Article Metrics

  • Figure 1

    View in Article
    Full Image
  • Figure 2

    View in Article
    Full Image
  • Figure 3

    View in Article
    Full Image
  • Figure 4

    View in Article
    Full Image
  • Figure 5

    View in Article
    Full Image
  • Figure 6

    View in Article
    Full Image
  • Information

  • Download

  • Contents

Frontiers in Bioscience-Elite (FBE) is published by IMR Press from Volume 13 Issue 2 (2021). Previous articles were published by another publisher on a subscription basis, and they are hosted by IMR Press on imrpress.com as a courtesy and upon agreement with Frontiers in Bioscience.

Abstract

Type-2 Diabetes mellitus (T2DM) is a complex metabolic disease. A case-control study was conducted with 218 T2DM and 214 controls to evaluate the T2DM risk of rs5219 polymorphism in the south Indian population. The analysis of allelic and genotype data showed a significant association of rs5219 polymorphism towards an increased risk of T2DM compared to controls with an odds ratio (OR) of 2.52, confidence interval (CI) (0.96-6.64) and p-value 0.046. The functional influence of rs5219 was tested which showed a significant correlation with HbA1c and serum uric acid levels. Although our results confirm rs5219 is a potential contributor to T2DM, several inconclusive results were noticed across the literature. Hence, the meta-analysis was performed by combining the results of case-control study with previous literature to confirm the rs5219 association with T2DM across various populations. Our meta-analysis revealed a significant risk association of rs5219 in T2DM under five genetic models. In summary, our analysis suggests, rs5219 polymorphism plays a significant role in T2DM susceptibility. Further, studies need to be conducted to determine the influence of rs5219 on the other characteristics of T2DM.

2. INTRODUCTION

Type-2 Diabetes mellitus is a complex metabolic disorder caused due to the development of insulin resistance that leads to hyperglycemia (1). Globally, 347 million people are affected with diabetes, of which most from middle and low-income countries (2). In India, the prevalence of diabetes is expected to increase up to 10.1% by the year 2035 (3). The etiology of T2DM is well reported suggesting interplay of genes, environment, sedentary behavior, and obesity (4). Several genome-wide association studies (GWASs) have documented over 129 loci in genes such as TCF7L2, PPARG, FTO, PRC1, DUSP9, CDKAL1, NOTCH2, ABCC8, HNF1A, IGF2BP2, KCNQ1, and KCNJ11 were found to be related with T2DM (5, 6).

Of several genes, Potassium Voltage-Gated Channel Subfamily J Member-11 (KCNJ11) localized at chromosome 11 encode KATP channel protein, containing 390 amino acids considered as a susceptible gene for T2DM (7). In particular, a study from France analyzed variations in KCNJ11 and ABCC8 genes among 109 diazoxide-unresponsive patients having congenital hyperinsulinism, which revealed mutations in 82% of the probands (8). Also, several mutations in the KCNJ11 gene were noticed and considered as one of the causative factors for diseases like congenital hyperinsulinemia and neonatal diabetes (9). Functionally, mutations in the KCNJ11 gene causes diabetes by reducing the sensitivity of KATP to ATP (potassium channel-adenosine triphosphate), thus preventing the secretion of insulin (10). The earlier study suggests that polymorphic variants identified in KCNJ11-ABCC8 locus were found to be linked with T2DM due to high linkage disequilibrium (LD) (11).

Globally, several polymorphic variants were observed in the KCNJ11 gene which was positively associated with T2DM across various ethnic populations (12, 13). Among several polymorphisms, the rs5219 variant (Glu23Lys, results in a modification of glutamic acid to lysine) in the KCNJ11 gene was selected for the DNA genotyping. The prime interest for selection rs5219 is based on two fundamental backgrounds, (1) So far no study was conducted reporting the association of rs5219 polymorphism in T2DM in the South-Indian population. (2) The rs5219 polymorphism suggests altering the protein function that may cause T2DM (14). Hence this study is conducted to determine the genetic predisposition of rs5219 polymorphism with T2DM susceptibility in the south Indian population. Despite previous studies of the KCNJ11 gene (p.E23K) polymorphism, several inclusive results were obtained across ethnic origin on the association of T2DM. To bring the conclusive results, we also examined the relationship between rs5219 and T2DM risk by an extensive meta-analysis following the preferred reporting items for systematic reviews and meta-analysis (PRISMA) criteria (15).

3. MATERIALS AND METHODS
3.1. Association based on case-control study
3.1.1. Study sampling

The T2DM patients were recruited from the Department of General Medicine, Chettinad Health City, Kanchipuram district, Tamil Nadu, India, between January to June 2017. All recruited participants are belonging to South India, Asian ethnic backgrounds. The fasting blood glucose and Haemoglobin-A1c levels were determined based on WHO regulations (16) for the confirmation of T2DM. Similarly, the control group was screened for T2DM to confirm the participants are healthy control. The present study protocol was following the Helsinki Declaration and was approved by the Human Ethics Committee (205/IHEC/12-16) of the Chettinad Academy of Research and Education. The signed informed consent written in the local language was obtained from the study participant before sample collection. The general characteristics from each participant were obtained through a structured questionnaire. Besides the HbA1c levels, serum uric acid was measured in the participants were recorded and used while analysis.

3.1.2. Genotyping and statistical analysis of rs5219

Approximately 3 ml of venous blood was collected from T2DM subjects and controls; Genomic DNA was extracted from the collected samples using a standard protocol followed by ethanol precipitation (17). Genotyping of rs5219 polymorphism was executed by newly designed allele-specific primers using Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR) (Table 1) (18). The PCR mixture contained, a 20 μl reaction mix was used with 25 ng DNA, 10 mM dNTPs, 12 pmol/μl of forward primer and reverse primer and 1 Unit Taq polymerase. The ARMS-PCR reaction was performed in the Eppendorf Master Cycler Gradient (Hamburg, Germany). The cycling conditions for ARMS-PCR reaction were: initial denaturation at 92°C for 5 mins, 36 cycles of 92°C for 45 secs, 62°C for 45 secs, 72°C for 45 secs and 72°C for 7 mins. The PCR products were electrophoresed in agarose gel (1.6%) along with 100 bp DNA Ladder Dye Plus (Cat no: 3422A, Takara Bio). Further, the polymorphism was confirmed from the randomly selected samples (Controls = 10; T2DM =12) using DNA sequencing (ABI 3100, USA). To identify the chromosomal interactions between the SNPs, a 3DSNP software package was used for visualizing the genomic data by generating the Circos plots based on r2 values (19). The genotype distribution in controls was examined for Hardy-Weinberg equilibrium (HWE value >0.05) by Fisher’s exact test. The distribution of allelic and genotypic frequencies among T2DM subjects and the control group were determined by Pearson's chi-square test. Further, the effects were examined by calculating the odds ratio (OR), and confidence intervals (95% CIs) in dominant (F-major, f-minor allele: Ff + ff vs. FF) and recessive (ff vs. FF + Ff) genetic models. Both the allelic and genotype data were analyzed by SPSS software V-21 (IBM Analytics, USA). Further, the associations of rs5219 polymorphism with HbA1c and serum uric acid levels in T2DM were tested using the chi-square test.

Table 1 Primers for KCNJ11 (rs5219) genotyping
Primer-ID Primer Sequence (5'-3') Allele No of base pairs Tm (ºC) Total Length (Bp)
SNP-1 OF - CCACCAGCGTGGTGAACACGTCCTGCAG 28 68 300
SNP-1 OR - CCCAGGGTGAGAAGGTGCCCACCGAGAG 28 68
SNP-1 IF - CGCTGGCGGGCACGGTACCTGGGATT T 26 68 200
SNP-1 IR - CTGACACGCCTGGCAGAGGACCCTGACG C 28 68 154
IF-inner forward, IR- inner reverse, OF-outer forward, OR- outer reverse
3.2. Meta-analysis of rs5219
3.2.1. Analysis of rs5219 polymorphism

To determine the association between rs5219 polymorphism and T2DM susceptibility, a meta-analysis was performed by including the results of case-control study. The eligible studies for this meta-analysis were identified through a systematic electronic search from databases such as NCBI-PubMed, Google Scholar, Cochrane Library, EMBASE and MEDLINE up to December 2017, respectively. The Key Words used for literature mining were "Type-2 Diabetes mellitus", "T2DM", "Potassium Voltage-Gated Channel Subfamily J Member-11", "KCNJ11 gene", "rs5219", and "Polymorphism". The language selection for the article included in this meta-analysis was limited to the English language. A study was included in the meta-analysis based on the following criteria: first, it should be a case-control study, second, the association of rs5219 gene polymorphism with T2DM was determined and third it should provide sufficient genotype data to calculate OR and 95% confidence intervals. We excluded the few articles based on: first, if the studies containing overlapping data, second if the studies were from in vitro, cell lines, case reports, animal models and studies that lack genotype frequencies, respectively. The data for this meta-analysis were extracted by two independent researchers (PA and DV) and any disagreement was solved by a team (AH, SSJ and RK). The following study characteristics, including author name, publication year, country, ethnic background, sample size (T2DM cases and controls), the source of DNA isolation, Diagnostic criteria of T2DM, genotype frequency and genotyping method were extracted.

The quality assessment of all the included studies was verified using Hardy-Weinberg equilibrium (HWE) with P-value > 0.05 in controls (20) and by the Newcastle Ottawa Scale (NOS) (21). In this scale maximum, 9 points represent the high quality of studies, 6 points or above were considered in this analysis. All the statistics for meta-analyses were executed using RevMan V-5.0 (Cochrane Community, UK) and STATA V-12.0 (Stata Corp., USA). The significance of meta-analysis of pooled and subgroup (Caucasian, Asian and others) were confirmed using the odds ratios (OR) and 95% confidence interval (CI) with (P-value < 0.05) under allelic (j vs. J) (J-major, j-minor allele), homozygote (jj vs. JJ), heterozygote (Jj vs. JJ), dominant (Jj + jj vs. JJ) and recessive (jj vs. JJ +Jj) genetic models, respectively. The Q-test and I2 statistics (22) was used to assess the study heterogeneity in this meta-analysis. Based on the heterogeneity values (I2<50), a Mantel-Haenszel's (fixed effect) model was used else DerSimonian and Laird's (23) (random-effect) model was used. Further, the funnel plot and Egger's regression analysis were used to evaluate the publication bias in this meta-analysis. The findings of our meta-analysis were validated using a sensitivity test (Leave one out method) (24).

4. RESULTS
4.1. Case-control study

The demographic characteristics of T2DM subjects (N=218) and healthy controls (N=214) were represented in Table 2. The mean ± standard deviation (SD) for age in T2DM and control were 54.45±07.48 and 53.15±06.57 years. Further, the HbA1c levels and serum uric acid were determined in all the participants showed HbA1c: control (5.39±0.27) and T2M (7.34±0.63). Similarly, the average serum uric acid in control was 3.21±0.64 and in T2DM was 5.35±0.63 mg/dL.

Table 2 Demographic characteristics of T2DM patients and control subjects
Characteristics T2DM Cases (N = 218) Controls (N = 214)
Men : women 144:74 128:86
Mean Age 54.45±07.48 53.15±06.57
Body mass index (kg/m2) 28.65±4.88 23.87±3.71
Age of disease onset 46.54±07.63 Nil
Duration of diabetes (years) 5.16±4.18 Nil
Family history of diabetes 102 35
HbA1c 7.34±0.58 5.39±0.27
Uric Acid 5.35±0.63 3.21±0.64
T2DM-Type 2 Diabetes Mellitus, Data are presented as mean ±standard deviation (SD) for continuous variables

The allelic and genotypic distributions of rs5219 polymorphism were illustrated in Table 3. An Agarose gel electrophoresis result of ARMS-PCR was represented in the fig1. The genotype distribution in control was not deviated from HWE (P = 0.183). The genotype frequencies of rs5219 polymorphism were 77.06% (CC), 16.51% (CT) and 06.41% (TT) in the T2DM. Whereas, in control, 70.64% (CC), 24.29% (CT) and 03.73% (TT), respectively. The distribution of rs5219 (TT genotype) was significantly increased in T2DM patients compared with control, OR=2.52 (95% CI (0.96-6.64)) P-value = 0.046. The results of dominant and recessive genetic models revealed no significant difference between T2DM and controls. The sequence electropherograms of KCNJ11 rs5219 polymorphism were presented in fig2. Alternatively, the results of the ARMS PCR were further confirmed with the DNA sequencing method which showed similar results. The KCNJ11 nucleotide sequences were deposited (MF109894, MF110273, and MF110298) in NCBI-Genbank. The Circos plot (outer to the inner circle) shows rs5219 variant associated other polymorphisms with r2 along with the annotated genes, chromatin states and 3D chromatin interactions (fig3). Further, the influence of polymorphism on clinical parameters showed a significant association of rs5219 with high HbA1c (Table 4) and serum uric acid (Table 5) concentration in T2DM patients.

Figure 1

Agarose (1.6) gel electrophoresis results of ARMS-PCR. Lanes: L1-CT genotype, L2 & L3-CC genotype, L4-100 Bp DNA Ladder, L5, L6 & L7 CC genotype, L8-Negative control.

Figure 2

DNA sequence electropherograms of rs5219 polymorphism in the KCNJ11 gene.Examples of homozygous dominant (CC genotype) and heterozygote (CT genotype) condition of the current SNP

Figure 3

Circos plot showing the chromosomal interactions among the studied variant (rs5219) and its associated SNPs.

Table 3 Allele frequency and genotype distribution of rs5219 polymorphism in T2DM and controls
Polymorphism Frequencies Type 2 Diabetes Mellitus n =218 (%) Controls n =214 (%) HWE OR 95% CI χ2 P-value
rs5219 Allele
C 372 (85.32) 360 (84.11) - Reference 0.24 0.344
T 64 (14.67) 68 (15.88) - 0.91 (0.62-1.31)
Genotype
CC 168 (77.06) 154 (70.64) 0.183 Reference 3.51 0.070
CT 36 (16.51) 52 (24.29) 0.63 (0.39-1.02)
TT 14 (06.41) 08 (03.73) 2.52 (0.96-6.64) 3.67 0.046*
Genetic models
Dominant CT +TT vs CC - - - 1.30 (0.84-2.02) 1.48 0.134
Recessive TT vs CC+ CT - - - 1.76 (0.72-4.30) 1.61 0.146
Table 4 Association of HbA1c levels (Low ≤ 7.3 and High > 7.4) with genotypes in T2DM
Genotype Levels P-value
Low High Total 0.003
CC 89 79 168
TT 15 21 14
CT 1 13 36
Total 105 113 218
Table 5 Association of uric acid levels (Low ≤ 5.3 mg/dL and High > 5.4 mg/dL) with genotypes in T2DM
Genotype Levels P-value
Low High Total
CC 88 80 168 0.016
TT 2 12 14
CT 15 21 36
Total 105 113 218
4.2. Meta-analysis
4.2.1. General characteristics

Our initial literature search in the selected databases identified 946 papers published up to December 2017. The articles were screened for relevance which met the inclusion and exclusion criteria. Finally, 34 studies (12,13, 25-56) were finally selected for meta-analysis which include 26,991 T2DM cases and 35,899 controls. The characteristics of the included studies in the meta-analysis were illustrated in Table 6. Further, the genotype and allele frequencies were extracted from each study involved in the meta-analysis is represented in Table 7.

Table 6 The characteristics of included studies in this meta-analysis
Reference Year Country Ethnicity Source Diagnostic criteria Cases Controls NOS Score Method
29 2008 Saudi Arabia West-Asian Blood WHO 550 335 07 Real-time PCR
34 2003 USA Caucasian Blood NA 499 494 08 FP-TDI
35 2008 UK Caucasian NA ADA 2734 4234 08 Real-time PCR
36 2007 Czech Caucasian Blood WHO 172 113 08 PCR-RFLP
30 2009 UK Caucasian Blood WHO 588 597 08 PCR-RFLP
37 2009 USA Caucasian blood ADA 2709 3344 08 OpenArray
38 2005 Netherland Caucasian Blood WHO 192 296 07 PCR-RFLP
33 2007 Japan East-Asian NA WHO 550 1433 07 Real-time PCR
39 2009 Tunisia Others Blood ADA 805 503 08 Real-time PCR
27 2004 Scandinavia Caucasian Blood WHO 477 473 08 MALDI
27 2004 Canada Caucasian 104 98
27 2004 Sweden Caucasian 496 506
40 2016 Egypt Others Blood ADA 53 30 07 AD-PCR
12 2001 UK Caucasian Blood WHO 319 324 07 PCR-SSCP.
41 2003 UK Caucasian Blood WHO 854 1182 07 PCR-SSCP.
42 2010 India South-Asian NA WHO 190 158 08 DNA Sequencing
26 1998 France Caucasian Blood NA 191 114 07 PCR-SSCP
43 1997 Denmark Caucasian Blood WHO 58 75 08 PCR-SSCP
44 2005 Denmark Caucasian Blood WHO 1187 4791 08 PCR-RFLP
45 2007 Japan East-Asian NA NA 858 862 08 DNA Sequencing
32 2010 China East-Asian Blood WHO 397 392 07 DNA Sequencing
13 2010 Israel Others Blood NA 573 843 07 Pyrosequencing
46 2003 Denmark Caucasian Blood WHO 803 862 08 PCR-RFLP
31 2007 USA Caucasian Blood NA 682 1078 07 Real-time PCR
28 2007 Japan East-Asian Blood WHO 906 889 07 Real-time PCR
47 1996 UK Caucasian Blood NA 100 82 07 PCR-SSCP
48 2007 USA Others Blood NA 572 587 07 Mass array
49 2008 India South-Asian Blood ADA 532 374 08 Real-time PCR
25 2015 Russia Caucasian Blood WHO 1384 414 08 Real-time PCR
50 2009 Japan East-Asian Blood ADA 484 397 07 Real-time PCR
This study 2017 India South-Asian Blood WHO 218 214 07 ARMS-PCR
51 2009 Norway Caucasian Blood NA 750 1879 07 PCR-RFLP
52 2008 UK Caucasian NA ADA 287 2684 07 Real-time PCR
53 2010 China East-Asian Blood WHO 1165 1135 07 Real-time PCR
54 2007 USA Caucasian NA WHO 1114 953 08 Mass array
55 2006 Japan East-Asian Blood WHO 1590 1244 07 Mass array
56 2009 China East-Asian Blood WHO 1848 1910 07 PCR
FP-TDI: Fluorescence polarization template-directed incorporation, SSCP: Single Stranded Conformational Polymorphism, AD PCR: Allelic Discrimination PCR, NA-Not available, ADA: American Diabetes Association, WHO: World Health Organization
Table 7 Genotype and allele frequencies of KCNJ11 gene rs5219 polymorphism of meta-analysis
Cases (CC/CT/TT) Controls (CC/CT/TT) Cases (C/T-Allele) Controls (C/T-Allele) HWE/ Chi-square
341/187/22 252/75/8 869/231 579/91 0.396/0.717
198/220/81 212/225/57 616/382 649/339 0.817/0.053
1112/1220/402 1625/2006/603 3444/2024 5256/3212 0.687/0.162
66/85/21 48/47/18 217/127 143/83 0.396/0.717
134/339/115 183/352/62 607/569 718/476 0.000/31.511
1055/1275/379 1382/1536426/ 3385/2033 4300/2388 0.980/0.0006
66/92/34 119/141/36 224/160 379/213 0.558/0.342
202/263/85 617/655/161 667/433 1889/977 0.515/0.422
371/352/82 250/213/40 1094/516 713/293 0.564/0.332
113/244/120 129/250/94 470/484 508/438 0.171/1.871
27/54/23 27/50/21 108/100 104/92 0.810/0.057
174/237/85 209/229/68 585/407 647/365 0.674/0.176
36/14/3 23/6/1 86/20 52/8 0.460/0.543
267/47/5 288/33/3 581/57 609/39 0.072/3.217
308/412/134 491/534/157 1028/680 1516/848 0.535/0.384
68/88/34 48/71/39 224/156 167/149 0.216/1.527
53/87/51 45/53/16 193/189 143/85 0.950/0.003
21/26/11 33/34/8 68/48 100/50 0.862/0.03
423/568/196 1955/2195/641 1414/960 6105/3477 0.525/0.402
334/393/131 332/417/113 1061/655 1081/643 0.314/1.012
131/180/86 147/187/58 442/352 481/303 0.906/0.013
228/266/79 339/404/100 722/424 1082/604 0.219/1.505
287/382/134 330/408/124 956/650 1068/656 0.013/0.907
245/322/115 446/505/127 812/552 1397/759 0.378/0.776
333/446/127 386/396/107 1112/700 1168/610 0.725/0.123
38/45/17 44/27/11 121/79 115/49 0.052/3.762
514/52/6 505/81/1 1080/64 1091/83 0.224/1.476
226/ 247 /59 148/169/57 699/365 465/283 0.446/0.580
535/ 656/ 193 158/204/52 1726/1042 520/308 0.266/1.236
169/ 232 /83 152/195/50 570/398 499/295 0.390/0.736
168/36/14* 154/52/8* 372/64* 360/68* 0.183/1.766*
26/360/125 661/883/335 890/610 2205/1553 0.08/2.98
101/137/49 994/1287/403 339/235 3275/2093 0.682/0.166
395/587/183 425/517/193 1377/953 1367/903 0.096/2.754
284/560/270 286/486/181 1128/1100 1058/848 0.316/1.004
610/734/246 503/570/171 1954/1226 1576/912 0.638/0.220
656/863/329 692/930/288 2175/1521 2314/1506 0.395/0.721
HWE, Hardy Weinberg equilibrium, OR-Odd’s ratio, χ2- Chi-square; P value-one tailed test; * - Results of current case-control study
4.2.2. Meta-analysis of rs5219 polymorphism

The analysis of rs5219 SNP, revealed mild heterogeneity was observed in the heterozygote (I2=31%) and in allelic (I2=60%), homozygote (I2=53%) dominant (I2=54%) and recessive (I2=44%) genetic models moderate heterogeneity was observed. The fixed effects (Mantel-Haenszel's) model was used which showed significant (P< 0.05) association with T2DM risk in heterozygote (Jj vs. JJ), with OR = 0.86, (95% CI (0.82-0.91)), and recessive (jj vs. JJ +Jj) with OR = 1.19, (95% CI (1.14-1.25)), Random-effect (DerSimonian and Laird's) model was implemented which revealed a positive association with T2DM susceptibility in for allelic (j vs J) with OR = 1.13, (95% CI (1.08-1.18)), homozygote (jj vs. JJ), with OR = 1.30, (95% CI (1.19-1.41)), and dominant (Jj + jj vs. JJ) with OR = 1.14,(95% CI (1.08-1.21)) genetic models. The meta-analysis results were represented as allelic (Table 8), homozygote (Table 9), heterozygote (Table 10), dominant (Table 11) and recessive (Table 12) model. Further, the funnel plot for pooled (fig.4) and sub-group of Caucasian (fig.5) and Asian (fig.6) were performed. Similarly, Egger's linear regression analysis were performed which revealed no publication bias in the investigated five genetic models.

Table 8 T2DM risk associated with KCNJ11 rs5219 polymorphism in allelic model with OR and 95% CI
Homozygote model
Study or Subgroup Cases Events Total Controls Events Total Weight M-H, Fixed, 95% CI
29 22 363 8 260 0.1% 2.03[0.89, 4.64]
34 81 279 57 269 0.4% 1.52[1.03, 2.25]
35 402 1514 603 2228 0.9% 0.97[0.84, 1.13]
36 21 87 18 66 0.2% 0.85[0.41, 1.76]
30 115 249 62 245 0.4% 2.53[1.73, 3.71]
37 379 1434 426 1808 0.9% 1.17 [0.99,1.37]
38 34 100 36 155 0.2% 1.7[0.98, 2.97]
33 85 287 161 778 0.5% 1.61 [1.19, 2.19]
39 82 453 40 290 0.4% 1.38[0.92, 2.08]
27 120 233 94 223 0.4% 1.46[1.01, 2.11]
27 23 50 21 48 0.1% 1.10 [0.49,2.43]
27 85 259 68 277 0.4% 1.5[1.03, 2.19]
40 3 39 1 24 0.0% 1.92[0.19, 19.56]
12 5 272 3 291 0.0% 1.8[0.43, 7.60]
41 134 442 157 648 0.6% 1.36[1.04, 1.78]
42 34 102 39 87 0.2% 0.62[0.34, 1.11]
26 51 104 16 61 0.2% 2.71[1.36, 5.38]
43 11 32 8 41 0.1% 2.16[0.75, 6.25]
44 196 619 641 2596 0.8% 1.41 [1.17, 1.71]
45 131 465 113 445 0.6% 1.15 [0.86,1.55]
32 86 217 58 205 0.4% 1.66[1.11, 2.50]
13 79 307 100 439 0.5% 1.17 [0.84,1.65]
46 134 421 124 454 0.6% 1.24[0.93, 1.66]
31 115 360 127 573 0.6% 1.65[1.23, 2.22]
28 127 460 107 493 0.6% 1.38[1.02, 1.85]
47 17 55 11 55 0.1% 1.79[0.75, 4.29]
48 6 520 1 506 0.0% 5.89 [0.71, 49.14]
49 59 285 57 205 0.4% 0.68[0.45, 1.03]
25 193 728 52 210 0.5% 1.10 [0.77,1.56]
50 83 252 50 202 0.4% 1.49[0.99, 2.26]
This study 14 182 8 162 0.1% 1.6[0.65, 3.93]
51 125 390 335 996 0.7% 0.93[0.72, 1.20]
52 49 150 403 1397 0.4% 1.2[0.83, 1.72]
53 183 578 193 618 0.7% 1.02[0.80, 1.30]
54 270 554 181 467 0.7% 1.5[1.17, 1.93]
55 246 856 171 674 0.7% 1.19 [0.94,1.49]
56 329 985 288 980 0.8% 1.21 [1.00, 1.46]
Subtotal (95% CI) 14683 19476 15.5% 1.30 [1.19,1.41]
Total events 4129 4838
Heterogeneity: Chi-Square = 76.71, df= 36 (P < 0.00001);12= 53% Odds Ratio > 1; Increased Risk
Test for overall effect: Z= 5.93 (P < 0.00001) Odds Ratio < 1; Decreased Risk
Table 9 T2DM risk associated with KCNJ11 rs5219 polymorphism in homozygote model with OR and 95% CI model
Allelic model
Study or Subgroup Cases Events Total Controls Events Total Weight M-H, Fixed, 95% CI
29 231 1100 91 670 0.6% 1.69[1.30,2.20]
34 382 998 339 988 0.8% 1.19 [0.99,1.43]
35 2024 5468 3212 8468 1.1% 0.96[0.90,1.03]
36 127 344 83 226 0.5% 1.01[0.71,1.43]
30 569 1176 476 1194 0.9% 1.41[1.20,1.66]
37 2033 5418 2388 6688 1.1% 1.08[1.00,1.16]
38 160 384 213 592 0.6% 1.27[0.98,1.65]
33 433 1100 977 2866 0.9% 1.26[1.09,1.45]
39 516 1610 293 1006 0.9% 1.15 [0.97,11.36]
27 484 954 438 946 0.8% 1.19 [1.00,1.43]
27 100 208 92 196 0.4% 1.05[0.71,1.55]
27 407 992 365 1012 0.8% 1.23[1.03,1.48]
40 20 106 8 60 0.1% 1.51[0.62,3.68]
12 57 638 39 648 0.4% 1.53[1.00,2.34]
41 680 1708 848 2364 1.0% 1.18 [1.04,1.34]
42 156 380 149 316 0.6% 0.78[0.58,1.05]
26 189 382 85 228 0.5% 1.65[1.18, 2.30]
43 48 116 50 150 0.3% 1.41[0.85,2.33]
44 960 2374 3477 9582 1.1% 1.19 [1.09,1.31]
45 655 1716 643 1724 0.9% 1.04[0.90,1.19]
32 352 794 303 784 0.8% 1.26[1.03,1.55]
13 424 1146 604 1686 0.9% 1.05[0.90,1.23]
46 650 1606 656 1724 0.9% 1.11[0.96,1.27]
31 552 1364 759 2156 0.9% 1.25[1.09,1.44]
28 700 1812 610 1778 0.9% 1.21[1.05,1.38]
47 79 200 49 164 0.3% 1.53[0.99,2.38]
48 64 1144 83 1174 0.5% 0.78[0.56,1.09]
49 365 1064 283 748 0.8% 0.86[0.71,1.04]
25 1042 2768 308 828 0.9% 1.02[0.87,1.20]
50 398 968 295 794 0.8% 1.18 [0.97,1.43]
This study 64 436 68 428 0.4% 0.91[0.63,1.32]
51 610 1500 1553 3758 1.0% 0.97[0.86,1.10]
52 235 574 2093 5368 0.8% 1.08[0.91,1.29]
53 953 2330 903 2270 1.0% 1.05[0.93,1.18]
54 1100 2228 848 1906 1.0% 1.22[1.08,1.38]
55 1226 3180 912 2488 1.0% 1.08[0.97,1.21]
56 1521 3696 1506 3820 1.1% 1.07[0.98,1.18]
Subtotal (95% CI) 53982 71798 28.4% 1.13 [1.08,1.18]
Total events 20566 26099
Heterogeneity: Chi 2= 90.03, df= 36 (P < 0.00001);12= 60% Odds Ratio > 1; Increased Risk
Test for overall effect: Z=5.53 (P < 0.00001) Odds Ratio < 1; Decreased Risk
Table 10 T2DM risk associated with KCNJ11 rs5219 polymorphism in heterozygote model with OR and 95% CI
Heterozygote model
Study or Subgroup Cases Events Total Controls Events Total Weight M-H, Fixed, 95% CI
29 187 209 75 83 0.0% 0.91[0.39,2.13]
34 220 301 225 282 0.2% 0.69[0.47,1.01]
35 1220 1622 2006 2609 1.4% 0.91 [0.79,1.05]
36 85 106 47 65 0.0% 1.55[0.75,3.20]
30 339 454 352 414 0.3% 0.52[0.37,0.73]
37 1275 1654 1536 1962 1.2% 0.93[0.80,1.09]
38 92 126 141 177 0.1% 0.69[0.40,1.18]
33 263 348 655 816 0.3% 0.76[0.56,1.03]
39 352 434 213 253 0.2% 0.81[0.53,1.22]
27 244 364 250 344 0.3% 0.76[0.55,1.06]
27 54 77 50 71 0.1% 0.99[0.49,2.00]
27 237 322 229 297 0.2% 0.83[0.57,1.20]
40 14 17 6 7 0.0% 0.78[0.07,9.08]
12 47 52 33 36 0.0% 0.85[0.19,3.83]
41 412 546 534 691 0.4% 0.9[0.69,1.18]
42 88 122 71 110 0.1% 1.42[0.82,2.48]
26 87 138 53 69 0.1% 0.51[0.27,0.99]
43 26 37 34 42 0.0% 0.56[0.20,1.58]
44 568 764 2195 2836 0.9% 0.85[0.70,1.02]
45 393 524 417 530 0.4% 0.81 [0.61,1.08]
32 180 266 187 245 0.2% 0.65[0.44,0.96]
13 266 345 404 504 0.3% 0.83[0.60,1.16]
46 382 516 408 532 0.4% 0.87[0.65,1.15]
31 322 437 505 632 0.4% 0.7[0.53,0.94]
28 446 573 396 503 0.3% 0.95[0.71,1.27]
47 45 62 27 38 0.0% 1.08[0.44,2.64]
48 52 58 81 82 0.0% 0.11[0.01,0.91]
49 247 306 169 226 0.1% 1.41 [0.93,2.1 3]
25 656 849 204 256 0.3% 0.87[0.61,1.22]
50 232 315 195 245 0.2% 0.72[0.48,1.07]
This study 36 50 52 60 0.0% 0.4[0.15,1.04]
51 360 485 883 1218 0.5% 1.09[0.86,1.39]
52 137 186 1287 1690 0.2% 0.88[0.62,1.24]
53 587 770 517 710 0.5% 1.2[0.95,1.51]
54 560 830 486 667 0.6% 0.77[0.62,0.97]
55 734 980 570 741 0.6% 0.9[0.72,1.12]
56 863 1192 930 1218 0.9% 0.81 [0.68,0.98]
Subtotal (95% CI) 16437 21261 12.0% 0.86[0.82. 0.91]
Total events 12308 16423
Heterogeneity: Chi-Square = 52.22, df=36 (P =0.04); 12= 31% Odds Ratio > 1; Increased Risk
Test for overall effect: Z=5.73 (P < 0.00001) Odds Ratio < 1; Decreased Risk
Table 11 T2DM risk associated with KCNJ11 rs5219 polymorphism in dominant model with OR and 95% CI
Dominant model
Study or Subgroup Cases Events Total Controls Events Total Weight M-H, Fixed, 95% CI
29 209 550 83 335 0.5% 1.86[1.38,2.52]
34 301 499 282 494 0.7% 1.14[0.89,1.47]
35 1622 2734 2609 4234 1.0% 0.91[0.82,1.00]
36 106 172 65 113 0.3% 1.19[0.73,1.92]
30 454 588 414 597 0.6% 1.5[1.16,1.94]
37 1654 2709 1962 3344 1.0% 1.1[1.00,1.22]
38 126 192 177 296 0.4% 1.28[0.88,1.87]
33 348 550 816 1433 0.8% 1.3[1.06,1.59]
39 434 805 253 503 0.7% 1.16[0.92,1.44]
27 364 477 344 473 0.6% 1.21[0.90,1.62]
27 77 104 71 98 0.2% 1.08[0.58,2.02]
27 322 496 297 506 0.6% 1.3[1.01,1.68]
40 17 53 7 30 0.1% 1.55[0.56,4.32]
12 52 319 36 324 0.3% 1.56[0.99,2.46]
41 546 854 691 1182 0.8% 1.26[1.05,1.51]
42 122 190 110 158 0.3% 0.78[0.50,1.23]
26 138 191 69 114 0.3% 1.7[1.04,2.78]
43 37 58 42 75 0.2% 1.38[0.69,2.80]
44 764 1187 2836 4791 1.0% 1.25[1.09,1.42]
45 524 858 530 862 0.8% 0.98[0.81,1.19]
32 266 397 245 392 0.6% 1.22[0.91,1.63]
13 345 573 504 843 0.7% 1.02[0.82,1.26]
46 516 803 532 862 0.8% 1.12[0.91,1.36]
31 437 682 632 1078 0.8% 1.26[1.03,1.53]
28 573 906 503 889 0.8% 1.32[1.09,1.60]
47 62 100 38 82 0.2% 1.89[1.04,3.42]
48 58 572 82 587 0.5% 0.69[0.49,0.99]
49 306 532 226 374 0.6% 0.89[0.68,1.16]
25 849 1384 256 414 0.7% 0.98[0.78,1.23]
50 315 484 245 397 0.6% 1.16[0.88,1.52]
This study 50 218 60 214 0.4% 0.76[0.49,1.18]
51 485 750 1218 1879 0.8% 0.99[0.83,1.19]
52 186 287 1690 2684 0.6% 1.08[0.84,1.40]
53 770 1165 710 1135 0.9% 1.17[0.98,1.38]
54 830 1114 667 953 0.8% 1.25[1.03,1.52]
55 980 1590 741 1244 0.9% 1.09[0.94,1.27]
56 1192 1848 1218 1910 1.0% 1.03[0.90,1.18]
Subtotal (95% CI) 26991 35899 23% 1.14 [1.08,1.21]
Total events 6437 21261
Heterogeneity: Tau-= 0.01; Chi2= 78.53 ,df= 36 (P =0.0001); 12= 54% Odds Ratio > 1; Increased Risk
Test for overall effect: Z=4.56 (P < 0.00001) Odds Ratio < 1; Decreased Risk
Table 12 T2DM risk associated with KCNJ11 rs5219 polymorphism in recessive model with OR and 95% CI
Recessive model
Study or Subgroup Cases Events Total Controls Events Total Weight Odds Ratio M-H, Fixed, 95% CI
29 22 550 8 335 0.0% 1.70 [0.75,3.87]
34 81 499 57 494 0.2% 1.49 [1.03,2.14]
35 402 2734 603 4234 1.5% 1.04 [0.91,1.19]
36 21 172 18 113 0.1% 0.73 [0.37,1.45]
30 115 588 62 597 0.2% 2.10 [1.50,2.93]
37 379 2709 426 3344 1.2% 1.11 [0.96,1.29]
38 34 192 36 296 0.1% 1.55 [0.93,2.58]
33 85 550 161 1433 0.3% 1.44 [1.09,1.92]
39 82 805 40 503 0.2% 1.31 [0.88,1.95]
27 120 477 94 473 0.3% 1.36 [1.00,1.84]
27 23 104 21 98 0.1% 1.04 [0.53,2.03]
27 85 496 68 506 0.2% 1.33 [0.94,1.88]
40 3 53 1 30 0.0% 1.74 [0.17, 17.51]
12 5 319 3 324 0.0% 1.70 [0.40,7.19]
41 134 854 157 1182 0.4% 1.22 [0.95,1.56]
42 34 190 39 158 0.1% 0.67 [0.40,1.12]
26 51 191 16 114 0.1% 2.23 [1.20,4.14]
43 11 58 8 75 0.0% 1.96 [0.73,5.24]
44 196 1187 641 4791 0.8% 1.28 [1.08,1.52]
45 131 858 113 862 0.3% 1.19 [0.91,1.57]
32 86 397 58 392 0.2% 1.59 [1.10,2.30]
13 79 573 100 843 0.3% 1.19 [0.87,1.63]
46 134 803 124 862 0.4% 1.19 [0.91,1.55]
31 115 682 127 1078 0.3% 1.52 [1.16,2.00]
28 127 906 107 889 0.3% 1.19 [0.90,1.57]
47 17 100 11 82 0.0% 1.32 [0.58,3.01]
48 6 572 1 587 0.0% 6.21 [0.75, 51.76]
49 59 532 57 374 0.2% 0.69 [0.47, 1.03]
25 193 1384 52 414 0.3% 1.13 [0.81, 1.57]
50 83 484 50 397 0.2% 1.44 [0.98, 2.10]
This study 14 218 8 214 0.0% 1.77 [0.73, 4.30]
51 125 750 335 1879 0.6% 0.92 [0.74, 1.15]
52 49 287 403 2684 0.2% 1.17 [0.84, 1.61]
53 183 1165 193 1135 0.6% 0.91 [0.73, 1.13]
54 270 1114 181 953 0.5% 1.36 [1.10, 1.69]
55 246 1590 171 1244 0.6% 1.15 [0.93, 1.42]
56 329 1848 288 1910 0.8% 1.22 [1.03, 1.45]
Subtotal (95% CI) 26991 36899 11.4% 1.19 [1.14, 1.26]
Total events 4129 4838
Heterogeneity: Chi-Square = 64.47, df=36 (P = 0.002); 12= 44% Odds Ratio > 1; Increased Risk
Test for overall effect: Z=7.38 (P < 0.00001) Odds Ratio < 1; Decreased Risk
Figure 4

Funnel plot for association between KCNJ11 rs5219 polymorphism and T2DM susceptibility. Funnel plot for publication bias on five genetic models in pooled analysis.

Figure 5

Funnel plot for association between KCNJ11 rs5219 polymorphism and T2DM susceptibility. Funnel plot for publication bias on five genetic models in sub-group analysis of Caucasian population.

Figure 6

Funnel plot for association between KCNJ11 rs5219 polymorphism and T2DM susceptibility. Funnel plot for publication bias on five genetic models sub-group analysis of Asian population.

4.2.3. Sub-group meta-analysis of rs5219

In a meta-analysis of sub-groups, the selected articles were stratified based on the ethnic background such as Caucasian (21 studies), others (04 studies) and Asian (12 studies), respectively. The results of sub-grouping Caucasian ethnicity revealed moderate heterogeneity in all the analyzed genetic models. Hence, the random-effects model was adopted to test the influence of polymorphism in the five genetic models. Similarly, the sub-group stratification results of the rs5219 variant in Asian ethnicity exhibited moderate heterogeneity in all the analyzed genetic models. Based on heterogeneity results, the fixed effects model was used which showed positive (p = 0.05) association with T2DM susceptibility in jj vs. JJ with OR = 1.21, (95% CI (1.05-1.40)), and Jj + jj vs. JJ with OR = 1.12, (95% CI (1.06-1.18)) respectively. Random-effect model was adopted which showed positive (p = 0.05) association with a risk of T2DM in j vs. J with OR = 1.10, (95% CI (1.02-1.20)) and jj vs. JJ +Jj with OR = 1.16, (95% CI (1.01-1.33)) genetic models respectively. Further, the Asian sub-group analysis was divided into (South-Asian=03, East-Asian=08, West-Asian =01) ethnic background. The results of subgroup analyses were illustrated in (Table 13).

Table 13 Meta-analyses of rs5219 polymorphism and T2DM risk in each sub-group
Genetic models
SNP-ID: rs5219 No of studies Ethnicity I2 (%) Model OR (95%CI) Z-Test P-value
C vs T Allelic Model 21 Caucasian 62 random 1.06 (1.09-1.23) 4.97 <0.00001
12 Asian 65 random 1.10 (1.02-1.20) 2.49 0.01
03 South-Asian 00 fixed 0.85 (0.73-0.98) 2.19 0.03
08 East-Asian 20 fixed 1.11 (1.06-1.17) 4.64 <0.00001
04 Others 36 fixed 1.06 (0.95-1.18) 1.08 0.28
CC vs TT Homozygote Model 21 Caucasian 60 random 1.35 (1.20-1.52) 5.01 <0.00001
12 Asian 44 fixed 1.21 (1.05-1.40) 2.55 0.01
03 South-Asian 41 fixed 0.74 (0.54-1.02) 1.87 0.06
08 East-Asian 22 fixed 1.25 (1.14-1.38) 4.58 <0.00001
04 Others 00 fixed 1.31 (1.01-1.69) 2.06 0.04
CT vs TT Heterozygote Model 21 Caucasian 20 fixed 0.84 (0.78-0.97) 4.39 <0.0001
12 Asian 51 random 0.89 (0.78-1.03) 1.56 0.12
03 South-Asian 67 random 1.07 (0.58-1.95) 0.21 0.84
08 East-Asian 42 fixed 0.87 (0.79-0.95) 2.95 0.003
04 Others 13 fixed 0.78 (0.61-1.01) 1.87 0.06
CC + CT vs TT Dominant Model 21 Caucasian 61 random 1.14 (1.04-1.25) 2.91 0.004
12 Asian 49 fixed 1.12 (1.06-1.18) 3.9 <0.0001
03 South-Asian 82 random 0.90 (0.58-1.38) 0.49 0.63
08 East-Asian 33 fixed 1.16 (1.08-1.25) 3.89 0.0001
04 Others 00 fixed 1.31 (1.14-1.50) 3.89 0.0001
CC vs CT + TT Recessive Model 21 Caucasian 66 random 1.21 (1.14-1.28) 6.32 <0.00001
12 Asian 55 random 1.16 (1.01-1.33) 2.10 0.04
03 South-Asian 49 fixed 0.76 (0.57-1.02) 1.81 0.07
08 East-Asian 36 fixed 1.19 (1.09-1.30) 3.96 <0.0001
04 Others 00 fixed 1.28 (1.01-1.68) 2.02 0.04
5. DISCUSSION

The current global prevalence of T2DM has been increased exponentially in recent years, which represents a major challenge to health care professionals and considered a global health concern with an impact on premature mortality, morbidity, and its related (Microvascular and Macrovascular) complications, especially in the elderly people (57). Previous studies suggest that T2DM is a multifactorial disorder caused because of complex genetic interactions and environmental factors (58, 59). The KCNJ11 gene based on its position in the chromosome, considered as a promising candidate gene for T2DM which functions in regulating glucose-induced insulin secretion (60). It has been documented that the rs5219 variant observed in the 11p15.1 region might play a significant role in T2DM development, hence making it a biomarker for assessing the KCNJ11 gene (25). In the association study, the relationship between KCNJ11 p.E23K polymorphism with T2DM susceptibility was identified, to the best of our understanding; this is the first study in South Indian population to determine the relationship between KCNJ11 gene rs5219 polymorphism and T2DM risk. The results of the case-control study showed a significant (P-value < 0.05) relationship with the genotype frequencies among T2DM subjects and controls revealing that the rs5219 variant may be a potential risk factor in the South Indians population. A study from UK diabetic subject’s revealed a significant association of rs5219 (TT genotype) compared with age-matched controls, OR=2.54 (95% CI (1.23-5.25)) P-value = 0.016, respectively (30). The results of the association study were in similarity with previously published studies from France (26), Sweden (27), Japanese (28) and Saudi-Arabian (29) T2DM subjects belonging to Caucasian and Asian ethnic populations. Our results from the case-control study confirm the involvement of the KCNJ11 gene rs5219 SNP in the T2DM etiology, despite the populations and also with the geographical locations, respectively. Besides, the rs5219 polymorphism showed an insight towards high HbA1c and serum uric acid, which confirms its functional importance in T2DM patients.

An extensive meta-analysis was executed to determine the relationship between KCNJ11 rs5219 SNP with T2DM among Asian and Caucasian ethnic populations. The research articles related to the KCNJ11 gene were identified through a systematic search followed by the quality assessment using HWE and NOS scores. The meta-analysis results for rs5219 SNP showed a significant association (P-value < 0.05) among the allelic (T vs C) homozygote (TT vs CC), heterozygote (CT vs CC), dominant (CT+TT vs CC) and recessive (TT vs CC+CT) genetic models. These results were in agreement with previously published studies from UK (30), USA (31), Chinese (32), Japanese (33) and T2DM cases belonging to Caucasian and Asian ethnic backgrounds. However, the insignificant association was observed in Finland (61), and Czech (36) T2DM subjects. The discrepancies in the outcomes might be because of the fewer sample size, bias and study heterogeneity. The stratification analysis based on Asian and Caucasian sub-groups revealed a significant association of rs5219 polymorphism with T2DM susceptibility among the studied genetic models. The cell line (in vitro) based studies on the p.E23K variant have suggested that it leads to a decrease in the sensitivity of Kir6.2 (subunit) towards the ATP, thus inhibiting the insulin secretion (62).

The potential strength of our KCNJ11 rs5219 meta-analysis includes a large sample size of 26,991 T2DM subjects and 35,899 controls there are few considerable limitations. First, we determined the association between rs5219 variant with T2DM risk, and the relationships with other confounding factors such as fasting insulin, fasting glucose concentrations, and lifestyle were not included in our case-control study. Second, stratification analysis based on gender, age, lifestyle factors were not performed, because of the lack of uniform background data. Third, articles published in the English language were only considered. Fourth, we could not explain the underlying mechanisms of gene-environmental interactions.

6. CONCLUSION

In conclusion, the rs5219 polymorphism in the KCNJ11 gene was found to be associated with T2DM susceptibility in south Indians. Our findings, together with previous reports from Asians and Caucasians, show that the KCNJ11 gene possesses a significant association with T2DM across multiple ethnicities. The results of meta-analysis, further add growing evidence of the positive effect of rs5219 SNP on T2DM susceptibility. However, T2DM confounding factors such as hyperlipidemia, obesity, environmental, gene-gene interactions are necessary for verifying this association.

7. ACKNOWLEDGMENTS

Rajagopalan Aswathi, Dhasaiya Viji, Prathap seelan and Pricilla Charmine equally contributed this work. These three authors thank Chettinad Academy of Research and Education for funding this research. All the authors were thankful to the patients and controls for participating in the study. The author (Akram Husain) wishes to acknowledge Chettinad Academy of Research and Education (CARE) for providing chettinad research fellowship. All the authors declare that they have no conflict of interest.

Abbreviations
Abbreviation Expansion
T2DM

Type-2 Diabetes Mellitus

GWAS

Genome-Wide Association Studies

KCNJ11

Potassium Voltage-Gated Channel Subfamily J Member-11

LD

Linkage Disequilibrium

PRISMA

Preferred Reporting Items For Systematic Reviews And Meta-Analysis

ARMS-PCR

Amplification Refractory Mutation System-Polymerase Chain Reaction

HWE

Hardy-Weinberg Equilibrium

NOS

Newcastle Ottawa Scale

OR

Odds Ratios

CI

Confidence Interval

References