The method from [19] was used to isolate streptomycetes from PAHs contaminated soil from which 1 g was suspended in 500 mL MNGA liquid medium (ingredients per liter; glucose 10 g, beef extract 3 g, peptone 5 g, sodium chloride 3 g, and yeast extract 3 g with final pH 7) [20]. Both naphthalene and phenanthrene (0.1%) were supplemented into the medium as crystals. Inoculates were incubated in an orbital shaker incubator at 200 rpm and 30 °C without light for 10 days. After the incubation period, 10 mL was transferred to be inoculated in 100 mL of freshly prepared liquid MNGA medium with the same hydrocarbon used previously. After the enrichment step, a series of dilutions of 10^-1 to 10^-6 was made, from which 0.1 mL was cultivated by spreading evenly on starch casein agar supplemented with nalidixic acid 100 mg /mL and cycloheximide 100 mg/mL to inhibit non-spore-forming bacterial, yeast and fungal growth. Plates were incubated for 14 days.

The bacteria genomic DNA of bacteria was extracted using a Favorgen Total DNA Isolation kit (Favorgen, Taiwan, type: FAMBD 001). The primers Str-F: GAACCACTTCGGTGGGGATT and Str-R: CAGGTACCGTCACTTTCGCT were designed in this study depending on the sequence accession no. PP855663.1 to give a product size of 400 bp of 16S ribosomal RNA gene by polymerase chain reaction (PCR) in a final PCR reaction mixture of 20 µL. The PCR amplification program conditions were as follows: Initial denaturation step (one cycle) at 94 °C for 4 min; after this step, 30 cycles of amplification started at 94 °C for 30 sec, annealing at 52 °C for 30 sec, and concluded by extension at 72 °C for 1 min. The final step of PCR amplification was an extension step at 72 °C for 10 min. Amplified samples were cooled to 4 °C until removed from the device. Amplified PCR products were resolved by electrophoresis using 2% agarose at a field strength of 8 v/cm. The gel was stained with red-safe dye (Promega, Madison, WI, USA, cat no.: H1181), visualized under a ultraviolet (UV) transilluminator, and photographed. The PCR products were sent to Macrogene Biotech Corp. (Korea) to be sequenced and compared using the BLAST tool available at https://www.ncbi.nlm.nih.gov/. All Streptomyces isolates were grown separately on ISP-2 medium as pure cultures.

Washed spores from Streptomyces were cultivated on an MNGA medium for 10 days, and their ability to degrade PAHs was tested. The medium was supplemented with naphthalene and phenanthrene as the main carbon source. After the cultivation period, cells were harvested by centrifugation, inoculated in IM medium supplemented with 100 mg naphthalene and phenanthrene, and incubated in the absence of light in a shaker incubator at 200 rpm, 30 °C for 10 days. The control medium was not supplemented with PAHs, allowed to grow simultaneously in the same conditions as before, and served for comparison. This experiment was triplicated for accurate results. The growth of microorganisms was monitored spectrophotometrically at optical density 600 (OD₆₀₀) nm, and cells were collected by centrifugation at 8000 g for 15 min. The supernatant was transferred to a new sterile tube acidified with 2 N HCl to pH 2 and extracted with equal volume ethyl acetate [21]. The ethyl acetate layer was separated and dried using anhydrous Na₂SO₄ to dryness with the aid of a vacuum evaporator and a temperature of 40 °C.

Using high-performance liquid chromatography (HPLC model: Shimadzu LC-2050 series, Shimadzu, Kyoto, Japan, equipped with UV absorbance detector), polycyclic aromatic hydrocarbons were identified and quantified. PAH standards were obtained from Sigma-Aldrich. The separation conditions were performed according to [22].

The bacterial isolate with the highest growth rate on a hydrocarbon-rich medium was investigated for biosurfactant production. Using 100 mL Bushnell–Hass medium composed of (g/L) from MgSO₄ 0.20; CaCl₂ 0.02; KH₂PO₄ 1.00; K₂HPO₄ 1.00; NH₄NO₃ 1.00; FeCl₃ 0.05; dextrose 15. The bacterium was inoculated and cultivated for 10 days in a shaker incubator at 200 rpm. Production of biosurfactants was estimated using the following methods: oil displacement test [23], drop collapse rest [24], and E 24 emulsification index percentage was determined [25]. Surface tension change due to biosurfactant was measured using the tensiometer and drop weight method [26].

Bacterial cells were grown in liquid Bushnell–Hass medium in a shaker incubator at 200 rpm, 37 °C for 10 days, and collected by centrifugation at 10,000 rpm for 20 min to remove biomass. A solvent extraction method detected biosurfactants produced by Streptomyces sp. supernatant obtained from the culture medium. The solution was acidified using 1 N HCl to pH 2 and stored at 4 °C overnight for precipitation. After one night of storage in the refrigerator, an equal volume of diethyl ether was used for extraction using a separation funnel. The resulting organic layer was transferred to a beaker, and the solvent was removed by evaporation, during which biosurfactant was retained [27]. Production of biosurfactants, oil displacement ability [28], drop collapse test [29], and emulsification index E₂₄ [30] with hexan and xylene were estimated after this process.

Thin layer chromatography (TLC) using silica gel with dimensions of 20 cm $\times$ 20 cm (Mereck) was employed to screen biosurfactant production by Streptomyces sp. under study [31]. The solvent system varied according to the component being tested. Spots of extracted biosurfactant were laid on the silica gel and developed using the following solvent system: solvent (1) was used to detect neutral lipids made from petroleum ether, diethyl ether, and acetic acid with ratios 80:20:1; the second solvent system was used to detect polar lipids made of chloroform, methanol, and water 65:25:4, while the third system consisting of ethyl acetate, acetic acid, and methanol served as the mobile phase. Lipids were identified as yellow spots after exposure to iodine vapor in a closed jar, while carbohydrates were identified as red spots when sprayed with alpha naphthol solution followed by concentrated sulfuric acid.

The physical and chemical properties of Iraqi oil were determined. It is characterized by specific gravity of 15.6/15.6 pour point (“C), degree American Petroleum Institute (API) gravity of 33.07, sulfur content of 2.74 (wt. %), Condradson carbon residue 4.60 (wt. %), ash yield 0.007 (wt. %), pour point (“C) –25, asphaltenes (wt. %) of 7.85, and Nickel (NI) (ppm) 14.8, V (ppm) 54.8.

The chemical and physical properties of each collected soil type were determined. Each site has a unique physical and chemical structure, as listed in Table 1.

A significant difference in both pH and salinity was found among samples collected from different parts of Iraq. The soil of the Northern part (Al-Begei) is characterized by alkalinity with pH 8.5, low salinity calculated to be less than 10 g/kg and high total organic carbon (TOC). Meanwhile, the Basra site to the south of Iraq was characterized by a low pH of 5.3 with high salinity that reached 38 gm/kg. The pH with moderate alkalinity in the Al-Latifia site located south of Baghdad in the middle of Iraq has acceptable salinity but a high TOC concentration. Basra contained fewer amounts of TOC, less than 17 mg/g, with the identical particle size distribution as 3.6% clay, 77% silt, and 53.5% sand as an average value.

Total concentrations of PAHs (TPAHs) in soils were estimated gravimetrically. The test started at (t = 0 d) and continued after cultivating microorganisms (t = 120 d) to investigate the degradation potential of PAHs. Microbial flora from Al-Begei and Al-Latifia soils showed higher potential to perform this process than the Basra soil, with reduction reaching 1.97 $\times$ 10⁴, starting concentrations of 5.96 $\times$ 10⁴ and 2.14 $\times$ 10⁴ mg kg^-1, beginning at 6.78 $\times$ 10⁴ mg kg^-1, respectively. This can be interpreted as 62% and 58% reductions in TPAH degradation potential, respectively. Gas chromatography–mass spectrometry (GC–MS) detected the remaining PAHs and n-alkanes. Al-Latifia soils showed the highest ability to degrade acyclic branched and unbranched hydrocarbons with a reduction in the concentration of medium carbon content (C8–C40) alkanes from (1.39 $\times$ 10⁴ at t = 0) to (0.27 $\times$ 10⁴ mg/kg at t = 120). Degradation was as high as 79% for alkane types of high carbon content (C13–C30), predominant in tested soils with values (1.17 $\times$ 10⁴ at t = 0 to 1.66 $\times$ 10³ mg kg^-1 at t = 120). The microbes obtained from Al-Latifia soil showed the highest mineralization of 84%. Basra soil exhibited the least degradation of alkanes C8–C40 and C13–C30, with 58% and 59%, respectively. Degradation curves are shown in Fig. 1.

Fig. 1.

The residual concentrations of petroleum hydrocarbons (PAHs) in soils from three geographic regions. (a) Concentrations of total petroleum hydrocarbons (TPAHs) in microcosm soils. (b) Concentration of n-alkanes (C8–C40) in microcosm soils.

There are several methods to isolate streptomycetes with active enzyme systems. Among these methods, using phenol as a selective agent for streptomycetes and actinomycetes proved efficient in achieving this goal. Using hydrocarbons as a carbon source helped cultivate Streptomyces isolates, which can grow and assimilate PAHs as an energy source. The morphology of Streptomyces isolate was as follows: No fragmentation of substrate mycelium and aerial mycelium with recti flexible (RF) arrangement. Cultural morphology on ISP2 agar was white leathery brown and showed brown pigment. A photo of Streptomyces isolates illustrating colony morphology is shown in Fig. 2.

Fig. 2.

Culture of Streptomyces isolates with a high ability to utilize different types of hydrocarbons cultivated on ISP2 medium. The biochemical properties of the bacterium showed the ability to grow on Czapeck medium with white substrate mycelia and grey aerial mycelia, a utilizer of glucose, arabinose, xylose, sucrose, and mannose but not rhamnose and inositol. It can produce organic acid and catalase and assimilate urea.

Bacterial isolates selected for this study were identified using 16S RNA primers specifically designed for streptomycetes [32]. The resulting amplicon was 400 bp in size and was sequenced for further confirmation of bacterial identity. The 16S RNA PCR amplicon is shown in Fig. 3.

Fig. 3.

The 16S RNA amplification of Streptomyces isolates under study. The first lane (M) is a 100 bp DNA marker. The (1) lane is a 16S RNA amplified site.

BLAST results from 16S rRNA showed that the isolate is similar to Streptomyces pini, Streptomyces radiopugnans, Streptomyces niveiscabiei, Streptomyces turgidiscabies, and Streptomyces radicis with query coverage of 100%, e-value 0.15, and per. ident of 100%, respectively. Fig. 4 shows the distance tree of the newly isolated Streptomyces isolates.

Fig. 4.

Distance tree of Polyaromatic hydrocarbons (PAHs) degrading Streptomyces isolate.

The degradative potential of Streptomyces against different hydrocarbons was investigated by cultivation on media supplemented with other types of these compounds. The ability to flourish and produce viable cells was the criteria for utilizing hydrocarbons, as illustrated in Table 2. The percentage of biodegradation of PAHs depends on the number in Table 3.

We found that identifying PAHs for the control sample represented by soils collected from sites under study contained high molecular weight PAHs, which exist in very high percentages, while low molecular weight PAHs existed in traces. For Streptomyces sp., the maximum biodegradation percent of PAHs was 93.49 and 95.47, respectively. This means it can assimilate most crude oil waste in spills. A further test was conducted on high molecular weight PAHs that reached C44 to calculate the range in which our isolate can utilize complex PAHs, as shown in Fig. 5.

Fig. 5.

Gas chromatographs of the high molecular weight PAHs assimilated by Streptomyces sp. (a) Untreated control, (b) Streptomyces sp. The figure shows that the spectrum of complex PAHs began from C5 and declined at C20.

The acid precipitation method was used to isolate and purify biosurfactant-produced Streptomyces. The yield was 1 g/L of biosurfactant. The nature of this substance was found to be lipopeptide, as determined by Fourier transfer infrared spectroscopy and biochemical tests. The surface-active compound was found to be white in color when precipitated and contained peptide bonds in its structure and lipid. The biosurfactants tested were found to be of two types: Polar and non-polar lipids, carbohydrates, and protein. Biosurfactants were produced after 10 days of cultivation on the ISP2 medium and were detected by TLC, as shown in Fig. 6.

Fig. 6.

Resulting biosurfactant from hydrocarbon degradation. (A) shows the polar LPS, (B) the non-polar LPS, and (C) the carbohydrate chromatography. LPS, lipoply saccharide.

Furthermore, the isolate under study was found to have a high emulsification index, the ability to displace oil, and to collapse oil drop when mixed with it. Table 4 illustrates these results.

Fig. 7 shows the bioemulsification of hydrocarbons results.

Fig. 7.

Biosurfactant production test. (A) oil displacement test, (B) drop collapse test in which an oil drop is disperesed on the glass after adding the biosurfactant and (C) emulsification activity. These tests were performed using Streptomyces isolate, which was obtained in this study.

The spectrum from which the Fourier-transform infrared spectroscopy (FTIR) began was 500–700 nm to cover all compounds involved in this detection method. The results showed a widening in specific areas as an indicator that these compounds transformed their chemical structure due to the bacterial effect of assimilation on crude oil contaminants. In Fig. 8, the fraction CH₂Cl₂ suffered a change in the CH bands at 3383, 3387, and 3414 cm^-1, suggesting the presence of an aliphatic chain (CH₃CH₂)n, while the change in compounds at wavelength 1643 cm^-1 suggested a stretching in N–C amid the group.

Fig. 8.

Spectral graph of crude oil contaminant degradation by Streptomyces isolate. The graph was obtained from Fourier-transform infrared spectroscopy (FTIR) analysis at a wavelength range of 500–700. (A) Streptomyces isolates grown on crude oil as a source of carbon, (B) Streptomyces isolate grown on hexadecane as a source of carbon, (C) Streptomyces isolate grown on diesel, and (D) Streptomyces isolate grown on naphthalene.