase, column temperature and flow rate. They included maintaining an Agilent-C18 column (250 mm $\times$ 4.6 mm, 5 $\mu$m) at 30 °C, using a 0.2% formic acid-water solution (mobile phase A) and acetonitrile (mobile phase B) with a gradient elution mode of 88% A (0 min) $\to$ 88% A (15 min) $\to$ 80% A (25 min) $\to$ 80% A (30 min) $\to$ 88% A (35 min) at a flow rate of 1.0 mL/min, and detection at a wavelength of 278 nm. A peak map was obtained based on the above detection conditions, the peak area of each component was measured, and the content of each chemical component was calculated by linear regression analysis of the injection amount (X, mg/mL) by the peak area (y).

Among the four GST samples, the sample with the highest number of new components and significantly concentrated components was selected (Fig. 1E), ground into powder, and soaked in 5$\times$ boiled water by weight for 20 min. The extraction process was repeated four times. Following filtration, the water extracts were combined and evaporated to dryness under reduced pressure at 60 °C using a reduced pressure concentrator to obtain a dry paste, which is referred to as ‘GST extracts’ in this article.

Fig. 1.

Overview of the total ion chromatograms of the GST and NC samples generated by GC/MS. (A,B,D,E) GST; (C,F) NC.

The human poorly differentiated mucinous gastric adenocarcinoma cell line MGC-803, human poorly differentiated gastric adenocarcinoma cell line BGC-823, human moderately differentiated gastric adenocarcinoma cell line SGC-7901 and human gastric mucosal epithelial cell line GES-1 were donated by the Department of Gastroenterology, Nanfang Hospital, Southern Medical University (China); the cell lines were recently authenticated by STR profiling and tested for mycoplasma contamination. Cells were cultured in complete RPMI-1640 medium (Gibco, Grand Island, NY, USA) containing 10% inactivated calf serum (Gibco, Grand Island, NY, USA). Cell culture was performed at 37 °C in a 5% CO${}_2$ humidified atmosphere.

BGC-823, MGC-803, SGC-7901 and GES-1 cells were seeded in 96-well plates at a density of 10${}^4$ cells/well in 100 $\mu$L of medium. After the cells in each well were cultured to 60–70% confluence, they were treated with GST extracts (dissolved in deionized water and autoclaved) at different concentrations (0, 5, 10, 20, 30, 40, 60 and 80 $\mu$g/mL) for 48 h. Ten microliters of CCK8 solution (Dojindo, Kawasaki City, Kanagawa Prefecture, Japan) was added to the wells, and the cells were cultured for 4 h. Next, the optical density (OD) was detected at 450 nm with a multifunctional microplate reader. The inhibition rate was calculated as inhibition rate (%) = (a – b)/a $\times$ 100, where a and b represent the absorbances of the untreated group and the experimental group, respectively [38].

BGC-823, MGC-803, SGC-7901 and GES-1 cells were seeded in 96-well plates at a density of 10${}^4$ cells per well, and each cell line was divided into a GST group and a control group with 5 duplicate wells per group. After 24 h of culture to allow cell adherence, each well was treated with 20 $\mu$g/mL GST extract solution or sterile water and tested at 24, 48, 72, 96 and 120 h after treatment. Next, 10 $\mu$L of CCK8 solution was added to each well. After further culture for 4 h, the optical density (OD) was detected at 450 nm with a multifunctional microplate reader. The cell proliferation curve was plotted with time (T) on the horizontal axis and OD on the vertical axis.

BGC-823, MGC-803, SGC-7901 and GES-1 cells were seeded in six-well plates at a density of 1.2 $\times$ 10${}^6$ cells per well, and each cell line was divided into a GST group and a control group with 3 parallel wells per group. Each well was treated with 20 $\mu$g/mL GST extract solution or sterile water, collected after 72 h and fixed overnight in 70% ethanol at 4 °C. The fixed cells were washed and resuspended in phosphate-buffered saline (PBS) containing 0.1 mg/mL RNase A at 4 °C and incubated with 800 $\mu$L of a 50 $\mu$g/mL PI solution (Multi Sciences, Hangzhou,China) for 30 min in the dark at 37 °C. The stained cells were analyzed by flow cytometry on a FACSCalibur.

BGC-823, MGC-803, SGC-7901 and GES-1 cells were seeded in six-well plates at a density of 1.2 $\times$ 10${}^6$ cells per well, and each cell line was divided into a GST group and a control group with 3 parallel wells per group. Each well was treated with 20 $\mu$g/mL GST extract solution or sterile water. After 72 h, the cells in each group were collected and washed with PBS, and a single-cell suspension was prepared with the binding buffer provided with the kit. After being mixed with 5 $\mu$L of Annexin V-FITC (Multi Sciences, Hangzhou, China) and 10 $\mu$L of PI (Multi Sciences, Hangzhou, China), the cells were gently shaken for 5 min and then incubated for 30 min in the dark at room temperature. Flow cytometry performed on a FACSCalibur was used to detect cell apoptosis rates. Annexin V+/PI- cells in the lower right quadrant (early apoptotic) and Annexin V+/PI+ cells in the upper right quadrant (late apoptotic) were counted to determine the number of apoptotic cells.

Sixty 5-week-old BALB/c nude mice (half male and half female) (Quality Certificate of Laboratory Animals in Guangdong Province of China No. 44002100008649) were provided by the Animal Experimental Center of Southern Medical University (Guangzhou, China).

Nude mice were reared under specific pathogen-free conditions with free access to food and water, and gastric cancer models were established by subcutaneous injection of BGC-823 cells. When the tumor diameter reached more than 8 mm (approximately 2 weeks), the nude mice were randomized into two experimental groups: one group was used to observe tumor-suppressive effects, and the other group was used to observe the survival time of the tumor models; each group contained 24 nude mice, half male and half female. Each group was divided into four subgroups: the low-dose GST-fed group (LTF), middle-dose GST-fed group (MTF), high-dose GST-fed group (HTF), and negative control group (harbored tumors but treated with saline; NC). There was also a blank control group (subcutaneous injection of saline and treatment with saline; CK). Each group included 6 nude mice, half male and half female.

The doses of GST extracts used for intragastric administration were 0.5, 1.5, and 2.5 g/kg of body weight (BW) for nude mice, which were equivalent to 4.5, 13.5, and 22.5 g/kg of BW GST for nude mice, respectively. The lowest dose for nude mice was calculated based on the daily human consumption of GST. Mice were orally administered 400 $\mu$L of water solution containing GST extracts (0.01, 0.03, and 0.05 g for the LTF, MTF, and HTF groups, respectively) or 400 $\mu$L of sterile saline (for the NC and CK groups) using a feeding needle. Each group was treated once per day at the same time by gavage until the observation time point set in the experimental protocol or a humane endpoint. Before gavage, the water solutions of the GST extracts were sterilized at high temperature (120 °C) and high pressure (103–115 kPa). The relative tumor volume (RTV) is equal to Vt/V0, where Vt is the tumor volume at the end of the experiment and V0 is the tumor volume at the beginning of the experiment. The tumor growth inhibition value (TGI) is equal to [1 – RTV (experimental group)/RTV (control group)] $\times$ 100%.

The observation time points set in the experimental protocol for animals used to observe tumor-suppressive effects, including those detected by immunohistochemistry (IHC) and gut microbiota evaluation, required euthanasia by cervical dislocation at different times followed by tumor collection; the time points included day 14 for the HTF group and day 28 for the MTF, LTF, and NC groups. The humane endpoints for animals used to observe the survival time were weight loss greater than or equal to 20% of BW, an inability to ambulate, an inability to reach food or water, tumors greater than or equal to 10% of BW, tumor ulceration, and a body condition score of 1 or less using the IACUC-approved scoring system. At the end of a study, the animals were euthanized by continuous CO${}_2$ inhalation for at least 15 min after respiratory arrest following an IACUC-approved protocol.

BGC-823 cells were treated with a 20 $\mu$g/mL GST extract solution or 40 $\mu$mol/L LY294002 (Sigma, Burlington, MA, USA) solution dissolved in dimethyl sulfoxide (DMSO), and the cells were collected after 72 h. Cell lysates were prepared using RIPA lysis buffer supplemented with phenylmethanesulfonylfluoride, incubated on ice for 20 min, centrifuged at 4 ℃ and 13000 rpm for 20 min, and the supernatant was collected after the centrifugation was complete. For protein quantification, the BCA (Thermo Fisher Scientific, Waltham, MA, USA) assay method was used. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, 5–15%) was used to separate the total protein; the electrophoretic conditions were a constant voltage of 90 V for the stacking gel for 20 min and a constant voltage of 160 V for the separation gel for 80 min, and the separated proteins were transferred to polyvinylidene difluoride membranes (Millipore, Burlington, MA, USA). The membrane was completely immersed in 3% BSA-TBST and blocked by shaking at room temperature for 30 min. The primary antibody was diluted with 3% BSA-TBST, incubated at room temperature for 10 min, and held at 4 °C overnight. The next day, the membrane was incubated at room temperature for 30 min. The membrane was washed 5 times for 3 min each with TBST. The secondary antibody was diluted with 5% nonfat dry milk-TBST and shaken gently for 40 min at room temperature. The membrane was washed 6 times for 3 min each with TBST. Antigen-antibody interactions were detected using an enhanced chemiluminescence fluorescence system (Thermo Scientific Pierce, Waltham, MA, USA). The antibodies used were as follows: a rabbit anti-Akt monoclonal antibody (Cell Signaling Technology, Danvers, MA, USA, CST4691, 1:500), a rabbit anti-p-Akt polyclonal antibody (Abcam, Cambridge, UK, ab8933, 1:500), a rabbit anti-cyclinD1 monoclonal antibody (Abcam, Cambridge, UK, ab16663, 1:200), a rabbit anti-Rb monoclonal antibody (Abcam, Cambridge, UK, ab181616, 1:500), a rabbit anti-p-Rb polyclonal antibody (Abcam, Cambridge, UK, ab47763, 1:500), a rabbit anti-E2F1 monoclonal antibody (Abcam, Cambridge, UK, ab179445, 1:500), a rabbit anti-$\beta$-actin monoclonal antibody (Abcam, Cambridge, UK, ab179467, 1:1000), and an HRP-labeled goat anti-rabbit IgG secondary antibody (Abcam, Cambridge, UK, ab6721, 1:1000).

Tumor tissues were collected from the HTF group on the 14th day and from the MTF, LTF, and NC groups on the 28th day and fixed with 4% paraformaldehyde. Then, IHC analysis was performed using paraffin-embedded tissue sections that underwent conventional dehydration, clearing, waxing, embedding, and slicing. After the paraffin sections were baked for 60 min, the tissues were conventionally dewaxed in dimethyl benzene and water, washed with PBS and heated with trisodium citrate for antigen retrieval. Then, a 3% peroxidase blocking solution was added, and the sections were washed with PBS. The slides were incubated with primary antibodies specific for p-Akt, cyclinD1, p-Rb, and E2F1 overnight at 4 °C in a refrigerator and then rinsed with PBS. A corresponding secondary antibody was added, and the slides were incubated at room temperature for 45 min. Traditional methods were used for DAB color development, hematoxylin counterstaining, dehydration, sealing, and microscopy imaging. The images were analyzed with Image-Pro Plus (Media Cybernetics, United States); brown particles indicated positive expression, and positive staining in images was quantified as integrated optical density (IOD)/area, i.e., the average density = sum of densities/area sum [39]. Specifically, 5 positive fields were selected from each section, and the mean of the mean densities was calculated. The antibodies used were as follows: a rabbit anti-p-Akt polyclonal antibody (Abcam, Cambridge, UK, ab8933, 1:200), a rabbit anti-cyclinD1 monoclonal antibody (Abcam, Cambridge, UK, ab16663, 1:100), a rabbit anti-p-Rb polyclonal antibody (Abcam, Cambridge, UK, ab47763, 1:200), a rabbit anti-E2F1 monoclonal antibody (Abcam, Cambridge, UK, ab179445, 1:200), and an HRP-labeled goat anti-rabbit IgG secondary antibody (Abcam, Cambridge, UK, ab6721, 1:500).

Feces were collected from nude mice in each group every 7 days with an Eppendorf (EP) tube and stored in a –80 °C freezer until the humane endpoint occurred. In the experiment, 200 mg of each fecal sample was weighed, mixed with 1 ml of 70% ethanol, and centrifuged at 10,000 rpm for 3 min at room temperature. Then, the supernatant was discarded, and 1$\times$ PBS was added to the remaining sample, which was then shaken and mixed before being centrifuged at 10,000 rpm for 3 min at room temperature; again, the supernatant was discarded. The sample was inverted on blotting paper for 1 min until no liquid flowed out and then baked in an oven at 55 °C for 10 min to completely evaporate any residual alcohol. DNA was extracted using an OMEGA kit EZNATM Mag-Bind Soil DNA Kit (OMEGA, Norcross, GA, USA), and PCR amplification was performed. The PCR primers were fused with the V3-V4 universal primer for the MiSeq sequencing platform. The universal primers were as follows: F: CCCTACACGACGCTCTTCCGATCTG(Barcode)CCTACGGGNGGCWGCAG and R: GACTGGAGTTCCTTGGCACCCGAGAATTCCAGACTACHVGGGT ATCTAATCC. The first round of PCR amplification conditions were 94 °C for 3 min; 5 cycles of 94 °C for 30 s, 45 °C for 20 s, and 65 °C for 30 s; 20 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s; and finally 72 °C for 5 min and 10 °C indefinitely. Next, a second round of amplification was performed, and Illumina bridge PCR-compatible primers were introduced. The conditions were 95 °C for 3 min; 5 cycles of 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 30 s; and finally 72 °C for 5 min and 10 °C indefinitely. The PCR products were recovered using Beckman’s Agencourt AMPure XP kit (Beckman, Brea, CA, USA) and then subjected to 16S DNA sequencing. The V3-V4 region was amplified.

Gastric cancer models were established with nude mice by subcutaneous injection of BGC-823 cells and divided into donor and transplantation groups, which included 4 subgroups with 6 mice (3 males and 3 females) in each group. There was also a blank control group (CK) containing 6 mice (3 males and 3 females). The mice in the donor and transplantation groups were considered eligible FMT recipients if their tumor diameter exceeded 8 mm. Donors were intragastrically fed the low, middle, or high dose of GST extracts or fed normal saline (LTF, MTF, HTF, and NC groups, respectively). The transplantation groups corresponding to the donor groups for FMT were designated the low-dose GST-fed transplantation group (LTT), middle-dose GST-fed transplantation group (MTT), high-dose GST-fed transplantation group (HTT), and negative control transplantation group (NCT). FMT was performed by oral administration using fresh graft material made from a total of 200 mg of feces from the same donor group, which was resuspended in 2 mL of sterile saline, vigorously mixed for 10 s, and centrifuged at 800 rpm for 3 min, with the pellet discarded. The preparation process was usually performed within 10 min to prevent changes in the bacterial composition. The treatment was administered to the mice at 100 $\mu$L/day until the humane endpoint.

We commissioned the Guangdong Provincial Center for Disease Control and Prevention, China, to conduct acute toxicity tests with GST extracts in accordance with the standard procedures prescribed by China.

A two-tailed Student’s t test was employed to analyze both the in vitro data and in vivo data. One-way ANOVA was applied to analyze tumor growth. The Mantel-Cox (log-rank) test was used for survival analysis. All analyses were performed with SPSS 20.0 (IBM Corp., Chicago, IL, USA). A threshold of p 0.05 was defined as statistically significant.

GST and NC samples were analyzed by GC/MS and HPLC. The results showed that compared with the NC group, new components appeared in the GST group, including vitispirane, tridecane, 2,6,10-trimethyldodecane, 6,10-dimethyl-2-undecanone, thujopsene, hydroxydihydroedulan, 2,6-di-tert-butyl-p-benzoquinone, $\beta$-selinene, n-nonyl cyclohexane, methyl 2-endo-acetamidobicyclo[2.2.1]heptane-2-exo-carboxylate, 3-methyl-hexadecane, 5,6-dihydro-5,6-dimethyl benzo[c]cinnoline, nonadecane, etc. Significant increases were also detected in the GST group, including 6-methyl-5-hepten-2-one, $\alpha$-limonene, $\alpha$-terpinene, $\alpha$-phellandrene, 2-methyl-pentadecane, etc. (Fig. 1, Tables 1,2). Most of these new and increased components were terpenes and their derivatives, among which there were more monoterpenes and fewer sesquiterpenes.

In the GST group, other components, particularly polyphenols and alkaloids, were decreased, including EGCG, ECG, theobromine, theophylline, caffeine, linalool, dihydroactinidiolide, methyl salicylate, $\beta$-ionone, etc. Some components were also absent in the GST group, including $\alpha$-terpineol, propanoic acid 2-methyl-2,2-dimethyl-1-(2-hydroxy-1-methylethyl)propyl ester, methyl N-methyl anthranilate, $\delta$-cadinene, 1,1-diphenyl-2-methylpropene, 2,3-dihydro-1-methyl-3-phenyl-1H-indene, etc. (Fig. 1, Tables 1,2).

In terms of composition, GST was completely different from the tea made from the branches and leaves of the same plant species, C. sinensis, which contains polyphenols, theanine, and caffeine simultaneously. In view of the significant increase in terpenes and their derivatives in GST extracts, and given that the anti-tumor activity of terpenes is well known, we choose the sample (Fig. 1E) with the highest number of new components and significantly concentrated components among the four GST samples, extracted it and performed antitumor experiments with the GST extracts.

We obtained 79 g of extracts from 700 g of GST, and the extraction rate was 11.3%. The viability of BGC-823, MGC-803, and SGC-7901 cells with different concentrations of GST extracts were detected using the CCK8 method at 48 h. The results showed that GST extracts significantly inhibited cell viability in a concentration-dependent manner (Fig. 2A). The IC50 values for BGC-823, MGC-803, and SGC-7901 cells at 48 h were 19.31 $\mu$g/mL, 20.65 $\mu$g/mL and 21.47 $\mu$g/mL, respectively; therefore, the average concentration of 20 $\mu$g/mL was selected for the next experiment. The results of a CCK8 assay showed that the GST extracts significantly inhibited gastric cancer cell proliferation (p = 0.037) but had no obvious inhibitory effect on human gastric mucosal epithelial GES-1 cells (Fig. 2B). The flow cytometry results showed that the GST extracts inhibited the cell cycle by arresting it in the G0/G1 phase (p 0.001) (Fig. 2C) and promoted early apoptosis (p = 0.041) (Fig. 2D).

Fig. 2.

Inhibition of gastric cancer by GST extracts in vitro and in vivo. (A) GST extracts inhibited BGC-823, MGC-803, and SGC-7901 cell viability in a concentration-dependent manner. (B) The CCK8 assay results showed that the GST extracts significantly inhibited BGC-823, MGC-803, and SGC-7901 gastric cancer cell proliferation without clear inhibitory effects on human gastric mucosal epithelial GES-1 cells. *p = 0.037, compared with the control group. (C) The cell cycle of BGC-823, MGC-803, and SGC-7901 gastric cancer cells and GES-1 cells was analyzed using flow cytometry. The results showed that the GST extracts inhibited the cell cycle in gastric cancer cells via G0/G1 arrest. *p 0.001 and ** p = 0.028, compared with the control group. (D) BGC-823, MGC-803, and SGC-7901 gastric cancer cells and GES-1 cells were stained with annexin-V FITC and PI and detected by flow cytometry. Annexin V+/PI– cells in the lower right quadrant (early apoptotic) and Annexin V+/PI+ cells in the upper right quadrant (late apoptotic) were counted to determine the number of apoptotic cells. The results showed that the GST extracts induced apoptosis in gastric cancer cells. *p = 0.041, compared with the control group. (E) Gastric tumor growth was significantly inhibited in the HTF group on the 14th day (p = 0.042) and in the MTF group on the 14th day (p = 0.002) and the 28th day (p = 0.008) compared with the NC group, *p 0.05. (F) Tumors from the nude model mice administered GST extracts from the HTF, MTF, LTF, and NC groups. (G) The survival time of the nude mice with gastric cancer xenografts in the MTF group was significantly prolonged compared with that in the NC group (p = 0.013).

The GST extracts were administered to model mice with gastric cancer, and on the 14th and 28th days, at least 5 nude mice from each group had survived. The results showed that gastric tumor growth was significantly inhibited in the HTF and MTF groups. The inhibition rate of the HTF group on the 14th day was 33.77% (p = 0.042), and the inhibition rate of the MTF group was 55.21% on the 14th day (p = 0.002) and 61.6% on the 28th day (p = 0.008) (Fig. 2E,F, Table 3). The survival time of the MTF group was significantly prolonged by 22.2% compared with that of the NC group (p = 0.013) (Fig. 2G, Table 4). Although the survival time of the HTF group was shorter than that of the NC group, there was no significant difference (p = 0.434) (Fig. 2G, Table 4). There were no significant differences in tumor growth (p = 0.060) (Fig. 2E,F, Table 3) or survival time (p = 0.469) (Fig. 2G, Table 4) between the LTF group and the NC group. Therefore, we concluded that treatment with GST extracts at a suitable dose (MTF) not only had a strong tumor growth inhibitory effect but also prolonged mouse survival time. These results suggest that GST extracts have the potential to treat gastric cancer.

Given that our results suggest that GST extracts play a role in the transition of gastric cancer cells from G1 to the S phase, we used western blotting to analyze the expression of key regulators of the cell cycle in the PI3K/Akt signaling pathway of BGC-823 cells after GST extract treatment. The results showed that the expression levels of p-Akt, cyclinD1, p-Rb, and E2F1 were significantly lower than those in BGC-823 cells not treated with GST extracts (control group) (p = 0.016). When BGC-823 cells were treated with the PI3K/Akt signaling pathway inhibitor LY294002, the pathway changes were similar to those observed in the GST extracts treatment group (p = 0.023) (Fig. 3A), indicating that GST extracts can inhibit the PI3K/Akt signaling pathway in gastric cancer.

Fig. 3.

Inhibition of the PI3K/Akt signaling pathway in gastric cancer by GST extracts. (A) Western blot results for BGC-823 cells showed that the expression levels of p-Akt, cyclinD1, p-Rb, and E2F1 in the GST extracts treatment group were significantly lower than those in the control group (*p = 0.016). When the PI3K/Akt signaling pathway inhibitor LY294002 was administered, the pathway changes were similar to those observed in the GST extracts treatment group. **p = 0.023, compared with the control group. (B) The immunohistochemistry results showed that the expression levels of p-Akt, cyclinD1, p-Rb, and E2F1 in the MTF group were significantly suppressed, which was consistent with the western blot results. *p = 0.029, compared with the NC group (200$\times$).

Next, we used IHC to detect changes in the PI3K/Akt signaling pathway in tumor tissues from the GST extracts treatment group. The results showed that the expression levels of p-Akt, cyclinD1, p-Rb, and E2F1 in the MTF group were significantly suppressed (p = 0.029) (Fig. 3B), which was consistent with the western blot results.

The effect of GST extracts on the gut microbiota of nude mice with gastric cancer was detected by 16S DNA sequencing. UniFrac-based principal coordinate analysis (PCoA) revealed distinct clustering of the microbiota composition in each group (Fig. 4A). The gut microbiota of the MTF group on the 28th day and that of the HTF group on the 14th day were similar to that of the normal group (CK) (Fig. 4B). Taxonomic profiling demonstrated that the ratio of Firmicutes to Bacteroidetes decreased over time in the NC group and increased over time in each GST-fed group. In particular, this ratio was significantly higher in the MTF group on the 28th day and in the HTF group on the 14th day than those in the NC and blank control groups. Additionally, Proteobacteria abundance was notably increased in all GST-fed groups (Fig. 4B). Differences in bacterial function between the NC group and the MTF group on the 28th day or the HTF group on the 14th day were identified by Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, which revealed that the altered microbiota functions were mainly concentrated in metabolism, growth, death, enzymes, replication, and repair (p 0.05) (Fig. 4C,D).

Fig. 4.

GST extracts altered the gut microbiota composition in a nude mouse model of gastric cancer. The gut microbiota composition in the feces of mice harboring gastric cancer xenografts treated with or without GST extracts was analyzed using 16S DNA sequencing (n = 5 for each group). (A) Plots were generated using the weighted version of UniFrac-based PCoA. (B) Taxonomic profiling of the gut microbiota in different groups at the phylum level. (C,D) Analysis of the functional differences in the gut microbiota based on KEGG analysis showed that the changes were mainly focused on metabolism, growth and death, enzymes, replication and repair (red indicates p 0.05 between the GST-fed groups and the NC group).

Because GST extracts altered the gut microbiota of nude mice with gastric cancer and inhibited tumor growth, we speculated that the alteration of gut microbiota most likely lead to tumor suppression. To test this hypothesis, we performed FMT experiments and found that tumor growth was not inhibited in any of the transplant groups on the 14th day (p = 0.742) or the 28th day (p = 0.572) (Table 5). Although the survival time of the HTT group was significantly longer than that of the HTF group (p = 0.002), there was no significant extension of survival in the other transplant groups (Table 4).

The acute oral toxicity of GST extracts was LD50 = 10.80 g/kg of BW (GST was LD50 = 95.6 g/kg of BW) in female Kunming mice and LD50 = 12.60 g/kg of BW (GST was LD50 = 111.5 g/kg of BW) in male Kunming mice; both values indicated that GST extracts were nontoxic.