Gene expression data from TCGA and Genotype-Tissue Expression (GTEx) were analyzed through gene expression profiling and interactive analyses (http://gepia.cancer-pku.cn/index.html). Immunohistochemical data from TCGA were sourced from the Human Protein Atlas (https://www.proteinatlas.org/humanproteome/tissue).

This analysis involved a group of 45 patients diagnosed with ovarian cancer, all of whom received their diagnosis and treatment at Beijing Chaoyang Hospital, affiliated with Capital Medical University, between January 2016 and September 2020. To identify the primary tumor location, a histological examination was conducted using hematoxylin and eosin (HE)-stained slides. For each sample, a single 1-mm diameter tissue core was extracted and manually embedded into a recipient paraffin block using a manual tissue arrayer.

TMA sections, each 5 µm thick, were dewaxed in xylene for 15 minutes. They were then rehydrated through a series of ethanol concentrations and rinsed with phosphate-buffered saline. To inhibit endogenous peroxidase activity, the sections were treated with a 3% hydrogen peroxide solution in methanol for 30 minutes. Antigen retrieval was performed using a microwave method with a citric acid buffer at pH 6.0. After this, the sections were incubated at room temperature for one hour in a 5% bovine serum albumin (BSA) solution (Cat# A8010, Solarbio, Beijing, China). The TMA sections were then incubated overnight at 4 ℃ with a rabbit anti-MAP7 antibody (1:100, Cat# ab240695, Abcam, Cambridge, UK), diluted in 5% BSA solution. Following this, they were treated with a horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (1:100, Cat# PV6001, ZSBG-BIO, Beijing, China), for one hour at room temperature. The sections were then exposed to 500 µL of 3,3′-diaminobenzidine (DAB) (Cat# PV6001, ZSBG-BIO, Beijing, China) for one minute followed by staining with hematoxylin for 30 seconds and dehydration. The sections were then mounted following standard protocols and staining scores were assessed using Image Pro Plus (version 6.0; Media Cybernetics, Rockville, MD, USA).

H-SCORE = $\sum$(PI $\times$ I) = (percentage of cells of weak intensity $\times$ 1) + (percentage of cells of moderate intensity $\times$ 2) + percentage of cells of strong intensity $\times$3).

Human ovarian cancer cell lines SKOV3 (HTB77) was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Human ovarian cancer cell lines A2780 (SCSP-5477) was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The two cells were cultured in RPMI-1640 medium (Cat# 11875093, Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Cat# 10270106, Gibco, Waltham, MA, USA) and 1% penicillin/streptomycin (Cat# 15140122, Thermo Fisher Scientific, Waltham, MA, USA), and maintained at 37 °C in a 5% CO₂ humidified incubator. All the cell lines are obtained from the Chinese Academy of Sciences at 2018. We tested for mycoplasma contamination and verified cells by short tandem repeat (STR) test; morphology was confirmed by pathologist before the experiments. Before the experiment began, we excluded mycoplasma contamination by RT-PCR.

The in vitro cell experiment used siRNA transfection and overexpression plasmids to infect the expression of MAP7. The following siRNA sequences were used: si-MAP7, 5^′-CAGCTACAAAGTGCAAGATAAGA-3^′, si-NC: 5^′-TTCTCCGAACGTGTCACGTTT-3^′. Full-length fragment of MAP7 was synthesized and inserted into the pcDNA3.1 plasmid. Transfection was performed using lipo2000, and cells were collected for transfection efficiency detection 48 hours after transfection.

The cells used in the tumorigenicity assay in nude mice were established as stable transfected cell lines through lentiviral transfection. The specific short hairpin RNAs (shRNAs) targeting the MAP7 gene and scrambled shRNA (negative control, NC) were cloned into the GV248 plasmid. The following shRNA sequences were used: sh-MAP7, 5^′-ACCATGAATCTTTCGAAATAT-3^′. The MAP7 cDNA was ligated into a lentiviral vector, the GV492 plasmid, to amplify the MAP7 gene. The MAP7 cDNA was ligated into a lentiviral vector, the GV492 plasmid, to amplify the MAP7 gene.

Total RNA was extracted from either cells or tissues using TRIzol (Cat# 15596026, Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. For reverse transcription, 1 µg of RNA was used with a PrimeScript RT reagent kit that contains a gDNA eraser (Takara Bio, RR047A, Kusatsu, Japan). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a Roche Light Cycler 480 II detection system (Roche, Basel, Switzerland). The detection of cDNA was carried out according to the instructions supplied with the SYBR® Premix Ex TaqTM kit (Cat# RR420A, Takara Bio, Shiga, Japan). Each sample was analyzed in duplicate, starting with an initial denaturation step at 95 °C for 30 seconds, followed by 40 cycles of 95 °C for 5 seconds and 60 °C for 31 seconds. The relative expression of MAP7 was normalized to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) value. The PCR primers used for real-time PCR were: MAP7, TCATCATGCCCTACAAAGCTG (forward) and TGCCAGATGTGAGGAAGAGTA (reverse); GAPDH, AAGGTCATCCCTGAGCTGAAC (forward) and ACGCCTGCTTCACCACCTTCT (reverse). The relative mRNA expression levels were calculated using the 2^-Δ⁢CT method.

Protein was extracted from both cells and tissues utilizing a lysis buffer designed for radioimmunoprecipitation assays (Solarbio, R0010, Beijing, China), which included inhibitors for protease and phosphatase (Solarbio, IKM1020, Beijing, China). A total of 30 µg of proteins extracted from cells and tissues were loaded onto 10% acrylamide gels for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The proteins separated through electrophoresis were transferred to nitrocellulose membranes (Millipore, St Quentin-en-Yvelines, France) and incubated overnight with specific antibodies. Following this, a second incubation with HRP-conjugated antibodies (ZSGB-BIO, PV6001, Beijing, China) was performed. The resulting films were digitized using a calibrated BioRad GS 800 densitometer, and the signals were quantified with Image J software (National Institutes of Health, Bethesda, MD, USA). The antibodies used in this study included p-Akt (1:100, ab81283, Abcam, Cambridge, UK), Akt (1:100, ab8805, Abcam, Cambridge, UK), p-mTOR (1:100, ab109268, Abcam, Cambridge, UK), mTOR (1:100, ab32028, Abcam, Cambridge, UK), MAP7 (1:100, ab240695, Abcam, Cambridge, UK), p62 (1:100, ab109012, Abcam, Cambridge, UK), LC3B (1:100, ab192890, Abcam, Cambridge, UK), Beclin1 (1:100, ab302669, Abcam, Cambridge, UK), and GAPDH (1:1000, ab8245, Abcam, Cambridge, UK), all obtained from Abcam.

The invasion assay was conducted using 24-well inserts with membranes (Corning Costar, 3422, Kennebunk, ME, USA), following established protocols. A2780 and SKOV3 cell lines were trypsinized and then plated into transwell inserts that had been pre-coated with 200 µg/mL of matrigel (BD Biosciences, 356234, Franklin Lakes, NJ, USA) at a density of 5 $\times$ 10⁴ cells per insert. The upper chambers were filled with RPMI 1640 medium containing 0.1% FBS, while the lower chambers contained RPMI 1640 medium supplemented with 10% FBS. After 30 hours, the cells were fixed and stained with crystal violet. The cells that adhered to the upper side of the membrane were carefully removed, and the number of stained cells on the lower side of the membrane was counted using a light microscope.

Cells were seeded at a density of 3 $\times$ 10³ cells per well across six wells in 96-well plates, with each condition replicated six times. The CCK-8 reagent (Solarbio, CA1210, Beijing, China) was introduced to four separate 96-well plates following incubation periods of 0, 4, 24, 48, or 72 hours. Subsequently, after a 2-hour incubation with the CCK-8 reagent, absorbance was measured at a wavelength of 450 nm utilizing an enzyme-linked immunosorbent assay (ELISA) plate reader. This assay was conducted in triplicate to ensure reproducibility.

Tumor tissues were harvested and fixed in paraformaldehyde for 24 hours. The paraffin-embedded specimens were cut into 4 µm sections before staining with HE and immunohistochemistry (IHC). A MAP7 polyclonal antibody (Abcam, ab240695, Cambridge, UK), diluted 1:100 in 5% BSA, was then applied. An HRP-conjugated goat anti-rat IgG (Abcam, ab6721, Cambridge, UK) was used as the secondary antibody. The staining was then performed using a DAB-containing solution (ZSGB-BIO, ZLI9018, Beijing, China).

All procedures performed in animal studies were approved by the Animal Research Ethics Committee of Capital Medical University (AEEI-2022-006). A2780 human ovarian cancer cells (cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37 °C in 5% CO₂) were trypsinized using 0.25% trypsin-EDTA (Gibco, 25200056, Waltham, MA, USA) for 3 min at 37 °C, pelleted by centrifugation at 300 $\times$g for 5 min, washed twice with PBS, and resuspended in ice-cold PBS at a density of 3 $\times$ 10⁶ cells/100 µL. Twenty-four female BALB/c nude mice (4-week-old, 12–16 g) purchased from Vital River Laboratories (Beijing, China) were housed under specific pathogen-free conditions (22 $\pm$ 1 °C, 55 $\pm$ 5% humidity, 12-h light/dark cycle) with unrestricted access to autoclaved food and water. Following subcutaneous injection into the right flank using a 27-gauge needle, tumor growth was monitored every 3 days using a digital caliper. Tumor volume (mm³) was calculated as V = 0.5 $\times$ major axis (D) $\times$ minor axis² (d). When tumors reached 800–1000 mm³ (or 21 days post-injection), mice were euthanized via CO₂ asphyxiation (30% chamber volume displacement rate) followed by cervical dislocation for confirmation. Excised tumors were weighed, photographed, and divided into two aliquots: fresh-frozen in liquid nitrogen for protein and RNA analysis, and fixed in 4% paraformaldehyde for histology.

Statistical analyses were performed using SPSS version 22.0 (SPSS, Inc., Chicago, IL, USA). Survival curves were created using the Kaplan-Meier life table method. All quantitative data are expressed as mean $\pm$ standard deviation (SD). An independent sample t-test was employed, to compare variables across groups, following a homogeneity of variance test to ensure the validity of the results. The relationships among the identified markers were assessed using Spearman’s rank correlation coefficient. A p-value of less than 0.05 was considered statistically significant.

The RNA-seq expression profiles for ovarian cancer were obtained from TCGA, and the normal ovarian tissue datasets were sourced from the GTEx. This dataset contained RNA expression profiles from 424 ovarian cancer tissues and 88 normal tissues. Analysis shows that MAP7 is overexpressed in ovarian cancer (p 0.001) (Fig. 1A). Additionally, the expression level of MAP7 was found to be high across different pathological stages (Fig. 1B). This finding suggests that MAP7 plays an important role in the progression of ovarian cancer. While the MAP7 low-expression group had a slightly better prognosis than the MAP7 high-expression group, this difference was not statistically significant (Fig. 1C). Moreover, immunohistochemical staining from the Human Atlas supported these results (Fig. 1D), and we validated the MAP7 expression patterns using a local ovarian cancer database. Western blot analysis confirmed a notable increase in MAP7 in ovarian cancer tissues compared to adjacent non-cancerous tissues, indicating significant upregulation (p = 0.0033) (Fig. 1E). We used the tissue microarray immunohistochemical method to evaluate the expression of MAP7 in 45 cases of ovarian cancer and para-cancerous tissues. Table 1 provides detailed demographic and clinical information for the 45 ovarian cancer patients included in the study. TMA immunohistochemical staining also demonstrated that the expression level of MAP7 in ovarian cancer was much higher than that in para-cancerous tissues (p 0.001) (Fig. 1F, Table 2). Based on the MAP7 staining score analysis, we stratified a cohort of 45 patients into two groups: MAP7-HIGH and MAP7-LOW, to conduct prognostic analysis. The findings revealed a statistically significant association between high MAP7 expression and poorer prognosis in comparison to low MAP7 expression among the patients studied (p = 0.0129) (Fig. 1G).

Fig. 1.

MAP7 is overexpressed in ovarian cancer. (A–C) The expression profile of MAP7 across all ovarian cancer samples (TCGA database) and paired normal ovarian tissues (GTEx database). (A) MAP7 is upregulated in ovarian cancer (p 0.001). (B) MAP7 expression pattern in different stages of ovarian cancer. (C) MAP7 expression level is not associated with the prognosis of ovarian cancer. (D) TMA analysis indicates that MAP7 levels in ovarian cancer tissues are higher than in normal ovarian tissues, according to The Human Protein Atlas. The magnification of the pictures was 20$\times$. (E) Western blot analysis shows that MAP7 is upregulated in ovarian cancer (p = 0.0033). (F) TMA analysis shows MAP7 is upregulated in ovarian cancer tissue than para-carcinoma tissue of the local ovarian cancer database. Scale bar = 20 µm. (G) A prognostic analysis was conducted on 45 patients diagnosed with ovarian cancer (p = 0.0129). * p 0.05. TPM, Transcripts Per Kilobase Million; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

We selected the A2780 and SKOV3 cell lines for in vitro experiments. We synthesized small interference RNA and overexpression plasmids to modulate the expression level of MAP7. RT-PCR and Western blot assays confirmed that MAP7 levels were reduced by approximately 30% and elevated by 300% after transfection with siRNA and the expression plasmid, respectively (Fig. 2A–C).

Fig. 2.

MAP7 enhances the invasion, migration, and proliferation of human ovarian cancer cells. (A–C) Establishment of ovarian cancer cell model for MAP7 knockdown and overexpression. (A) Real-time PCR to measure the mRNA expression of MAP7 after siRNA or overexpress plasmid transfer (A2780: si-NC vs. si-MAP7 p = 0.0015, OV-NC vs. OV-MAP7 p = 0.0020; SKOV3: si-NC vs. si-MAP7 p = 0.0002, OV-NC vs. OV-MAP7 p = 0.0001). (B,C) Western blotting to measure the protein level of the expression of MAP7 after siRNA or overexpress plasmid transfer in A2780 cells (B) (A2780: si-NC vs. si-MAP7 p = 0.0011, OV-NC vs. OV-MAP7 p = 0.0003) and SKOV3 cells (C) (SKOV3: si-NC vs. si-MAP7 p = 0.0010, OV-NC vs. OV-MAP7 p = 0.0003). (D,E) Transwell insert assay was carried out to evaluate the role of MAP7 migration and invasion in A2780 cell (D) (invasion: si-NC vs. si-MAP7 p = 0.0008, OV-NC vs. OV-MAP7 p = 0.0479; migration: si-NC vs. si-MAP7 p = 0.0061, OV-NC vs. OV-MAP7 p = 0.0068) and SKOV3 cells (E) (invasion: si-NC vs. si-MAP7 p = 0.0004, OV-NC vs. OV-MAP7 p = 0.0426; migration: si-NC vs. si-MAP7 p = 0.0012, OV-NC vs. OV-MAP7 p = 0.0415). (F,G) CCK8 assay to measure the cell viability in A2780 cells (F) and SKOV3 cells (G) (A2780: si-NC vs. si-MAP7 p 0.0001, OV-NC vs. OV-MAP7 p 0.0001; SKOV3: si-NC vs. si-MAP7 p = 0.0005, OV-NC vs. OV-MAP7 p = 0.0011). Each of the tests was replicated three times. Data are presented as mean $\pm$ SD. * p 0.05. PCR, polymerase chain reaction; si-NC, the control group of the knockdown experiment; OV-NC, the control group of the overexpression experiment.

We next used this model to study the effect of MAP7 on the biological function of ovarian cancer cell lines. Compared to the control group, MAP7 knockdown significantly reduced the invasion and migration of ovarian cancer cells. When we overexpressed MAP7, the invasion and migration of ovarian cancer cells were up-regulated (Fig. 2D,E). Similarly, in proliferation experiments, reduced MAP7 expression could inhibit cell proliferation, while overexpression of MAP7 could promote cell proliferation (Fig. 2F,G).

We examined the expression pattern of the Protein Kinase B/mammalian Target of Rapamycin (Akt/mTOR) signaling pathway in A2780 cells after transfecting with either MAP7 small interfering RNA or an overexpression plasmid (Fig. 3A). The activation or inhibition of the Akt/mTOR signaling pathway depends on whether MAP7 is increased or decreased (Fig. 3A). This relationship may play a crucial role in enhancing the biological functions of tumor cells. Similarly, we conducted verification using SKOV3 cells. The experimental data confirmed that MAP7 enhances the activation of the Akt/mTOR signaling pathway (Fig. 3B).

Fig. 3.

MAP7 regulates the biological function of ovarian cancer cells by mediating autophagy. Western blotting to measure the expression level of autophagy-related genes after siRNA or overexpress plasmid transfer in A2780 cells (A) (si-NC vs. si-MAP7: Beclin1: p = 0.068, p62: p 0.001, LC3B: p = 0.0021, p-Akt: p = 0.0077, p-mTOR: p = 0.0159; OV-NC vs. OV-MAP7: Beclin1: p 0.001, p62: p 0.001, LC3B: p = 0.0032, p-Akt: p = 0.0006, p-mTOR: p = 0.0066) and SKOV3 cells (B) (si-NC vs. si-MAP7: Beclin1: p = 0.0399, p62: p = 0.0177, LC3B: p = 0.018, p-Akt: p = 0.003, p-mTOR: p = 0.026; OV-NC vs. OV-MAP7: Beclin1: p = 0.004, p62: p = 0.0062, LC3B: p = 0.065, p-Akt: p = 0.0133, p-mTOR: p = 0.0402). The bar chart shows the statistical results of p-Akt, p-mTOR, Beclin1, p62, and LC3B. Each of the tests was replicated three times. Data are presented as mean $\pm$ SD. * p 0.05. p-Akt, phosphorylated Protein Kinase B; p-mTOR, phosphorylated mTOR; LC3B, Microtubule Associated Protein 1 Light Chain 3 Beta.

MAP7 gene knockdown or overexpression in A2780 cells was assessed by using the Lentiviral vector system. A2780 cells were infected with Lentivirus-shScrmble RNA or Lentivirus-the control group of the overexpression experiment (Lentivirus-OV-NC) as a control. Western blot analysis confirmed that MAP7 knockdown efficiency was 80%, while overexpression efficiency was 200% (Fig. 4A).

Fig. 4.

MAP7 promotes ovarian cancer progression. (A) Construction of A2780 cells with stable MAP7 knockdown or overexpression using a lentivirus system. Western Blot showing the relative expression levels of MAP7 in A2780 cells stably transfected with MAP7 lentivirus (si-NC vs. si-MAP7 p = 0.0008, OV-NC vs. OV-MAP7 p = 0.0138). (B,C) Tumor formation assays. A2780 cells were injected subcutaneously into the upper back of nude mice (6 mice per group). Mice were examined for tumor formation every 5 days. (D) HE and IHC staining of tumor structure. Scale bar = 20 µm. (E,F) The bar chart shows the statistical result of p-Akt (si-NC vs. si-MAP7 p = 0.0035, OV-NC vs. OV-MAP7 p = 0.015), p-mTOR (si-NC vs. si-MAP7 p = 0.0057, OV-NC vs. OV-MAP7 p = 0.024), Beclin1 (si-NC vs. si-MAP7 p 0.001, OV-NC vs. OV-MAP7 p = 0.0138), p62 (si-NC vs. si-MAP7 p = 0.0017, OV-NC vs. OV-MAP7 p = 0.0068), and LC3B (si-NC vs. si-MAP7 p = 0.049, OV-NC vs. OV-MAP7 p = 0.0022). Each of the tests was replicated three times. Data are presented as mean $\pm$ SD. * p 0.05. HE, hematoxylin and eosin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

To investigate the role of MAP7 in ovarian cancer progression, we injected four groups of six nude mice with either lentivirus MAP7 knockdown cells, overexpression cells, or control cells. The size of the tumor was monitored every 5 days. When the tumor volume in the control group reached 0.5–1 cm³, the experiment was terminated, and tumor tissues were collected. MAP7 knockdown significantly decreased the tumorigenic potential of A2780 cells compared to the control group (Fig. 4B,C). A significant upregulation of MAP7 notably enhanced the tumorigenic potential of ovarian cancer cells (Fig. 4B,C). Then the tumor tissues were identified by HE staining and immunohistochemistry of MAP7 (Fig. 4D). Akt/mTOR signaling pathway is involved in tumor development (Fig. 4E,F). The xenograft experiment in nude mice showed that changes in MAP7 expression significantly affect the tumorigenic potential of ovarian cancer cell lines. This provides further evidence that MAP7 promotes ovarian cancer progression.