Article Metrics

  • Fig. 1.

    View in Article
    Full Image
  • Fig. 2.

    View in Article
    Full Image
  • Fig. 3.

    View in Article
    Full Image
  • Fig. 4.

    View in Article
    Full Image
  • Fig. 5.

    View in Article
    Full Image
  • Fig. 6.

    View in Article
    Full Image
  • Fig. 7.

    View in Article
    Full Image
  • Information

  • Download

  • Contents

Abstract

Background: It remains largely unclear about the function of 5-methylcytosine (m5C) RNA modification in the context of abdominal aortic aneurysm (AAA). In this regard, the present work focused on investigating m5C RNA methylation and related modulator expression levels in AAA. Materials and methods: To this end, we quantified the m5C methylation levels in AAA tissues (n = 32) and normal aortic tissues (n = 12) to examine the mRNA m5C status and m5C modulator expression at mRNA and protein levels. Meanwhile, modulator localization within AAA tissue samples was detected by immunohistochemistry (IHC). Moreover, RNA immunoprecipitation-sequencing (RIP-seq) was also used to analyze the lncRNAs and mRNA binding to Aly/REF, as an m5C reader. Results: m5C expression markedly elevated in AAA in comparison with normal aortic samples in the AAA cases. The major 5-methylcytosine modulators, including NSUN2, NSUN5, and Aly/REF, which represented the major parameters related to the abnormal m5C modification level, were observed up-regulating in AAA tissues at both protein and mRNA levels. In addition, NSUN2 mRNA level remarkably related to Aly/REF expression, and they were co-expressed in the same cells in AAA group. Regarding the cellular location, Aly/REF was associated with inflammatory (CD45+, CD3+) infiltrates. Simultaneously, after screening for reads in AAA tissue compare with anti-Aly/REF group relative to IgG as control, we obtained totally 477 differentially expressed Aly/REF-binding lncRNAs and 369 differentially expressed Aly/REF-binding mRNAs in AAA tissue. The functions of Aly/REF-interacting lncRNA were involved in immune system process and macrophages infiltration. Through regulatory network (lncRNA-mRNA) analysis, our findings predicted the potential mechanism of Aly/REF-induced lncBCL2L1 and Aly/REF-lncFHL1 axis in AAA and inspire the understanding of m5C and lncRNA in AAA. Conclusions: This study is the first to examine m5A modification within human AAA samples. Our results indicate that m5C modulators, namely, Aly/REF and NUSN2, play vital parts in the human AAA pathogenic mechanism, which shed new lights on the function of m5C modification within AAA. Taken together, findings in this work offer a possible RNA methylation modification mechanism within clinical AAA.

2. Introduction

Abdominal aortic aneurysm (AAA) accounts for a primary cause leading to cardiovascular event among the old male population [1, 2]. AAA is featured by the local while persistent abdominal aortic weakening and expansion [3], and it may be symptomatic, asymptomatic, or may present as rupture. The open retroperitoneal or transperitoneal selection operation has been the frequently adopted repair method [4]. Nonetheless, it is now suggested that the placement of the endoluminal stent graft in aneurysm may be applied in replacement of open intervention [5, 6]. There is no effective pharmacological treatment capable of limiting AAA progression or avoiding AAAs rupture. So far, pharmacological intervention is unavailable, while monitoring aneurysm size prior to operation is the only choice [7].

The pathogenic mechanism of AAA has been suggested to be complicated and multifactorial. In previous studies, AAA is suggested to be related to the deficient adventitial/medial arterial layers, like fibroblasts and smooth muscle cells (SMCs). Recent research with either human tissue or animal models has led to a shift regarding AAA, and AAA development is now considered to be part of a significant and dynamic remodeling process in the vessel [8]. Moreover, the critical pathological features are vascular inflammation [9], oxidative stress (OS) [10], aortic extracellular matrix (ECM) destruction [11], and aortic wall thinning due to vascular smooth muscle cell (VSMC) losses [12].

Epigenetic alterations, such as DNA methylation [13], histone modification [14] or RNA modification [15], has been found to exert vital parts in AAA due to their strong impacts on regulating gene levels. N6-methyladenosine (m6A) has been well investigated and most frequently observed in mRNA, which is found to be related to pre-mRNA translation, processing, mRNA decay and miRNA biogenesis. m6A modifications are reversible and dynamic among mammalian cells, and they are suggested to be the other epigenetic regulating layer associated with histone and DNA modifications [16, 17]. Our recent study has reported that aberrant RNA epigenetic modifications, such as m6A RNA methylation, are present in AAA [18]. The above results can shed novel lights on the AAA pathogenic mechanism.

Compared with m6A modification, 5-methylcytosine (m5C) is rarely investigated. m5C may be discovered in mRNA, tRNAs, rRNAs and recently poly(A)RNAs. It represents the abnormal RNA modification existing in various RNA species, such as numerous non-coding RNAs (ncRNAs), mitochondrial and cytoplasmic ribosomal RNAs (rRNAs), enhancer RNAs (eRNAs), transfer RNAs (tRNAs) and messenger RNAs (mRNAs) [19, 20]. m5C is a vital factor to regulate gene expression, like ribosomal assembly, RNA export, RNA stability and translation [21, 22, 23].

Hence in this study, we focused on the function of m5C mRNA modification involved in human AAA tissues, and detected m5C mRNA methylation level as well as related modulator expression. In addition, this study examined the relationship of m5C modification with the clinical data of patients. Moreover, RNA immunoprecipitation-sequencing (RIP-seq) was also used to analyze the lncRNAs and mRNA binding to Aly/REF, and to investigate the role of m5C RNA methylation in progression of AAA.

3. Materials and methods
3.1 China Medical University Aneurysm Biobank and tissue collection

This study obtained human AAA tissue and relevant peripheral blood samples from altogether 147 consecutive cases at the Department of Vascular Surgery, The First Hospital of China Medical University (CMU) following the open operation for aneurysm according to previous description from January 2009 to December 2020 [18, 24]. In addition, each case provided the informed consent for participation. All human AAA samples were collected in line with guidelines from the World Medical Association Declaration of Helsinki. The Ethics Committees of the First Hospital of CMU approved our study protocol (ethical approval number: 2019-97-2).

We collected aneurysm tissues from 147 Chinese AAA cases at the time of emergency or elective open surgical repair. In addition, we obtained the clinical and history data from all patients, like medication history, rupture history, peripheral/coronary artery disease history, or risk factors like hypertension, smoking, hyperlipidemia and diabetes mellitus (DM). Meanwhile, patients with concurrent Marfan syndrome, Ehlers-Danlos syndrome, or additional identified connective tissue or vascular diseases were excluded from this study. Within 147 AAAs, for present study, 32 AAA tissues (28 male patients and 4 female patients) were available for further analyses. For inclusive 32 AAA patients, AAA was analyzed by computed tomography angiography (CTA). For all AAA cases, their diameter of infra-renal abdominal aorta was over 30 mm or 1.5–2 folds as high as the abdominal aorta diameter in corresponding normal segment [25] under CTA diagnosis. Furthermore, the included patients had no evidence or medical history of any cancer disease.

Over the same period, abdominal aorta samples from 12 heart-beating brain-dead organ donors (10 males and 2 females) were used as the controls. For controls, those with concurrent drug history, cancer, infection and additional immune-related disorders potentially affecting this work were excluded.

3.2 RNA extraction and total mRNA m5C level determination

TRIzol reagent (TaKaRa Bio, Shiga, Japan) was utilized to extract total mRNA from aortic tissues according to the standard protocol as described previously. The extracted total mRNA was used to directly detect the m5c RNA methylation level by adopting the fluorometricm m5C RNA methylation ELISA kit (Epigentek, Farmingdale, NY, USA). Briefly, a pipette was utilized to add mRNA (200 ng) in the detection wells. Later, an m5C detection complex solution with a specific m5c antibody was added to the wells. After washing, the wells were added with fluorescence development solution for incubation under ambient temperature away from direct light. The fluorescence development solution will turn pink in the presence of sufficient m5c products. The fluorescence was read on a fluorescence microplate reader within 2 to 10 min at 530EX/590EM nm. Then, the mRNA m5C methylation level was assessed through the m5c-modified mRNA proportion in overall mRNA (m5C%) following the specific instructions.

3.3 Quantitative real-time PCR analysis

For the high-quality RNAs, their A260/A280 ratio was greater than 1.8. The PrimeScript RT Master Mix (Q711-02/03, Vazyme Biotech, Nanjing, China) was used to synthesize cDNA from total mRNA, and the Universal SYBR qPCR Master Mix (Q711-02/03, Vazyme Biotech, Nanjing, China) was utilized to conduct quantitative real-time PCR (qRT-PCR) in LightCycler 480 system (Roche Molecular Systems, Indianapolis, IN, USA) in accordance with the amplification protocols after modification. The PCR conditions were as follows, 30 s of initial denaturation under 95 C; followed by 5 s of denaturation under 95 C, and 30 s of annealing and 30 s of extension under 60 C for 40 cycles. RT-PCR was conducted for twice or more for all samples. GAPDH served as the internal control. Each primer was provided by Sangon (Shanghai, China): NSUN1, NSUN2; NSUN5, NSUN6, Dnmt1 and Aly/REF, and their sequences are shown in Table 1. An improvement of the 2ˆ (–delta delta CT) method for quantitative real-time polymerase chain reaction data analysis.

Table 1.Primer sequences used for reverse-transcription polymerase chain reaction.
Gene Forward primer Reverse primer
NSUN1 AAGGGTGCCGAGACAGAACT GAGCACGACTAGACAGCCTC
NSUN2 CAAGCTGTTCGAGCACTACTAC CTCCCTGAGAGCGTCCATGA
NSUN5 CGCTACCATGAGGTCCACTAC GCATCTCGCACCACGTCTT
NSUN6 TCTCAGCCCTTCATTTGACAGT TCCAGTGCTATAACTTCTCCCTG
Dnmt1 TGCCAAGACGATTGAAGGCAT GCAGGGAGGGCTCATTAAAAT
Aly/REF TATGATCGCTCTGGTCGCAG AGAGGGACGCCGTTGTACT
GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC
3.4 Western blotting analysis

The RIPA-based reagents were utilized to extract proteins from fresh frozen tissues in line with specific instructions; later, the concentration of each sample was measured by a Pierce BCA Protein Assay kit. The samples were isolated through SDS-PAGE, followed by transfer onto PVDF membranes. Afterwards, membranes were blocked using skimmed milk and incubated using suitable primary as well as secondary antibodies. Later, the ECL detection system was employed for membrane developing in line with specific instructions. GAPDH was used for normalization. In the present work, the following primary antibodies were utilized, anti-Aly/REF (ab202894; Abcam, Cambridge, UK; dilution 1:1000) and anti-NSUN2 (Cat. No. 20854-1-AP; Proteintech, Wuhan, China; dilution 1:1000) and anti-GAPDH (dilution 1:2000; Zsbio, Beijing, China). The densitometry was performed with Image J software (Java 1.8.0_172, National Institutes of Health, Bethesda, Rockville, MD, USA) and normalized to the signal intensity of GAPDH for equal protein loading control of each sample in each experiment.

3.5 Histological and Immunohistochemical (IHC) analyses

The typical 2–3-μm aortic tissue sections were utilized to carry out histological and IHC analyses. In brief, we used hematoxylin-eosin (HE) to stain paraffin-embedded sections for assessing the inflammatory cell composition, morphology and infiltration extent in each AAA sample according to previous description [14].

In IHC assay, antigen retrieval was performed through boiling tissue sections in sodium citrate solution (pH = 6.0), after washing, suitable antibodies were used to treat the sections, then they were deparaffinized and hydrated. To analyze cells within AAA wall, endothelial cells (ECs) were analyzed by anti-CD34 (1:100; Proteintech, Wuhan, China), SMCs were measured through anti-α-SMA (1:400; Absin, Shanghai, China), T-lymphocytes were detected through anti-CD3 (1:800; Absin Bioscience, Shanghai, China), while leukocytes were examined by anti-CD45 (1:500; Proteintech, Wuhan, China). In addition, m5c modulator expression within AAA tissues was detected by adopting anti-Aly/REF and anti-NSUN2 in line with specific protocols.

The Nikon ScanScope 90i system (Nikon, Melville, NY, USA) was used to obtain the digital images of the stained tissues (slides). To be specific, the settings for digital image capturing were 20×/40× magnification and 5-slide load capacity for the 90i system.

To conduct standard and traditional staining, the extent of calcification and cellularity of vascular wall were characterized for histological classification. Thereafter, basic cell count and related cell intensity were used to evaluate the grade, such as new vessel formation, infiltrates and SMCs.

To determine the expression of biomarkers in single cells in aneurysms, we made successive slides of every sample and incubated them using appropriate antibodies. In all cases, one slide was stained with an antibody to detect a certain cell type; thereafter, the anti-biomarker antibodies were used to stain the successive slides.

3.6 Immunofluorescence (IF) staining of NSUN2 and Aly/REF

In brief, typical 2–3-μm paraffin-embedded sections were subjected to deparaffinate and rehydration with gradient ethanol, followed by boiling within citrate buffer (pH = 6.0) for retrieving the antigen epitopes, rinsing by PBS, and overnight incubation using the rabbit anti-Aly/REF antibody (1:400; Abcam, Shanghai, China) under 4 C within the humid chamber. After rinsing by Tris-buffered saline thrice, the Alexa Fluor® 488 (green) affiniPure fab fragment goat anti-rabbit antibody (dilution 1:400; Jackson ImmunoResearch Laboratories, West Grove, NJ, USA) was used to incubate the sections for an hour. Then sections were washed 3 times with Tris-buffered saline, and incubated with rabbit anti-NSUN2 antibody (dilution 1:100; Proteintech, Wuhan, China) overnight at 4 C in a humidified chamber. Sections were washed 3 times with Tris-buffered saline and incubated with CY3 (red) conjugated goat anti-rabbit antibody (dilution 1:300; Servicebio, Wuhan, China) was used to further incubate the membranes for 1 h. The sections were washed 3 times again, and stained by DAPI. At last, the confocal microscope (Nikon CI plus, Tokyo, Japan) was used to obtain sections.

3.7 RNA Immunoprecipitation sequencing (RIP-seq)

First of all, the Magna RIP™ RNA-binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) was utilized for RIP-seq in line with specific instructions. In brief, after coating with 10 μg anti-Aly/Ref antibody (ab202894, Abcam, Cambridge, UK) or corresponding IgG antibody (Millipore, Billerica, MA, USA), cell lysates were used to incubate the coated magnetic beads overnight under 4 C. Later, the proteinase K digestion buffer was used to treat the RNA-protein complexes. Thereafter, the phenol: chloroform: isoamyl alcohol was used to purify the coprecipitated RNAs, and the RNA content and purity were analyzed by adopting NanoDrop 2000c [26]. Additionally, we eliminated rRNAs out of the immunoprecipitated RNAs; later, the rRNA-depleted RNAs were used to input RNA samples through the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs, Inc., Ipswich, MA, USA) in accordance with specific protocols. In addition, the BioAnalyzer 2100 system (Agilent Technologies, Inc., Palo Alto, CA, USA) was utilized to analyze the quantity and quality of libraries. At last, we loaded the clustered libraries on the reagent cartridge to carry out sequencing using the illumina Hiseq 4000 (Illumina, San Diego, CA, USA) system by the use of 150 bp paired-end reads. Then, Q30 was utilized for quality control. Finally, the Cloud-Seq Biotech (Shanghai, China) was applied in RIP-RNA-Seq high-throughput sequencing.

With regard to mRNA and lncRNA, we used hisat2 software to align high-quality reads to human reference genome (UCSC hg19). Thereafter, we adopted Cuffdiff (version 2.1.0: http://cole-trapnell-lab.github.io/cufflinks/) for obtaining the fragments per kilobase of transcript per million mapped reads (FPKM) under the guidance of Ensembl gtf gene expression profiles, which were the mRNA and lncRNA expression profiles [27]. Further, we determined p-values and fold changes (FCs) according to FPKM, and discovered the differentially expressed mRNAs and lncRNAs. The target genes of lncRNAs were estimated according to their locations relative to adjacent genes. Additionally, the predicted target genes were subjected to GO (www.geneontology.org) and KEGG (www.genome.jp/kegg) enrichment to determine the major functions and related pathways involved in differentially expressed mRNAs and lncRNAs on the basis of differentially expressed mRNAs.

3.8 LncRNA and mRNA interaction network analysis

Since the expression of lncRNAs shows significant relation with the surrounding protein encoding genes, numerous lncRNAs play roles of the cis regulators [28]. LncRNA and its adjacent mRNAs were integrated and differentially expressed in the biome to explore the function of lncRNA. LncExpDB (https://ngdc.cncb.ac.cn/lncexpdb) estimates lncRNA genes’ expression reliability and capacities, used for the lncRNA-mRNA interaction network analysis.

3.9 PPI network construction and visualization

PPI networks can offer precious data about cell functions or the signal transduction pathways. In this study, we searched the interactions of DEGs-encoded proteins through the Search Tool for the Retrieval of Interacting Genes/Proteins (http://string-db.org/) online database. Thereafter, the PPI network was built using 5 calculation algorithms (EPC, Degree, EcCentricity, MNC and MCC) and visualized using Cytoscape (http://cytoscape.org/). At last, those overlapping genes obtained by the above 5 algorithms encoded core proteins that had vital biological regulatory activities.

3.10 Statistical analysis

Statistical analysis was completed using SPSS22.0 (SPSS Inc., Chicago, IL, USA). Differences among the categorical variables were compared by chi-square test between groups. In addition, the one-sample Kolmogorov-Smirnov test was used to examine the distribution of data. Later, the non-parametric Mann–Whitney U test or parametric t-test for unpaired samples was used for analysis according to variable distribution. Thereafter, partial correlation analysis was conducted to examine the associations among continuous variables after adjusting for smoking, age and sex. Correlations between continuous variables were quantified by using Spearman’s rank correlation coefficient. A difference of p< 0.05 suggested statistical significance.

4. Results
4.1 Characterization of AAA subjects and histological analysis

Table 2 presents the clinical and demographic data of AAA cases and normal subjects. For AAA cases, their age ranged from 43 to 86 years, and the average AAA maximum diameter was found to be 69.25 ± 20.37 mm. None of the control subject (age ranged 41 to 73) showed any signs of atherosclerosis and no evidence or medical history of aneurysm and the other vascular disorders was known. Age, sex, and body mass index (BMI) were comparable between two groups. At the same time, differences in concurrent diseases, i.e., Hypertension, hyperlipidemia, and renal diseases, were not significant.

Table 2.Demographic and clinical characteristics of AAA patients and controls group included in this study.
Characteristics AAA group (N = 32) Control group (N = 12) p
Baseline n mean ± SD (%) n mean ± SD (%)
Age, Year 32/32 61.94 ± 8.38 12/12 58.67 ± 10.72 0.279
female 4/32 12.50% 2/12 16.67% 0.529
BMI 31/32 25.75 ± 4.37 11/12 24.41 ± 5.58 0.344
maximum AAA diameter, mm 32/32 74.23 ± 4.44 NA NA NA
Comorbidity
Hypertension 17/32 53.13% 5/12 41.67% 0.368
Smoking 18/31 58.06% 5/12 41.67% 0.265
Hyperlipidemia 5/32 15.63% 1/12 8.33% 0.471
Diabetes mellitus 1/32 3.13% 0/12 0% 0.727
Cardiac disease 4/31 12.90% 1/12 8.33% 0.569
Renal disease 2/31 6.45% 0/12 0% 0.515
Medication use 10/32 31.25% 1/12 0% 0.118
Note, AAA, abdominal aortic aneurysm; SD, standard deviation; BMI, body mass index; NA, not available.

The symptoms of the AAA patients are summarized in Table 2. Altogether 22% AAA cases had aneurysmal rupture, whereas 5 out of the 32 cases had iliac aneurysms. Among AAA cases, each AAA sample was semi-quantitatively and histologically characterized for evaluating each histopathological characteristic degree within AAA wall as previously [14]. In Table 3, IHC was used to differentiate between the four main cell types in AAAs, i.e., endothelial cells, lymphocytes, macrophages, and smooth muscle cells to assess the extension of the individual histopathological features in AAA wall.

Table 3.Histological characterization of all AAA tissue samples.
No. Abdominal pain Pulsating sensations in the abdomen Comorbidity-Iliac artery aneurysms Ruptured AAA Cellularity (HE) Infiltrates (CD45) Macrophages (CD68) SMCs (α-SMA) Neovessel (CD34)
A1 + +/++ + (+/++) ++ + (+/++)
A2 +/– + + (+/–) +/++ +/++
A3 + + –/+ ++/+++ +/–
A4 +/++ ++++ + (+/–) +/++ +++
A5 ++ +/– ++ +/– –/+
A6 +/++ +/++ +/– +++
A7 +/++ ++++ ++ ++ (+/++) +/++
A8 +/– +/++ –/+ + +
A9 + ++ +/– + (+/–)
A10 +/– +/– + +/– –/+
A11 +/++ +++ + + ++/+++
A12 + +/++ –/+ +/– +/++
A13 ++ + + (+/–) +/++ –/+
A14 + ++++ +/– +/– +/–
A15 +/++ ++++ + (+/–) + +/++
A16 + +/++ +/– +/++ +/–
A17 + ++ (+/++) + (+/–) +/++ +/++
A18 +/– +++ + + (+/–) +
A19 ++ +/++ + +++
A20 + + +/– ++ ++
A21 + +/– + + (+/–) –/+
A22 ++ +++ –/+ + ++
A24 +/++ ++ + +/++ +
A25 +/– +++ –/+ +/++ +/–
A26 + + +/++ + +/++
A27 + +++ +/++ + –/+
A29 +/– + ++ +/++ + (+/–)
A30 + +/– +/++ +/++ +
A31 +/– +++ ++ +/– + (+/–)
A32 + ++ (+/++) + +/– –/+
A33 +/++ + –/+ + +++
4.2 Increased m5c mRNA methylation occurred in AAA tissue samples

According to our analysis, relative m5c mRNA methylation level within AAA tissues showed significant correlation with an increased m5c proportion in the overall mRNA relative to controls (more than 1.5-fold; p = 0.040; Fig. 1A).

Fig. 1.

Expression of m5C RNA methylation status (A) and m5C methylation modulators (B, C, D, E, F, and G) at the mRNA level in AAA tissue samples compared with the healthy control aortas analyzed by qRT-PCR. The non-parametric Mann-Whitney U test was all applied to analyze the m5C methylation ratio (A); the m5C “writers” family, NSUN1 (B), NSUN2 (C), NSUN5 (D), NSUN6 (E), Dnmt2 (F); and “readers” family Aly/REF (G). The expression of individual m5C RNA methylation modulators related to the expression of GAPDH set as 1 (100% expression). *, p< 0.05; **, p< 0.01. m5C, 5-Methylcytosine RNA methylation; AAA, abdominal aortic aneurysm; qRT-PCR, quantitative real-time polymerase chain reaction; ns, not significant.

4.3 The mRNA expression of m5c modulators in AAA tissue samples and association with clinical data

Thereafter, certain typical molecules that might be related to m5C mRNA modification were analyzed for their expression at mRNA level, including NSUN1, NSUN2, NSUN5, NSUN6, Dnmt2 and Aly/REF (Fig. 1B–G). In the current study, the mRNA expressions of NSUN2, NSUN5 and Aly/REF were observed up-regulating in the AAA tissue samples relative to matched normal tissues (>2 folds, p = 0.037; 2 folds, p = 0.035; 2 folds, p = 0.046). Differences in NSUN1, NSUN6 and Dnmt1 mRNA levels were not significant (p = 0.645, p = 0.136 and p = 0.448).

4.4 The correlations among the mRNA m5C status and mRNA expression levels of m5Cc modulators in AAA tissue samples

According to our results, the m5C% in total mRNA was significantly correlated with NSUN2, NSUN5 and Aly/REF expression levels (R = 0.316, 0.320, and 0.312 respectively, and p = 0.039, p = 0.037 and p = 0.042, respectively; Table 4). Afterwards, the associations of mRNA expression were examined. As a result, NSUN2 mRNA expression showed significant relationship with the expressions of NSUN5 and Aly/REF (R = 0.538, p < 0.001 and R = 0.464, p = 0.002 respectively). Aly/REF expression significantly correlated with NSUN1, NSUN5, and NSUN6 (R = 0.313, 0.642 and 0.339; p = 0.041, p < 0.001 and p = 0.026, respectively) Table 4.

Table 4.The correlations among m5C status and m5C modulators.
m5c NSUN1 NSUN2 NSUN5 NSUN6 Dnmt1 Aly/REF
m5c -
-
NSUN1 –0.264 -
0.087 -
NSUN2 0.316* 0.209 -
0.039 0.18 -
NSUN5 0.320* 0.218 0.538** -
0.037 0.16 <0.001 -
NSUN6 –0.145 0.451** 0.287 0.410** -
0.352 0.002 0.062 0.006 -
Dnmt1 –0.099 0.470** 0.143 0.349* 0.673** -
0.527 0.001 0.361 0.022 <0.001 -
Aly/REF 0.312* 0.313* 0.464** 0.642** 0.214 0.339* -
0.042 0.041 0.002 <0.001 0.169 0.026 -
Note, significant correlation: *p < 0.05, **p < 0.01, ***p < 0.001.

Thereafter, the associations of m5C modulator expression levels with clinical features were analyzed. Similarly, the expression of NSUN1, NSUN2, NUSN5, NSUN6 and Dnmt1 positively correlated to platelet hematocrit (PCT) (R = 0.429, 0.429, 0.462, 0.494, and 0.537; p = 0.016, 0.016, 0.009, 0.005, and 0.002, respectively).

NSUN5, NSUN6, and Dnmt1 expression significantly correlated to platelets count (PLT) (R = 0.443, 0.456, and 0.382; p = 0.013, 0.010, and 0.034, respectively). The expression of NSUN1 and NSUN5 at mRNA level were negative associated with mean corpuscular volume (MCV), the correlation coefficient was –0.470 and –0.419 (p = 0.008 and 0.019 respectively) in Fig. 2.

Fig. 2.

Correlation among the mRNA expressions of m5C modulators and clinical parameters. Partial correlation analysis was adjusted with age, gender, BMI, and smoking. BMI, body mass index; LY, lymphocyte; WBC, white blood cell; MONO, monocyte; EO, eosinophils; BASO, basophil; RBC, red blood cell; HGB, hemoglobin; HCT, hematocrit; MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; RDWCV, red blood cell volume distribution width; MCHC, mean corpuscular hemoglobin concentration; PLT, platelets; PDW, platelet distribution width; PCT, platelet hematocrit; MPV, mean platelet volume; Ca, serum calcium; K, serum kalium; Cr, creatinine; Cl, serum chlorine; Mg, serum magnesium; Na, serum sodium; GLU, fasting plasma glucose; P, serum phosphate; GGT, gamma glutamyl transpeptidase; ALB, albumin; ALT, alanine aminotransferase; LDL-C, low-density lipoprotein-cholesterol; TG, triglycerides; HDL-C, high-density lipoprotein-cholesterol; CK, creatine kinase; LDH, lactate dehydrogenase; AST, aspartate aminotransferase; TC, total cholesterol; AG, anion gap; CHE, cholinesterase; PA, pre-albumin; CysC, cystatin C; ALP, alkaline phosphatase; TBA, total bile acid; TBIL, total bilirubin; TP, total protein; PT, prothrombin time; Fg, fibrinogen; APTT, activated partial thromboplastin time; PTA, prothrombin activity; INR, international normalized ratio; DD, D-dimer; TES, testosterone; AND, androgen; DHS, dehydroepiandrosterone; F-TEST, free testosterone; SHBG, sex hormone-binding globulin; Hcy, Homocysteine.

4.5 The protein expressions of mRNA m5C modulators and their cellular colocalization in AAA tissues

We selectively performed western blot analysis for NSUN2 and Aly/REF, because their roles on the 5-mC modification in mRNA, their expressions at mRNA levels and their interrelatedness with mRNA m5C status in human AAA tissue samples. Fig. 3A displays the representative images of NSUN2 and Aly/REF expression levels measured through Western blotting (Supplementary Fig. 1). Aly/REF and NSUN2 protein expression markedly increased within AAA tissues relative to normal controls (more than 1.5-fold for both comparison; p = 0.039, and p = 0.003, respectively; Fig. 3B,C).

Fig. 3.

Protein level of Aly/REF and NUSN2 are highly expressed in human abdominal aortic aneurysm (AAA). The representative images of blots between AAA and healthy aortas at the protein level (A); The density of the protein signals for Aly/REF (B) and NUSN2 (C) through the non-parametric Mann-Whitney U test quantification of the band intensities relative to the expression of GAPDH. *, p< 0.05; **, p< 0.005. The representative photographs of immunohistochemical staining for NSUN2, Aly/REF (D) and individual cell types markers in AAA tissue. Scale bar, 50 μm. AAA, abdominal aortic aneurysm; α-SMC, smooth muscle cell; CD34, endothelial cell and neovascularization; CD45, leukocytes; CD3, T lymphocytes. (E) Confocal immunofluorescence for human AAA sections stained with NUSN2, Aly/REF and 4’, 6-diamidino-2-phenylindole (DAPI). AAA, specimens of abdominal aortic aneurysm (N = 32). Ctrl, control healthy aorta (N = 12).

Similarly, significantly increased expressions of NSUN2 and Aly/REF were also observed in AAA tissue samples, both were observed in the healthy aorta tissue through IHC analysis, date was not shown. Additionally, we examined the colocalization of NSUN2 and Aly/REF within the successive sections by IHC. As a result, NSUN2 staining showed weak colocalization with CD34+ ECs, and strongly with CD45+ leukocytes and CD3+ T lymphocytes. Aly/REF also showed strong colocalization with CD3+ T lymphocytes and CD45+ leukocytes (Fig. 3D).

Later, the AAA wall and normal aortic wall co-localization of Aly/REF with NSUN2 was examined using IF analysis (Fig. 3E). Here, we also observed that the expressions of NSUN2 and Aly/REF were higher in AAA sections compared with the controls. The result is similar to the results of western blot analysis and IHC analysis. Furthermore, for the co-localization analysis, NSUN2 and Aly/REF were co-expressed in the one cell in AAA group (Fig. 3E).

4.6 RIP-seq Identifies Aly/REF-interacting lncRNAs in AAA

The possible Aly/REF target genes were predicted by RIP-seq assay. lncRNAs have the length of over 200 nucleotides (nt). In addition, this study analyzed those known lncRNAs for their length distribution. As a result, there were markedly more lncRNAs with the length of 500–1000 and >3500 bp compared with those with additional lengths. Here, using RIP-seq, we detected a total of 36,224 lncRNAs in human AAA tissue. Afterwards, reads 1.0 or those with an anti-Aly/REF group to IgG control enrichment ratio >1.5 were screened; finally, 477 lncRNAs that bound to Aly/REF were discovered within AAA samples. For those upregulated lncRNAs, distributions among the human chromosomes were also illustrated in Fig. 4A. A total of 221 intergenic, 20 intron sense overlapping, 136 exon sense overlapping, 38 natural antisense, 43 intronic antisense, 19 bidirectional lncRNAs were identified (Fig. 4B), the lncRNA length of Aly/REF binding lncRNAs (Fig. 4C); and relationship of Aly/REF binding lncRNAs (Fig. 4D).

Fig. 4.

The results demonstrated that 477 differentially expressed genes Aly/REF-binding lncRNAs in AAA tissue. The locus, genomic locus, chromosome of Aly/REF binding lncRNAs (A); thebiotype of Aly/REF binding lncRNAs (B); the lncRNA length of Aly/REF binding lncRNAs (C); and relationship of Aly/REF binding lncRNAs (D) in abdominal aortic aneurysm tissue. Note, exon sense-overlapping: the LncRNA’s exon is overlapping a coding transcript exon on the same genomic strand; intron sense-overlapping: the LncRNA is overlapping the intron of a coding transcript on the same genomic strand; intronic antisense: the LncRNA is overlapping the intron of a coding transcript on the antisense strand; natural antisense: the LncRNA is transcribed from the antisense strand and overlapping with a coding transcript; bidirectional: the LncRNA is oriented head-to-head to a coding transcript within 1000 bp; intergenic: there are no overlapping or bidirectional coding transcripts nearby the LncRNA.

GO analysis indicated that the functions of Aly/REF-interacting lncRNA were involved in a variety of biological processes, including immune system process and macrophages infiltration, i.e., macrophage cytokine production (GO:0010934), immune system process (GO:0002376) for Biological Process; MHC class I protein complex (GO:0042612), platelet alpha granule (GO:0031091) for Cellular Component; and MHC class I protein binding (GO:0042288), MHC protein binding (GO:0042287) for Molecular Function (Fig. 5).

Fig. 5.

Go analysis of 477 differentially expressed genes Aly/REF-binding lncRNAs in AAA tissue. Fold enrichment in biological process (A), cellular component (B), and molecular function (C); The enrichment score in biological process (D), cellular component (E), and molecular function (F).

KEGG pathway analysis indicated the up-regulation of 26 pathways, mainly including ECM-receptor interaction (KEGG: hsa04512), PPAR (KEGG: hsa03320) and phagosome (KEGG: hsa04145) signal transduction pathways, suggested that dysregulated lncRNA pathways in Aly/REF were closely associated with signal transduction in AAA tissue (Supplementary Fig. 2). Based on the FC, the top 20 dysregulated lncRNAs are summarized in Table 5. Among these dysregulated lncRNAs, distributions among the human chromosomes were also illustrated.

Table 5.General information of top 20 ranked regulated long non-coding RNAs by Aly/REF-binding.
No. Transcript ID Biotype Strand Gene ID Chromosome LncRNA Source LncRNA length Relationship Association gene name
1 ENST00000416191 antisense + ENSG00000258486 chr14 Ensembl 297 bidirectional RPS29
2 ENST00000598952 misc RNA ENSG00000265150 chr14 Ensembl 297 intergenic
3 uc003ine.3 lincRNA ENSG00000260402 chr16 Ensembl 2484 intergenic
4 ENST00000473958 misc RNA ENSG00000200488 chr2 Ensembl 332 intergenic
5 TCONS_l2_00025918 misc RNA + ENSG00000265735 chr9 Ensembl 288 intronic antisense PTPRD
6 uc009ykc.1 lincRNA + ENSG00000224934 chr10 Ensembl 2998 bidirectional GOT1
7 ENST00000455068 antisense + ENSG00000269296 chr19 Ensembl 3653 natural antisense ZNF780A
8 ENST00000493013 long noncoding BC039551 chr4 UCSC knowngene 1124 intronic antisense FHDC1
9 TCONS_00004186 antisense + ENSG00000244300 chr3 Ensembl 722 intronic antisense GATA2
10 ENST00000565978 long noncoding SNHG10 chr14 RefSeq 1980 bidirectional GLRX5
11 ENST00000510986 antisense ENSG00000225733 chr3 Ensembl 1874 intronic antisense NR2C2
12 uc002xuq.1 lincRNA ENSG00000267427 chr19 Ensembl 2103 exon sense-overlapping MLLT1
13 ENST00000516507 antisense ENSG00000249042 chr5 Ensembl 1151 bidirectional FAM151B
14 ENST00000586625 antisense + ENSG00000259985 chr18 Ensembl 1169 natural antisense B4GALT6
15 TCONS_l2_00005763 lincRNA + ENSG00000254339 chr8 Ensembl 697 intergenic
16 NR104639 long noncoding CENPJ chr13 RefSeq 5246 exon sense-overlapping CENPJ
17 ENST00000332012 lincRNA + ENSG00000248587 chr5 Ensembl 1941 exon sense-overlapping GDNF-AS1
18 ENST00000556819 long noncoding AK055386 chr20 UCSC knowngene 3404 intergenic
19 ENST00000602575 antisense + ENSG00000227061 chr2 Ensembl 4775 intergenic
20 ENST00000434707 processed transcript + ENSG00000012171 chr13 Ensembl 1765 exon sense-overlapping SEMA3B
4.7 RIP-seq Identifies Aly/REF-interacting mRNAs in AAA

After RPKM value distribution was analyzed, we analyzed the sample gene expression profiles on the whole. When IP showed significant enrichment relative to input group, the combined expression for each gene of IP group increased relative to input group. Through RIP-seq, mapping data revealed that FMRP had 3060 potential target genes, which showed extensive activities in cell physiological processes, moreover, there were 369 mRNAs showing differential expression (p< 0.01) in AAA tissue (anti-Aly/REF group relative to IgG control).

To reduce the mRNAs binding to Aly/REF to better investigate and enrich mRNAs that might be related to AAA, this study screened the significantly differentially expressed mRNAs (FC >4, p< 0.01) possibly related to the protein encoding genes annotated based on GO functional annotation and scientific literature. Based on the FC, the top 40 dysregulated mRNAs are summarized in Table 6. As expected, Dnmt1 was candidate mRNAs of Aly/REF-interacting mRNA by RIP-seq identified in AAA tissue.

Table 6.General information of top 40 ranked regulated mRNAs by Aly/REF-binding.
No. Gene symbol Gene ID Strand Chromosome Map location Gene name
1 MYCBP2 ENSG00000005810 13 13q22 MYC binding protein 2, E3 ubiquitin protein ligase
2 LUC7L ENSG00000007392 16 16p13.3 LUC7-like
3 TYMP ENSG00000025708 22 22q13.33 thymidine phosphorylase
4 CYFIP2 ENSG00000055163 + 5 5q33.3 cytoplasmic FMR1 interacting protein 2
5 MYO9A ENSG00000066933 15 15q22-q23 myosin IXA
6 JMJD6 ENSG00000070495 17 17q25 jumonji domain containing 6
7 FGFR1 ENSG00000077782 8 8p11.23-p11.22 fibroblast growth factor receptor 1
8 SDF4 ENSG00000078808 1 1p36.33 stromal cell derived factor 4
9 CREM ENSG00000095794 + 10 10p11.21 cAMP responsive element modulator
10 MED15 ENSG00000099917 + 22 22q11.2 mediator complex subunit 15
11 ZC3H14 ENSG00000100722 + 14 14q31.3 zinc finger CCCH-type containing 14
12 DCAF11 ENSG00000100897 + 14 14q11.2 DDB1 and CUL4 associated factor 11
13 ZMYND8 ENSG00000101040 20 20q13.12 zinc finger MYND-type containing 8
14 SIRPB1 ENSG00000101307 20 20p13 signal regulatory protein beta 1
15 JAG1 ENSG00000101384 20 20p12.1-p11.23 jagged 1
16 MTMR9 ENSG00000104643 + 8 8p23-p22 myotubularin related protein 9
17 VRK3 ENSG00000105053 19 19q13 vaccinia related kinase 3
18 PALD1 ENSG00000107719 + 10 10q22.1 phosphatase domain containing, paladin 1
19 XPNPEP1 ENSG00000108039 10 10q25.3 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
20 ZMIZ1 ENSG00000108175 + 10 10q22.3 zinc finger MIZ-type containing 1
21 CDK5RAP3 ENSG00000108465 + 17 17q21.32 CDK5 regulatory subunit associated protein 3
22 PPP6R3 ENSG00000110075 + 11 11q13 protein phosphatase 6 regulatory subunit 3
23 ELMOD3 ENSG00000115459 + 2 2p11.2 ELMO/CED-12 domain containing 3
24 SERPINC1 ENSG00000117601 1 1q25.1 serpin peptidase inhibitor, clade C (antithrombin), member 1
25 MTRR ENSG00000124275 + 5 5p15.31 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
26 ERMARD ENSG00000130023 + 6 6q27 ER membrane-associated RNA degradation
27 YIPF2 ENSG00000130733 19 19p13.2 Yip1 domain family member 2
28 DNMT1 ENSG00000130816 19 19p13.2 DNA (cytosine-5-)-methyltransferase 1
29 SCLY ENSG00000132330 + 2 2q37.3 selenocysteine lyase
30 HSD17B4 ENSG00000133835 + 5 5q21 hydroxysteroid (17-beta) dehydrogenase 4
31 NUMB ENSG00000133961 14 14q24.3 numb homolog (Drosophila)
32 ZCCHC11 ENSG00000134744 1 1p32.3 zinc finger CCHC-type containing 11
33 ELP2 ENSG00000134759 + 18 18q12.2 elongator acetyltransferase complex subunit 2
34 LMO7 ENSG00000136153 + 13 13q22.2 LIM domain 7
35 CALCOCO2 ENSG00000136436 + 17 17q21.32 calcium binding and coiled-coil domain 2
36 FPGS ENSG00000136877 + 9 9q34.1 folylpolyglutamate synthase
37 PML ENSG00000140464 + 15 15q22 promyelocytic leukemia
38 RHOT2 ENSG00000140983 + 16 16p13.3 ras homolog family member T2
39 DEF8 ENSG00000140995 + 16 16q24.3 differentially expressed in FDCP 8 homolog (mouse)
40 ANAPC11 ENSG00000141552 + 17 17q25.3 anaphase promoting complex subunit 11

GO analysis indicated that the functions of Aly/REF-interacting mRNA were related to various biological processes, such as UDP-N-acetylglucosamine metabolic process and endocytic recycling; and cellular component, including eukaryotic 48S preinitiation complex, eukaryotic 43S preinitiation complex; and platelet-derived growth factor biding, histone methyltansferases activity (Supplementary Fig. 3).

KEGG Moreover, regulated pathways were enriched in protein processing in endoplasmic reticulum (KEGG: hsa04141), lysine degradation (KEGG: hsa00310), and Focal adhesion (KEGG: hsa04510) (Supplementary Fig. 4).

Altogether 369 DEGs were analyzed against the STRING database. At the same time, Cytoscape was used to construct a PPI network through neighborhood, co-expression, settings experiments, text-mining and database. Afterwards, the separated genes were removed (those that did not interact with the remaining genes), and the DEGs regulated by Aly/REF were exhibited with 745 edges and 372 nodes (Fig. 6). Based on every gene degree, 4 hub genes that had a >20 degree were obtained, including ALB, ATM, TRIP12, and HIF1A.

Fig. 6.

Construction of PPI network, analysis of 369 differentially expressed, and identification of hub genes.

4.8 Regulatory network (lncRNA-mRNA) analysis

Firstly, the lncRNA-mRNA correlations were analyzed based on 369 differentially expressed mRNAs and 477 differentially expressed lncRNAs. For better investigating the associations among the coding genes, the NIANA approach [28] was used for regulatory network analysis, which exhibited the network objects for the 246 candidate lncRNAs.

Secondly, we screened the candidates in the lncRNA-mRNA interaction network by the correlation >0.7 threshold, which yielded a network that consisted of 246 lncRNAs and 369 mRNAs (Fig. 7).

Similarly, 8 hub mRNA candidates (SLC3A2, CCNL1, WDR81, MLLT10, BCL2L1, FHL1, GON4L, MYO15B) also exerted vital parts in the regulatory network, as observed from Table 7. In addition, there were more genes and signaling pathways involved in the above constructed network, suggesting the complicated mechanisms by which Aly/REF-binding mRNAs and lncRNAs regulated the AAA pathogenic mechanism.

Fig. 7.

The Venn diagram of the candidates in the lncRNA-mRNA interaction network. lncRNA and mRNAs were selected with a threshold of correlation >0.7, resulting in a network consisting 246 lncRNAs and 369 mRNAs.

Table 7.The 8 hub mRNA candidates in the lncRNA-mRNA interaction network.
Transcript ID Biotype Strand Gene ID Locus LncRNA Source LncRNA length Associated gene transID Association gene name
ENST00000363981 processed transcript ENSG00000255717 chr11:62619459-62623386 Ensembl 72 ENST00000377892 SLC3A2
ENST00000364908 misc RNA + ENSG00000201778 chr3:156864296-156878549 Ensembl 93 NM001308185 CCNL1
ENST00000571091 lincRNA ENSG00000186594 chr17:1614804-1641893 Ensembl 525 ENST00000446363 WDR81
uc001irb.3 long noncoding + MLLT10 chr10:21823093-22032559 UCSC knowngene 3611 ENST00000307729 MLLT10
uc002wwk.3 long noncoding BCL2L1 chr20:30252254-30311792 UCSC knowngene 2462 ENST00000376062 BCL2L1
uc004ezm.2 long noncoding + FHL1 chrX:135228860-135293518 UCSC knowngene 2136 ENST00000345434 FHL1
uc009wrg.1 long noncoding GON4L chr1:155579566-155829191 UCSC knowngene 4500 ENST00000271883 GON4L
uc010dgi.1 long noncoding + MYO15B chr17:73584138-73704142 UCSC knowngene 3088 ENST00000578462 MYO15B
mRNA
Association gene name Description Deneid Strand Locus RIP FPKM Gene ID Chromosome Map location
SLC3A2 solute carrier family 3 member 2 ENSG00000168003 + chr11:62623517-62656355 14.1648 6520 11 11q13
CCNL1 cyclin L1 ENSG00000163660 chr3:156864296-156878549 27.0217 57018 3 3q25.31
WDR81 WD repeat domain 81 ENSG00000167716 + chr17:1614804-1641893 46.204 124997 17 17p13.3
MLLT10 myeloid/lymphoid or mixed-lineage leukemia; translocated to, 10 ENSG00000078403 + chr10:21823093-22032559 14.4303 8028 10 10p12
BCL2L1 BCL2 like 1 ENSG00000171552 chr20:30252254-30311792 26.9695 598 20 20q11.21
FHL1 four and a half LIM domains 1 ENSG00000022267 + chrX:135228860-135293518 166.2 2273 X Xq26
GON4L gon-4-like (C. elegans) ENSG00000116580 chr1:155579566-155829191 42.58 54856 1 1q22
MYO15B myosin XVB ENSG00000266714 + chr17:73584138-73704142 230.939 80022 17 17q25.1
Note, RIP vs IgG. FPKM, fragments per kilobase of transcript per million mapped reads.
5. Discussion

AAA is one of the most severe vascular diseases in the vascular surgery [29, 30]. Because of the complex pathogenesis of AAA, efficient medical treatment for preventing the occurrence and rupture of AAA is lacking so far [31]. Among the researches on the AAA pathogenesis, epigenetic regulation occupies an increasing decisive position [32]. 5-methylcytosine modification on mRNA is a novel mRNA epigenetic modification, which have been found to play an essential role in other diseases [33, 34]. However, the evidence on the relationship between AAA and mRNA m5C modification is still lack. Therefore, this work aimed to examine the relationship of mRNA m5C expression with AAA. And for the first time, we observed that increased mRNA m5C modification occurred in AAA tissues, compared with the healthy controls.

Here, we observed up-regulating in the AAA tissue samples relative to matched normal tissues (>1.5-fold) at mRNA and protein level. Clinically, the NSUN2 expression was positively correlated to platelet hematocrit in AAA patients. NSUN2, firstly recognized as a tRNA m5C-methyltransferases [35], was also identified to methylate mRNA. Several researches have reported previously that NSUN2 regulated the stability, the translation of mRNAs and further affected gene expressions in cell proliferation [36], oxidative stress [37], inflammation reactions [38] and other pathophysiological processes [39]. These processes might participate in the progression of AAA [40] and other cardiovascular diseases [41]. Recently, Miao et al. [40] suggested that Nsun2 regulated hyperhomocysteinemia (HHcy)-deteriorated AAA progression mostly through elevating the expression and production of endothelial autotaxin, along with the migration of T cells, and this accounts for a new mechanism for the HHcy-deteriorated pathogenic mechanism and vascular inflammation in AAA. In the current study, we found that NSUN2 was higher within human AAA tissues relative to normal tissues, significantly correlated with m5C status of mRNA, and was localized in the inflammatory cells through IHC analysis. Our results indicated that NSUN2 may play an important role in the m5C methylation of mRNA in the AAA progression. Further research should focus on its potential function on regulating expressions of target genes in AAA, which may provide a new insight on the etiological study of abdominal aortic aneurysm.

Aly/REF is a specific mRNA m5C reader, which can bind to m5C sites in mRNA [33, 42], and contributes to the regulation of mRNA export [43]. Aly/REF plays a critical role on promoting the nuclear-cytoplasmic shuttling mRNA export in conjunction with NSUN2 [33]. It has been reported previously that either knock-down of NSUN2 or knock-down of Aly/REF affected the cytoplasmic to nuclear ratios of mRNAs [36]. In the current study, we found a higher level of Aly/REF in AAA group. Additionally, the expression of Aly/REF was strongly correlated with m5C status of mRNAs and the expression of NSUN2. Furthermore, according to the IHC analysis and IF analysis, NSUN2 and Aly/REF were co-expressed in the inflammatory cells in AAA tissues, which illustrated that NSUN2 and Aly/REF might mediate mRNA m5C modification in inflammatory cells. Yang et al. [33] have suggested a similar point about m5C formation in mRNAs is mainly catalyzed by the RNA methyltransferase NSUN2, and m5C is specifically recognized by the mRNA export adaptor Aly/REF as shown by in vitro and in vivo studies. NSUN2 modulates Aly/REF’s nuclear-cytoplasmic shuttling, RNA-binding affinity and associated mRNA export. The modification may be related with inflammatory infiltration in AAA. It has been reported that NSUN2 regulated AAA formation by promoting T cell recruitment. However, the research on the association of inflammation with m5C modification and Aly/REF is still lack. Phenotypic transformation of immune cells is an important mechanism of AAA progression. Further researches should focus on the potential role of m5C modification in the phenotypic transformation of immune cells.

Considering the higher level of Aly/REF in AAA and its specific binding to mRNA m5C sites as identified by other researches, Aly/REF may play a critical role in the mRNA m5C status in AAA. Therefore, we tried to perform RIP-Sequence of Aly/REF in AAA tissues to find out the downstream target lncRNA and mRNA of Aly/REF. According to our result, in AAA tissue samples, the downstream mRNAs were involved in several pathophysiological processes. As this study explored, Dnmt1 was candidate mRNAs of Aly/REF-interacting mRNA by RIP-seq identified in AAA tissue. Previous study demonstrated that high Aly/REF expression and low DNMT1 expression were both associated with poor head and neck squamous cell carcinoma prognosis [44]. Simultaneously, the target differential expression mRNA regulated by Aly/REF were exhibited by PPI network, four hub genes were obtained, including ALB, ATM, TRIP12, and HIF1A. As well as Aly/REF-HIF1A interaction, a bioprocesses of bladder cancer cells were demonstrated by a series of experiments in vitro, they found that hypoxia-inducible factor-1alpha (HIF-1A) indirectly up-regulated the expression of PKM2 by activating Aly/REF in addition to activating its transcription directly [45]. Future cellular and molecular studies are required to further validate our findings and to better understand the genes targeted for m5C modifications during AAA progression.

For example, Aly/REF-interacting lncRNAs were associated with various biological processes, including immune system process and macrophages infiltration, i.e., macrophage cytokine production, MHC class I protein complex, MHC class I protein binding, and MHC protein binding. Meanwhile, lncRNAs also participated in Phagosome pathway, PPAR signaling pathway and ECM-receptor interaction pathway, which have been identified to be modulated in the current study. Long non-coding RNAs (lncRNAs), which are the main non-coding RNAs, are transcripts longer than 200 nt. They are known to play a key role in chromatin remodeling, transcription, and post-transcriptional regulation [46]. At present, few studies exist on m5C related lncRNAs. Studies have performed quantitative mapping of the m5C sites in Arabidopsis thaliana on a transcriptome range, and found more than 1000 m5C sites in mRNA, long non-coding RNA [47]. NSUN2 may play a similar role in lncRNAs. Sun et al.[48] showed that NSUN2 deficiency significantly decreased the half-life of H19 RNA (lncRNA), which might be regulated by NSUN2-mediated m5C modification in hepatocellular carcinoma. Nevertheless, the mechanism of m5C methylation in lncRNAs promoting AAA progress is unclear, and deeper exploration would be helpful for understanding the pathogenesis of AAA.

Through bioinformation method, we also predicted eight hub mRNA candidates (SLC3A2, CCNL1, WDR81, MLLT10, BCL2L1, FHL1, GON4L, MYO15B) exerted vital parts in the lncRNAs-mRNAs regulation network. The sequence profile provided reliable basis for the mechanism of m5C methylation regulating AAA progression. However, further researches are needed to focus on the relationship of m5C target RNA and AAA, which may uncover a new cause of AAA occurrence.

6. Conclusions

We were first to observe m5A modification in human abdominal aortic aneurysm tissues. The results also reveal the important roles of m5C modulators, including NUSN2 and Aly/REF, in the pathogenesis of human AAA and provide a new view on m5C modification in AAA. Our findings suggest a potential mechanism of RNA methylation modification in clinical AAA. Understanding how these m5C RNA modifications occur, and the correlation between lncRNA changes in structure and function, may open up new therapeutic possibilities in AAA. Future molecular and cellular studies are required to further identify our findings and to better understand the genes targeted for m5C RNA methylation modifications during AAA progression.

7. Author contributions

Conceptualization—JZ and YSH; methodology—YCH, FXY and YHW; software—YSH and YCH; formal analysis—SYW, YSH and YCH; investigation—JZ and YSH; data curation— HZ and YCH; writing-original draft preparation—PPG, YCH and YSH; writing-review and editing—SJX and JZ; supervision—JZ and YSH; funding acquisition—YSH and JZ. All authors have read and agreed to the published version of the manuscript.

8. Ethics approval and consent to participate

Human AAA samples collection conducted according to the Guidelines of the World Medical Association Declaration of Helsinki, and was approved by the Ethics Committees of First Hospital of China Medical University (ethical approval number: 2019-97-2).

9. Acknowledgment

We thank Cloud-Seq Biotech Ltd. Co. (Shanghai, China) for the RIP-transcriptome sequencing service and the subsequent bioinformatics analysis.

10. Funding

This work was supported by the Fundamental Research Funds for the Central Universities (grant number: DUT19RC(3)076), the National Natural Science Foundation of China (grant number: 81600370), and the China Postdoctoral Science Foundation (grant number: 2018M640270) for Yanshuo Han. This work was supported by the National Natural Science Foundation of China (grant: 81970402) for Jian Zhang.

11. Conflict of interest

The authors declare no conflict of interest.

12. Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request. The datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) database (Accession Number: GSE 163615).

Supplementary material

Supplementary material associated with this article can be found, in the online version, at https://www.fbscience.com/Landmark/articles/10.52586/5016.

Abbreviations

AAA, abdominal aortic aneurysm; Ctrl, control group.

References