2. Introduction
Liver fibrosis, the excessive accumulation of extracellular matrix (ECM)
proteins, is a pivotal structural basis of the pathogenesis in
many chronic liver diseases [1, 2]. If left untreated, progressive fibrosis
eventually develops into cirrhosis, liver failure, and hepatocellular carcinoma
[1, 3]. In recent years, although great progress has been made in understanding
the pathogenesis, effective anti-liver fibrosis drugs have not been developed
[4]. Hepatic stellate cells (HSC), the main cell population of
liver-synthesizing ECM proteins, not only secrete some ECM components including
proteoglycan and glycoprotein, but also synthesize several collagenases to
maintain normal basement membrane structure, which plays an important role during
the development of hepatic fibrosis [4, 5]. In addition to ECM synthesis, the
pathological process of hepatic fibrosis also involves ECM degradation, which is
synergistically regulated by matrix metalloproteinases (MMPs) and tissue
inhibitors of metalloproteinases (TIMPs) [6]. Studies have shown that activated
HSC can increase the synthesis and decrease degradation of ECM, scar tissue from
excessive deposition of ECM gradually distorts the normal parenchymal structure
and impairs its function in this process, and finally leads to the development of
liver fibrosis [7]. Furthermore, inflammation is a hallmark of liver fibrosis.
Many studies have demonstrated that chronic liver inflammation drives hepatic
fibrosis by accelerating liver macrophage infiltration through the secretion of
cytokines and chemokines, such as interleukin-1 (IL-1) and
monocyte chemotactic protein-1 (MCP-1/CCL2). Furthermore, liver inflammation is
regulated by different phenotypes of macrophages, including pro-inflammatory M1
and anti-inflammatory M2 macrophages [8, 9, 10, 11]. Thus, the regulation of HSC
activation and inflammatory infiltration are promising therapeutic strategies for
the treatment of liver fibrosis.
The janus kinase/signal transducer and activator of transcription (JAK/STAT)
pathway specifically mediates the signal transduction of many cytokines and
growth factors from the cell membrane to the nucleus [12].
The activation of JAK2/STAT3 signaling is among the distinctive
hallmarks of HSC activation, and it is involved in the development of liver
fibrosis [13, 14]. Studies in HSCs shown that the inhibition of JAK2/STAT3 pathway
prevents HSC morphological trans-differentiation and downregulates the expression
levels of pro-fibrotic genes [15]. The suppressor of cytokine signaling 3
(SOCS3), an inhibitor protein of STAT3 signaling, can inhibit JAK/STAT pathways
and thereby exert important actions in liver fibrosis [16, 17]. The expression of
SOCS3 gradually increases with the aggravation of liver fibrosis and decreases
during the reversal process [16].
Dimethylnitrosamine (DMN), a potent hepatotoxin, can induce liver fibrosis and
cirrhosis. In rats, DMN administration can lead to severe necrosis and ECM
protein deposition in the liver [18, 19]. Thus, in investigating human liver
fibrosis and cirrhosis, the DMN induced liver injury rat model is reproducible
and potentially valuable animal model. Genistein
(4,5,7-trihydroxyisoflavone, Fig. 1), a biologically active isoflavone that
is mainly extracted from soybean products, including Cordyceps sinensis
mycelium, exhibits multiple biological effects, such as anti-inflammatory,
hepatoprotective, and anti-cancer properties, which has aroused great interest in
the field of pharmacy [20]. Genistein ameliorates many chronic liver diseases,
such as hepatocellular carcinoma [21] and nonalcoholic fatty liver disease [22].
In the present study, we aimed to evaluate the anti-hepatic fibrosis effects of
genistein and its potential mechanism both in vitro and in
vivo. First, the effects of genistein on cell viability, proliferation, cell
cycle and activation were investigated in human immortalized HSC LX2 cells.
Furthermore, liver fibrosis model was established by DMN in rats. Subsequently,
liver injury, liver fibrosis, HSC activation, the expressions of MMPs and TIMPs,
and the functional properties of macrophage, as well as the JAK2/STAT3/SOCS3
signaling pathway were evaluated.
Fig. 1.
Chemical structure of genistein.
3. Materials and methods
3.1 Main materials
Genistein was obtained from Dalian Meilun Biology Technology Co., Ltd. (Dalian,
China). Dimethylnitrosamine was obtained from TCI (Shanghai) Chemical Industry
Development Co., Ltd. Dulbecco’s modified Eagle’s medium (DMEM, high glucose) and
fetal bovine serum (FBS) were obtained from Gibco Life Technology (Gibco
Invitrogen Corporation, Barcelona, Spain). Aspertate aminotransferase (AST),
alanine aminotransferase (ALT), alkaline phosphatase (ALP), and total bile acid
(TBA) test kits, hematoxylin and Eosin (H&E) staining kit, and hydroxyproline
(Hyp) assay kit were obtained from Nanjing Jiancheng Bioengineering Institute
(Nanjing, China). Reverse transcriptase assay kit was purchased from Applied
Biological Materials Inc. (abm, Vancouver, Canada). TRIzol reagent and all primer
were obtained from Shanghai Sangon Biological Engineering Co. Ltd. (Shanghai,
China). SYBR Green Realtime PCR master mix was obtained from Toyobo Co., Ltd.
(Osaka, Japan) Cell counting kit-8 (CCK-8) was obtained from Dojindo Laboratories
Co., Ltd. (Kumamoto, Japan). BeyoClick™ EdU cell proliferation kit
with Alexa Fluor 594 and cell cycle and apoptosis analysis kit were obtained from
Beyotimebiology Co., Ltd. (Shanghai, China). RIPA lysis buffer, proteinase and
phosphatase inhibitor, BCA protein concentration assay kit and
QuickBlock™ blocking buffer for western blot were obtained from
Beyotimebiology Co., Ltd. (Shanghai, China). Antibodies JAK2 (#3230), p-JAK2
(#3771), STAT3 (#9139) and p-STAT3 (#9145) were obtained from Cell Signaling
Technology (Danvers, MA, United States); -smooth muscle actin
(-SMA, #ab7817, for Western blot; #ab124964, for immunofluorescence),
collagen type I alpha 1 (Col1A1, #ab34710), SOCS3, and CD68 (#ab125212), as
well as Goat Anti-Rabbit IgG H&L (Cy3 ®) preadsorbed (#ab6939)
were obtained from Abcam, Inc. (Cambridge, UK). CD163 (#16646-1-AP), CD206
(#60143-1-Ig) and GAPDH (#60004-1-Ig) were purchased from Proteintech (Wuhan,
China). HSC line LX2 cells was provided by Professor Lieming Xu.
3.2 Animals and experiment design
Forty male Wistar rats (SPF grade, weight of 140 20 g) were provided by
Shanghai Xipuer-Bikai Experimental Animal Co., Ltd. Animal experiment was carried
out in Experimental Animal Center of Shanghai University of Traditional Chinese
Medicine. The animal study was reviewed and approved by the Animal Ethics
Committee of Shanghai University of Traditional Chinese Medicine
(PZSHUTCM190322007; Approval date: July 27, 2018). All rats (weighing 160–180 g)
were randomly divided into the normal control (n = 8) and liver fibrosis
model group (n = 32). An experimental model of liver fibrosis was
established by intraperitoneal injection of 0.5% DMN saline (2 mL/kg body
weight, 3 consecutive days per week) for 4 weeks according to the previous study
[23]. After the second week, 32 rats with liver fibrosis were further divided
into four groups with eight rats in each group as follows: DMN model, genistein-5
mg/kg, genistein-20 mg/kg, and sorafenib (5 mg/kg, as a positive control drug)
group. From weeks 3 to 4, rats received treatment with 0.4% CMC-Na or
correspondence drugs by gavage per day. After the fourth week, all rats were
anesthetized by 3% pentobarbital sodium through intraperitoneal injection, and
the samples were collected for further studies.
3.3 Cell culture and treatment
LX2 cells were seeded in 12-well plates with 5 10 cells and 30
mm petri dishes with 2 10 cells and were maintained in 10%
FBS-containing DMEM medium. The cells were incubated with genistein at
concentrations of 20, 40, and 80 M. The divided experimental groups were
as follows: DMSO control group, TGF-1 (5 ng/mL) group, TGF-1 +
SB431542 (10 M, an TGF-1 inhibitor) group, TGF-1 + 20
M genistein group, TGF-1 + 40 M genistein group,
TGF-1 + 80 M genistein group. The mRNA and protein expressions
were evaluated by qRT-PCR, Western blot and immunofluorescent assay.
3.4 CCK-8 cell viability assay
LX2 cells were cultured at 5 10 cells/well into 96-well plate
and incubated in 10%-containing DMEM medium at appropriate times. Subsequently,
cells were incubated with genistein at concentration of 1.56, 3.13, 6.25, 12.5,
25, 50, 100 and 200 M. And then, 10 L CCK-8 solution was quickly
added to each well at two hours before the scheduled times (24 h). Ultimately,
the absorbance of 96-well plates was detected at 450 nm by microplate reader
(BioTek, Hercules, CA, USA) at the scheduled times.
3.5 EdU cell proliferation assay
LX2 cells were grown in 12-well plates and were treated with genistein (20, 40
and 80 M) for 24 h. Then, the cells were incubated with EdU labeling
medium with a final concentration of 10 M for additional 2 h at 37 C. Two
hours later, the cells were fixed with 4% formaldehyde for 10 min, were
permeabilized with 0.3% Triton X-100 for 15 min, and were stained with click
reaction solution for 30 min, respectively. The cell nuclei were stained using
hoechst for 10 min. Finally, the cells were observed using an inverted
fluorescence microscope DP80 (Olympus, Tokyo, Japan).
3.6 Cell cycle analysis
Briefly, LX2 cells, seeded into the 6-well plate at 1 10 cells
per well, were cultured with genistein (20, 40 and 80 M) for 24 h. The
cells were then washed using ice-cold PBS, harvested and fixed in EP tube with
cold 70% ethanol for 24 h, and followed by staining with PI for 30 min 37
C, respectively. Added 500 L propidium iodide staining solution
and incubated for 30 min at 37 C in the dark. Finally, the samples were
analyzed by flow cytometry (FACS AriaIII, BD, USA). The percentage of cells in
different phases of the cell cycle was analyzed by ModFit LT 5.0 software (Verity
Software House, Inc., Topsham, ME, USA).
3.7 Serological index and hepatic hydroxyproline (Hyp) content
assays
Serum AST, ALT, ALP and TBA levels, and the content of hepatic Hyp were measured
using a matched test kit. In short, the serum samples were thawed at room
temperature, and then placed in an automatic analyzer according to the labeling
sequence. Subsequently, the corresponding detection reagents were added into the
analyzer detection reagent bottle to detect serum AST, ALT, ALP, and TBA levels.
Furthermore, hepatic Hyp content was assessed by alkaline hydrolysis method.
Approximately 50 mg of liver tissues were weighed and hydrolyzed, and pH was
adjusted to 6.0–6.8. The detection steps were performed according to the
manufacturer’s instructions.
3.8 Histopathological assay
Formalin-fixed paraffin-embedded tissue samples were cut into 4-m
sections, and then adhered to silanized slides. The samples were then stained by
H&E and Sirius red staining to evaluate histopathological features and fibrosis
stage according to manufacturer’s instructions. Sirius red-positive area was
further calculated by Leica LAS Image Analysis, percentage of positive staining
area = positive staining area/total area 100%.
3.9 Immunohistochemistry assay
The tissue sections were routinely de-waxed and dehydrated, and underwent
antigen retrieval with mixing 4% sodium citrate buffer. Endogenous peroxidase
activity and non-specific antigens were blocked with methanol containing 3%
HO for 15 min and PBS containing 10% goat serum for 30 min,
respectively. Further, the sections were incubated with anti--SMA
(1:1000), anti-Col1A1 (1:500), anti-CD68 (1:1000), anti-CD163 (1:1000), and
anti-CD206 (1:1000) at 4 C overnight. PBS was used instead of the
primary antibody as the negative control. The following day the sections were
incubated using secondary antibody labeled with HRP. Finally, the sections were
stained by 3, 3-diaminobenzidine (DAB) and harris hematoxylin.
3.10 Immunofluorescent assay
An 8 m-thick frozen sections of liver tissues were fixed with cold
acetone for 10 min. The cells were fixed with 4% formaldehyde for 15 min and
were permeabilized with 0.3% Triton X-100 for 10 min. Then, fixed tissue
sections and cells were blocked with 10% goat serum for 30 min, followed by
incubation with anti--SMA (1:1000) and anti-Col1A1 (1:500) overnight at
4 C, respectively. Meanwhile, PBS was used instead of the primary
antibody as the negative control. Subsequently, the specimens were stained using
fluorescent secondary antibodies with goat anti-rabbit IgG-Cy3 (1:3000) and the
nuclei were counterstained with DAPI (1:1000). Finally, these specimens were
scanned under Olympus Fluoview 500 confocal microscope (Malvern, USA), and
representative images were displayed.
3.11 Western blot analysis
The proteins from the liver tissues and LX2 cells were extracted using RIPA
lysis buffer. Simply, LX2 cells and liver tissues were lysed with RIPA lysis
buffer containing phosphatase and protease inhibitor, and lysed tissues and cells
were centrifuged at 12,000 rpm for 20 min. The protein concentration was measured
using the BCA protein assay kit. And then, the samples, SDS-PAGE protein loading
buffer (5) and water were mixed together to prepare loading protein
samples. Subsequently, 30 g proteins were loaded on 8% or 12%
SDS-PAGE (electrophoresis conditions: 80 V) and transferred onto 0.45
polyvinylidene fluoride (PVDF) membranes (transfer conditions: 2–2.5 h, 100 V).
The membranes were blocked with quick sealing fluid for 30 min, and then
incubated with anti--SMA (1:1000), anti-JAK2 (1:500), anti-p-JAK2
(1:500), anti-STAT3 (1:500), anti-p-STAT3 (1:500), anti-SOCS3 (1:500), and
anti-GAPDH (1:5000) at 4 C overnight and subsequently incubated with
fluorescence-labeled secondary antibody (1:5000). The protein bands were scanned
by the Odyssey infrared scanner (LI-COR Biosciences, Lincoln, NE, USA).
3.12 Quantitative real-time PCR (qRT-PCR) analysis
Total RNA from rat hepatic tissues and LX2 cells was extracted using TRIzol
reagent. Briefly, liver tissues and LX2 cells were lysed using TRIzol reagents.
Afterward, chloroform, isopropanol, 75% ethanol, and anhydrous ethanol were
added to the solutions of homogenized tissues and lysed cells, and then
centrifuged at 12,000 rpm 4 C and finally dissolved with DEPC water. cDNA was
synthesized from extracted total RNA using the reverse transcriptase PCR kit.
qRT-PCR was carried out using SYBR Green PCR master mix. The relative mRNA
expression levels of liver tissues and LX2 cells were measured using the ABI
ViiA7 sequence detector (Applied Biosystems, USA). The PCR cycling program was 95
C for 60 s, 40 cycles of 95 C for 15 s, and 60 C
for 60 s. Gene expression was normalized to that of the housekeeping gene GAPDH.
The relative expression of target genes was calculated using
2 method. The primer sequences for qRT-PCR are listed
in Table 1.
Table 1.PCR primer sequences.
Gene |
Forward primer (5′-3′) |
Reverse primer (5′-3′) |
Human |
|
|
-SMA |
CTATGCCTCTGGACGCACAACT |
CAGATCCAGACGCATGATGGCA |
Col1A1 |
GATTCCCTGGACCTAAAGGTGC |
AGCCTCTCCATCTTTGCCAGCA |
GAPDH |
GTCTCCTCTGACTTCAACAGCG |
ACCACCCTGTTGCTGTAGCCAA |
Rat |
|
|
-SMA |
AAGTATCCGATAGAACACG |
TAGATAGGCACGTTGTGAG |
Col1A1 |
ACAGACCAACAACCCAAACTC |
ACTTATACCCACATAGGTCTTCAAG |
MMP1 |
GGAAGGTGATATTGTGTTCGCC |
CTATGGTCTCCTCTGTAGAAGGC |
MMP9 |
CACTGTAACTGGGGGCAACT |
CACTTCTTGTCAGCGTCGAA |
TIMP1 |
TGGCATCCTCTTGTTGCTATC |
ACAGCGTCGAATCCTTTGAG |
IL-6 |
AGCCAGAGCTGTGCAGATGA |
GCAGGCTGGCATTTGTGGTT |
TNF- |
CCCCAAAGGGATGAGAAGTT |
CACTTGGTGGTTTGCTACGA |
IL-1 |
GGATGAGGACATGAGCACCT |
AGCTCATATGGGTCCGACAG |
MCP-1 |
AGCATCCACGTGCTGTCTC |
GATCATCTTGCCAGTGAATGAG |
GAPDH |
CCATCAACGACCCCTTCATT |
GACCAGCTTCCCATTCTCAG |
3.13 Statistical analysis
Data are expressed as mean standard deviation (SD). Multiple groups mean
with normal distributions and equality of variance were compared by one-way ANOVA
with post hoc LSD for multiple pair-wise comparisons. Non-normal
distributions and unequal variance were analyzed using Kruskal-Wallis
test. p 0.05 was considered statistically significant.
4. Results
4.1 Genistein regulates the cell viability, proliferation, and
cell-cycle arrest in LX2 cells
Genistein was used in HSC line LX2 cells to evaluate the effect of genistein on
cell growth by CCK8 assay, EdU staining, cell cycle analysis. First, the cell
viability was evaluated by CCK8 assay, compared with the control group, cell
viability was not significantly inhibited within 150 , but was
obviously inhibited by genistein treatment with 200 (p
0.05, Fig. 2A). Further, the anti-proliferative effect of genistein was
investigated in LX2 cells by EdU staining, the results showed that the
proliferation of LX2 cells was significantly inhibited at 40 and 80 of
genistein (p 0.05 or p 0.001, Fig. 2B). The cell cycle
distribution was evaluated using flow cytometry. In comparison with the control
group, the G0/G1 phase population increased, and the S phase population decreased
in LX2 cells after treatment with 20, 40, and 80 genistein (p 0.05 or p 0.01 or p 0.001), suggesting that
genistein induced cell cycle arrest at G0/G1 phase (Fig. 2C).
Fig. 2.
The effects of genistein on cell viability, proliferating and
cell cycle. (A) CCK8 test was used to evaluate the effect of different
concentrations of genistein on cell viability at 24 h in LX2 cells was detected
by. (B) EdU assay was performed to detected the effect of genistein (20, 40 and
80 ) on the proliferation at 24 h in LX2 cells, and the number of
positive cells in EdU assay, Hoechst was counterstained the nuclei,
representative confocal microscopy images are shown, scale bar 20
m. (C) Flow cytometry was used to evaluate the effect of genistein
(20, 40 and 80 ) on the cell cycle at 24 h in LX2 cells.
p 0.001, p 0.01,p 0.05 vs control group (0.1% DMSO).
4.2 Genistein inhibits the expressions of -SMA and Col1A1
in LX2 cells
HSC activation is a key event in the occurrence and development of liver
fibrosis. Thus, its activation is usually evaluated in the study of fibrosis. In
this work, the expressions of -SMA and Col1A1, which are typical
markers of HSC activation, were induced by TGF-1 in LX2 cells to
investigate the anti-fibrosis effects of genistein in vitro. First, the
expressions of -SMA and Col1A1 mRNA were assessed by qRT-PCR analysis.
As expected, the elevated mRNA expression levels of -SMA and Col1A1 in
LX2 cells induced by TGF-1 were decreased after treatment with 20, 40,
and 80 M of genistein (p 0.05 or p 0.01 or
p 0.001; Fig. 3A). The protein expression of -SMA was also
evaluated by Western blot assay and immunofluorescent staining. Western blot
assay result showed that the expression of -SMA protein was
significantly suppressed in genistein treatment group (p 0.05 or
p 0.001; Fig. 3B). Consistent results of -SMA protein
expression were achieved by immunofluorescence staining (Fig. 3C).
Fig. 3.
The effects of genistein on the expressions of -SMA
and Col1A1 in LX2 cells. (A) qRT-PCR was used to determine the effects of
genistein on the expression levels of -SMA and Col1A1 mRNA in LX2
cells, gene expression was normalized to GAPDH mRNA. (B) Western blot was used to
assess the effect of genistein on the expression level of -SMA protein,
-SMA protein expression was normalized against GAPDH level. (C)
Immunofluorescence staining of -SMA was assessed by immunofluorescence
assays, DAPI was counterstained the nuclei, representative confocal microscopy
images are shown, scale bar 60 m. p 0.001
vs control group (0.1% DMSO);p 0.001,
p 0.01, p 0.05 vs TGF-1
group. SB43152 is an inhibitor of TGF-1.
4.3 Genistein ameliorates liver injury and collagen deposition in
DMN-induced hepatic fibrosis rats
Liver pathological histology was determined in rats by H&E staining. As shown
in Fig. 4A, the structure of hepatic lobular was severely collapsed and
formed more complete pseudo-lobules, an abundance of inflammatory cells
infiltrated in the portal tract area, the central vein area, and the hepatic
sinusoid in DMN rats compared with the control rats. However, compared with the
DMN rats, these changes of liver histopathology in genistein-treated rats were
significantly improved. Serum biochemistry indices: AST, ALT, ALP, and TBA
levels, were also detected. As shown in Fig. 4C, the serum levels of AST, ALT,
ALP, and TBA were increased significantly by administration with DMN (p 0.001) and were evidently reduced by genistein treatment (p 0.05
or p 0.01). However, there was no significant difference in
sorafenib group, compared with the DMN group.
Fig. 4.
The effects of genistein on the liver injury and the collagen
deposition in the DMN-induced rats. (A) Representative images of H&E staining
(scale bar 100 m). (B) Representative histological images stained
with sirius red staining (scale bar 200 m). (C) Serum levels of
ALT, AST, ALP and TBA were measured in rats. (D) Sirius red-positive area (%)
was assessed by quantitative imaging of sirius red staining. (E) Hyp content in
liver was determined. p 0.001 vs control group.
p 0.001, p 0.01,p
0.05 vs DMN group. Alanine aminotransferase (ALT), aspartate
aminotransferase (AST), alkaline phosphatase (ALP), total bile acids (TBA),
hydroxyproline (Hyp).
In addition, the deposition of collagen fibers was evaluated by sirius red
staining. Compared with the control rats, several collagen fibers formed fibrous
septum, destroyed the structure of hepatic lobule, and formed pseudo lobule in
the liver with hepatic fibrosis (Fig. 4B). After genistein treatment, several
changes were improved. For instance, reduced collagen depositions and fibrous
septa were observed in these rats compared with the DMN-induced rats. Further,
sirius red-positive area was calculated to evaluate indirectly hepatic collagen
content. The result indicated that sirius red-positive area was obviously
decreased after genistein treatment, compared with the DMN model group
(p 0.05 or p 0.01; Fig. 4D). The liver tissue Hyp
content was further measured to estimate directly the collagen deposition in the
liver. The results were consistent with sirius red-positive area (p
0.01 or p 0.001; Fig. 4E).
4.4 Genistein regulates the expressions of -SMA, Col1A1,
MMP2/9, and TIMP1 in DMN-induced rats
Consistent with the in vitro experiments, the expressions of
-SMA and Col1A1 were also evaluated in vivo. As shown in Fig. 5A–C, at the protein levels, the expressions of -SMA and Col1A1 were
evaluated by immunohistochemistry, immunofluorescent, and Western blot assay. As
expected, immunohistochemistry and immunofluorescence results indicated that the
expressions of -SMA and Col1A1 were increased significantly in the
liver with DMN-induced rats and decreased significantly in the genistein group
(p 0.05 or p 0.01 or p 0.001). Similar
results were obtained by Western blot assay, in which genistein could clearly
reduce the expression of -SMA (p 0.05; Fig. 5D–F). The
mRNA expressions of -SMA and Col1A1 at transcription levels were
further confirmed by qRT-PCR, showing a significant increase in the DMN model
group (p 0.001) but a remarkable reduce in the genistein group
(p 0.05 or p 0.01 or p 0.001; Fig. 5G).
Fig. 5.
The effects of genistein on the expressions of HSC, MMPs and
TIMPs in the DMN-induced rats. (A,B) Immunohistochemistry assay was used to
determine the effects of genistein on the protein expression levels of
-SMA and Col1A1 in the liver (scale bar 100 m). (C)
Immunohistochemistry quantification of -SMA and Col1A1 protein with
positive area. (D,E) Immunofluorescence assay was performed to determine the
effects of genistein on the protein expression levels of -SMA and
Col1A1 in the liver (scale bar = 100 m), the nuclei were counterstained
with DAPI. (F) Western blot assay was applied to assess the protein expression
level of -SMA in the liver, protein expression was normalized against GAPDH
level. (G) qRT-PCR was performed to evaluate the effects of genistein on the
expression levels of Col1A1 and -SMA mRNA in the liver, the expression
levels of genes were normalized by GAPDH mRNA. (H) qRT-PCR was performed to
assess the effects of genistein on the expression levels of MMP9, MMP2 and
TIMP1 in liver, the expressions of genes were normalized by GAPDH mRNA.
p 0.001,p 0.01 vs control
group.p 0.001, p 0.01, p 0.05 vs DMN group.
MMPs and TIMPs are directly involved in the balance between synthesis and
degradation of ECM in the liver [24]. Thus, in the present study, MMP2, MMP9, and
TIMP1 at the levels of transcription were detected. The results indicated that
the elevated mRNA expressions of MMP2 and MMP9 in DMN-induced rats were reversed
after treatment by genistein (p 0.05; Fig. 5H). The expression of
TIMP1 mRNA was also enhanced with DMN administration (p 0.001) but
decreased in the genistein treatment group (p 0.05; Fig. 5H).
4.5 Genistein regulates inflammatory infiltration and macrophage
functional properties in rats induced by DMN
Liver fibrosis is an inflammatory response. Thus, inflammation related-factors
were evaluated at the transcriptional levels in this work. qRT-PCR results
indicated that the increased mRNA expressions of IL-1, IL-6,
TNF-, and MCP-1 in DMN-induced rats were decreased significantly by
genistein treatment (p 0.05 or p 0.01; Fig. 6A). We
investigated whether genistein could affect the distribution of both subtypes of
macrophage in the liver. The expression levels of CD68 (M1 macrophage marker),
CD163 and CD206 (M2 macrophage marker) in the liver were assessed by
immunofluorescence staining. As shown in Fig. 6B–E, the expression of CD68 was
evidently increased, but those of CD163 and CD206 were clearly decreased in the
DMN-treated rats (p 0.001). After genistein treatment, the
expression of CD68 was markedly decreased, and those of CD163 and CD206 increased
(p 0.05 or p 0.01 or p 0.001).
Fig. 6.
The effects of genistein on inflammatory infiltration and
macrophage functional properties in rats induced by DMN. (A) qRT-PCR was
performed to evaluate the effects of genistein on the mRNA expression levels of
IL-1, TNF-, IL-6 and MCP-1 in the liver, the expression of genes
were normalized by GAPDH mRNA. The expression levels of CD68 (B), CD163 (C) and
CD206 (D) protein were determined by immunohistochemistry (scale bar 100
m). (E) Immunohistochemistry quantification of CD68, CD163 and
CD206 protein with positive area. p 0.001,
p 0.01, p 0.05 vs control
group; p 0.001, p 0.01,p 0.05 vs DMN group.
4.6 Genistein inhibits the JAK2/STAT3/SOCS3 signaling pathway
JAK2/STAT3 and SOCS3 pathway plays an important role during liver fibrosis. In
the present study, the protein expressions of JAK2, STAT3, and SOCS3 and the
phosphorylation of JAK2 and STAT3 were detected. In vivo, the results
indicated that the expression levels of p-JAK2/JAK2 and p-STAT3/STAT3 were
clearly increased in rats with DMN-induced fibrosis (p 0.01,
p 0.001), but genistein could depress the expressions of p-JAK2/JAK2
and p-STAT3/STAT3 (p 0.01, p 0.001; Fig. 7A). The
expression of SOCS3 protein was also upregulated in DMN-treated rats (p 0.001). After genistein treatment, the expression of SOCS3 protein was
significantly inhibited (p 0.05; Fig. 7A). Interestingly, consistent
results were also obtained in TGF-1-activated LX2 cells in
vitro (Fig. 7B).
Fig. 7.
The effects of genistein on the JAK2/STAT3/SOCS3 pathway.
Western blot was used to assess the protein expression levels of p-STAT3, STAT3,
p-JAK2, JAK2, and SOCS3 (A) in the liver and (B) in LX2 cells were assessed by,
protein expression was normalized against GAPDH level. Data are shown as mean
SD.p 0.001, p 0.01
vs control group; p 0.001, p
0.01, p 0.05 vs DMN/TGF-1 group.
5. Discussion
Hepatic fibrosis is a common pathological consequence for diverse liver injuries
induced by chronic viral and metabolic disorders [1]. Effective drugs are not yet
available in clinic. Several studies have previously attempted to investigate the
anti-fibrosis effects of genistein, and liver injury and fibrosis were
significantly improved via genistein treatment in experimental models mediated by
D-galactosamine [25], carbon tetrachloride [26], schistosomiasis [27], and
methionine-choline-deficient diet [28]. However, these studies are focused on the
current understanding of the pharmacodynamics, and research about the mechanism
remains insufficient.
HSC proliferation and activation are closely related to the development of
fibrosis. In the present study, we first evaluated cell viability, proliferation,
and cell cycle arrest in LX2 cells. The inhibition of cell viability and
proliferation, the increase of G0/G1, and the reduction of S phase population
were observed in genistein-treated cells. Thus, the genistein-mediated
suppression of cell proliferation may be caused by cell cycle arrest, but the
mechanism remains to be explored in detail in future studies. Meanwhile, HSC
activation in LX2 cells was induced by TGF-1 stimulation, the elevated
expressions of -SMA and Col1A1 mRNA and protein were suppressed
substantially in genistein-treated cells, in which genistein could markedly
inhibit the activation of HSCs in vitro. Further, in vivo,
experimental hepatic fibrosis model in rats was established by the
intraperitoneal injection of DMN to evaluate the anti-fibrosis effects of
genistein. The results showed that genistein could ameliorate liver injury and
collagen deposition. Meanwhile, the mRNA and protein expressions of
-SMA and Col1A1 in the liver were consistent with those in
vitro. Therefore, genistein has a good therapeutic effect for the liver fibrosis
in vivo and in vitro models.
To research the possible mechanism of genistein on the synthesis and degradation
of ECM, we assessed the expressions of MMPs, and TIMPs in the liver. MMP2 and
MMP9 are the primary MMPs that degrade normal liver matrix, while its activity
is inhibited by TIMP1, a pivotal regulator in the remodeling of extracellular
matrix [6]. Although MMP2 and MMP9 can accelerate degradation of ECM and its
expressions are reduced in liver fibrosis, some studies also believe that the
expressions of MMP2 and MMP9 substantially increased because of the body’s
response to the degradation of excessive ECM during liver fibrosis [29, 30]. In
the present work, at the transcriptional levels, the elevated expressions of
MMP2, MMP9, and TIMP1 in the liver with DMN rats were obviously decreased by
genistein treatment. Therefore, genistein contributes to degradation of ECM by
regulating the expressions of MMPs and TIMPs.
Chronic liver inflammation plays a predominant role in the initiation and
progression of hepatic fibrosis [31, 32]. In the present study, inflammation
factors were evaluated at the transcriptional levels, the elevated expressions of
IL-1, IL-6, TNF-, and MCP-1 in DMN-induced rats were reduced
significantly by genistein treatment. In liver inflammation, intrahepatic
macrophages are the most important immune cells that exhibit high dynamic
plasticity, which allows them to adapt their phenotype in response to various
microenvironmental signals or stimuli [8]. They are generally delineated into two
major polarization states, namely, M1 and M2 macrophages. M1 macrophage display
pro-inflammatory properties and release pro-inflammatory mediators that
contribute to inflammation and injury in response to stimuli or polarization
signals [11, 33]. By contrast, M2 macrophage show anti-inflammatory properties
and release anti-inflammatory or pro-resolving mediators that accelerate wound
repair and tissue remodeling [33]. To explore the effects of genistein for the
functional properties of macrophage in hepatic fibrosis, we investigated the
expressions of pro-inflammatory M1 macrophage marker CD68 and anti-inflammatory
marker M2 macrophage CD163 and CD206 in the liver. The result showed that
genistein could inhibit the expression of CD68 but upregulate the expression
levels of CD163 and CD206. Therefore, genistein could regulate the functional
properties of macrophage to attenuate liver inflammation.
In previous studies, the mechanism of genistein against liver fibrosis was
limited to TGF-/Smad and NF-B pathways, so the discovery of
new mechanism is very important for genistein to treat this disease. JAK/STAT
pathway is key for various cytokines and growth factors in mammals [12]. During
liver fibrosis, the activation of JAK2/STAT3 pathway accelerates quiescent HSC
morphological trans-differentiation and the expression of pro-fibrotic genes
[13]. In the present study, JAK2/STAT3 pathway was activated by the
intraperitoneal injection of DMN in rats and TGF-1 stimulation in LX2
cells, whereas genistein could significantly inhibit the expressions of
p-JAK2/JAK2, and p-STAT3/STAT3. The increase of SOCS3 expression, an inhibitor
protein of STAT3 signaling that negatively regulate JAK/STAT pathways, was also
reduced by genistein treatment. Therefore, genistein inhibits the progression of
liver fibrosis possibly by suppressing JAK2/STAT3 pathway through regulating the
expression of SOCS3, but this result still needs further study.
Furthermore, the serum and liver levels of genistein should be measured to
establish concentrations that can be referred to as therapeutic. The contents of
genistein in the serum and liver tissue of DMN-induced fibrosis rats were
detected by LC-MS (Supplementary Fig. 1). The result is shown in
Supplementary Fig. 2, in which the contents of genistein in the liver
tissue of 5 mg/kg and 20 mg/kg genistein groups were successfully detected, and
the contents of genistein in the serum of genistein-20 mg/kg group were detected.
Notably, these samples were obtained approximately 24 h after the last oral
administration. This study aimed to effectively understand the exposure of
genistein in blood after oral administration genistein. The plasma concentration
vs time curves of genistein in rats after oral treated 20 mg/kg
genistein are shown in Supplementary Fig. 3. According of the
quantitative results, the pharmacokinetic parameters were calculated and
summarized in Supplementary Table 1. After oral treated 20 mg/kg
genistein, genistein was detected in rat plasma at different sampling points.
Genistein could be quickly absorbed into blood with T of 2 h and
Tof 2.20 0.33 h. Overall, these results suggest
that genistein has a good exposure in the blood or liver by oral administration.
6. Conclusions
In conclusion, the results presented here indicate that genistein efficiently
attenuates hepatic fibrosis induced by DMN in rats, and this condition may be
related to the regulation of the functional properties of macrophage and
JAK2/STAT3/SOCS3 signaling pathway.
7. Author contributions
YX and DZ performed the experiments, analyzed the data and wrote the manuscript.
HY, YL, LZ, CZ, GC and YH assisted with the experiments. JC, HZ and YM critically
revised the manuscript. PL and WL designed the research, conceived the ideas, and
revised the manuscript. All authors read and reviewed the manuscript.
8. Ethics approval and consent to participate
The animal study was reviewed and approved by the Animal Ethics Committee of
Shanghai University of Traditional Chinese Medicine (PZSHUTCM190322007; Approval
date: July 27, 2018).
9. Acknowledgment
Not applicable.
10. Funding
This work was supported by the National Natural Science Foundation of China (No.
82004162, 81703681 and 81530101), “Chen Guang” project supported by Shanghai
Municipal Education Commission and Shanghai Education Development Foundation (No.
20CG50), Young Elite Scientists Sponsorship Program by CAST (No. 2020QNRC001),
Shanghai Sailing Program (No. 17YF1419800 and 20YF1449500), China Postdoctoral
Science Foundation (No. 2020M681367). Budget project of Shanghai University of
traditional Chinese medicine (No. 2020LK029).
11. Conflict of interest
The authors declare no conflict of interest.