1 Encephalopathy Department, Xi’an Hospital of Traditional Chinese Medicine, 710021 Xi’an, Shaanxi, China
2 Science and Technology Innovation Center, Guangzhou University of Chinese Medicine, 510405 Guangzhou, Guangdong, China
3 Endocrinology Department of Shenzhen Hospital, Beijing University of Chinese Medicine, 518172 Shenzhen, Guangdong, China
4 Encephalopathy Department, Shaanxi Provincial Hospital of Chinese Medicine, 710003 Xi’an, Shaanxi, China
Abstract
Background: Alzheimer’s disease
(AD) is a chronic neurodegenerative brain disorder currently without satisfactory
therapeutic treatments. Triggering receptors expressed on a myeloid cells-2
(Trem2) gene mutation has been reported as a powerful AD risk factor
that induces Trem2 gene deletion aggravated microglia disfunction and
Amyloid-
Keywords
- Danggui-Shaoyao-San
- triggering receptor expressed on myeloid cells-2
- microglia polarization
- Amyloid-β deposition
- Alzheimer's disease
Alzheimer’s disease (AD) is a chronic neurodegenerative brain disorder currently
without satisfactory therapeutic alternatives [1, 2]. With an increasingly aged
population, the incidence of AD is increasing annually and the number of AD
patients is predicted to reach 130 million worldwide by 2050 [3, 4].
Amyloid-
Microglia are resident immune cells of the central nervous system (CNS) and
serve the role of immune surveillance [9]. In pathological situations, microglia
are activated by toxic A
A triggering receptor expressed on myeloid cells-2 (Trem2) is a cell
surface receptor protein of the immunoglobulin receptor superfamily that is
predominantly expressed on brain microglia [15]. Recent studies have revealed
that Trem2 gene mutation is a powerful AD risk factor that slows down
the clearance of cell debris and toxic A
Danggui-Shaoyao-San (DSS) is a traditional Chinese medicine formula, first
recorded in Synopsis of Prescriptions of Golden Chamber written by Zhang Zhong-Jing during the Eastern Han Dynasty. DSS was originally
employed to treat gynecological diseases and was then found to have effects on
forgetfulness. More recently, medical records and clinical studies have suggested
that DSS may significantly improve the clinical symptoms of patients with
dementia [19, 20, 21]. Experimental animal studies have also demonstrated that DSS
alleviates cognitive impairment in AD models [22, 23, 24]. Furthermore, DSS may also
increase the expression of the M2 microglia polarization marker IL-4 and reduce
the level of the M1 microglia biomarker TNF-
Six herbs of Danggui-Shaoyao San, Angelica sinensis (Oliv.) Diels (Umbelliferae), Paeonia lactiflora Pall. (Paeoniaceae), Poria cocos (Schw.) Wolf (Polyporaceae), Atractylodes macrocephala Koidz. (Compositae), Ligusticum chuanxiong Hort. (Umbelliferae) and Alisma orientalis (Sam.) Juzep. (Alismataceae) were purchased from the Pharmacy Room of the First Affiliated Hospital of Guangzhou University of Chinese Medicine (Guangzhou, China). LPS (lipopolysaccharide) (Cat No. L2630, sigma, St. Louis, MO, USA), murine IL-4 (Cat No. 96-214-14-20, PeproTech, Suzhou, China), Arg1 (Cat No. 16001-1-AP, Proteintech Group, Wuhan, China), and antibodies against OX42 (Cat No. ab1211), Trem2 (Cat No. ab86491), iNOS (Cat No. ab15323), Arg1 and GAPDH (Cat No. ab8245) were purchased from Abcam (Cambridge, UK).
The extraction of DSS was performed in the Laboratory of Science and Technology Innovation Center, Guangzhou University of Chinese Medicine. Angelica sinensis (Oliv.), Paeonia lactiflora Pall, Poria cocos (Schw.) Wolf, Atractylodes macrocephala Koidz., Ligusticum chuanxiong Hort. and Alisma orientalis (Sam.) Juzep. were mixed with a ratio of 3:16:4:4:8:8. The herbs were soaked in distilled water (1:8, w/v) for 1 h and extracted for 1 h. After the filtrate was collected, distilled water was added (1:6, w/v) for a second extraction. The two filtrates were then mixed and concentrated to 1.28 g/mL DSS extract at 60 ℃.
Analysis of the main active components of the DSS water extract was performed using HPLC-MS/MS in a previous study [26]. It was found that the extract included 78 main constituents. The concentration of albiflorin, paeoniflorin, benzoic acid, gallic acid, ferulic acid, Chuanxiong lactone Ⅰ, Chuanxiong lactone A were 1.76, 12.15, 0.68, 1.17, 0.29, 0.46 and 0.19 mg per gram extractum, and the highest content was paeoniflorin.
A total of 20 male C57BL/6 mice (seven months old) were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China) and randomly divided into four groups (five mice/group), (1) normal group (0.9% saline, 10 mL/kg/day, i.g.), (2) high-dose DSS group (6.4 g/kg/day, i.g.), (3) mid-dose DSS group (4.8 g/kg/day, i.g.), (4) low-dose DSS group (3.2 g/kg/day, i.g.). The drug intervention period was continued for seven days. Serum samples were collected from the eyeball blood of mice 1 h after the last treatment administration. The serum samples were heat inactivated at 56 ℃ for 30 min, then divided and stored at –20 ℃ until use. The experiment was carried out in accordance with guidelines established by the National Institutes of Health of the United States for the care and use of laboratory animals and was approved by the Laboratory Animal Ethics Committee of the Guangzhou University of Chinese Medicine (Guangzhou, China).
BV2 microglia cells were obtained from the Science and Technology Innovation
Center of Guangzhou University of Chinese Medicine. The cell line has been authenticated based on morphology and functional expression, and mycoplasma testing has been done. Cells were cultured at 37
°C in an atmosphere of 5% CO
Antigen repair was performed with 0.01 M citrate buffer at 90 °C for 30 min. Subsequently, cells were saturated and permeabilized by 0.1% Triton X-100 (Solarbio, Beijing, China) and blocked in goat serum at room temperature. Samples were then incubated overnight at 4 °C with primary antibodies of anti-OX42, anti-iNOS, and anti-Arg1. They were then incubated with goat anti-mouse or goat anti-rabbit IgG at 37 °C for twenty minutes. Finally, the samples were stained with Alexa Fluor 488 anti-rabbit IgG or Alexa Fluor 594 anti-rabbit IgG at room temperature away from light for 1 h. Confocal microscopy (Serial No. 538623, Nikon 80i, Tokyo, Japan) was utilized to capture images. Positive cells were identified from three different perspectives in each sample.
The effect of DSS on the viability of BV2 cells was assessed by cell counting
kit-8 (CCK8). The cells were plated into 96-well plates at a density of 2
The capacity of BV2 cells to phagocytose A
BV2 cells were plated in six-well plates with fresh medium. Trem2 over-expression lentivirus, Trem2 siRNA, and non-targeting siRNA (control vector) transfection were performed respectively according to the manufacturer’s instructions by Lipofectamine 2000 reagent (Lot No. 2744064, Invitrogen, Carlsbad, CA, USA). BV2 cells were cultured in serum-free medium for 8 h then treated with different concentrations of DSS drug-containing serum (0, 3.2, 4.8, and 6.4 g/Kg/d) for 24 h.
The protein of BV2 cells was obtained by lysis with RIPA buffer. Bicinchoninic acid (BCA) assay was employed to quantify the protein concentration. Samples were separated by SDS–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA), and blocked by 5% BSA for 1.5 h at room temperature. The membranes were then incubated overnight at 4 °C with the Trem2, Arg1, and iNOS antibodies specific for target proteins, and then incubated with the secondary antibodies for 1 h at 37 °C. Detection was performed using the Gel Imaging System (Serial No. 721BR19506, Bio-Rad, Hercules, CA, USA) and quantified by Image Lab 5.2.1 software (Bio-Rad, Hercules, CA, USA).
TRIzol reagent (Lot No. 93289, Sigma, St. Louis, MO, USA) was applied to extract total RNA from
BV2 cells with different treatments in each group according to
the instruction manual. The ratio of OD260 to OD280 of total RNA was measured by
microspectrophotometer and the purity and concentration of RNA were calculated.
Samples with a ratio between 1.8–2.0 met experimental requirements. cDNA
templates were prepared by performing reverse transcription reactions according
to the reverse transcription protocol of PrimeScript™ RT Master
Mix (Lot No. RR036B, Takara, Beijing, China). Following
| Gene | Forward sequence | Reverse sequence | Size |
|---|---|---|---|
| IL-1 |
TCAGGCAGGCAGTATCACTC | AGCTCATATGGGTCCGACAG | 250 bp |
| TNF- |
AGCACAGAAAGCATGATCCG | CTGATGAGAGGGAGGCCATT | 212 bp |
| IL-6 | CACAGAGGATACCACTCCCAACAGA | ACAATCAGAATTGCCATTGCACAAC | 124 bp |
| Arg1 | ATCGTGTACATTGGCTTGCG | CGTCGACATCAAAGCTCAGG | 184 bp |
| IL-10 | GCTGGACAACATACTGCTAACCG | CACAGGGGAGAAATCGATGACAG | 218 bp |
| iNOS | TTGGCTCCAGCATGTACCCT | TCCTGCCCACTGAGTTCGTC | 121 bp |
| GAPDH | ATGGGTGTGAACCACGAGA | CAGGGATGATGTTCTGGGCA | 229 bp |
All data were analyzed by the software package Statistic Package for Social
Science (SPSS, v.26.0, Armonk, NY, USA) and data were expressed as mean
BV2 cells were treated either with LPS at a concentration of 100 ng/mL or IL-4 at a concentration of 20 ng/mL in DMEM for 24 h to induce either the M1 or M2 phenotype. As shown in Fig. 1A, the results of immunofluorescence double-labeling revealed that activated BV2 microglia cells with large and round cellular bodies, disappeared cellular projections and amoeboid shape were observed after either LPS or IL-4 treatment. LPS up-regulated the M1 microglia biomarker iNOS, which indicated an alteration of microglia polarization toward M1 status. While IL-4 up-regulated the M2 microglia polarization marker Arg1, which promoted microglia polarization toward a M2 phenotype (Fig. 1B). Moreover, LPS enhanced the protein expression of iNOS and decreased the expression of Trem2 in the M1 polarization state. In contrast, IL-4 remarkably increased the protein expression of Arg1 and Trem2 in the M2 polarization state (Fig. 1C,D). Taken together, Trem2 was highly expressed in the M2 polarization phenotype and poorly expressed in the M1 polarization phenotype.
Fig. 1.Trem2 expression in different polarization states of
BV2 cells. (A,B) Cell morphology changes and immunofluorescence of iNOS
(red)/Arg1 (red) and double immunofluorescence labeling with OX-42
(green). (C,D) Western blot analysis of iNOS, Arg1, and Trem2
protein expression in control, LPS (100 ng/mL), and the IL-4 (20 ng/mL) group.
GAPDH served as the loading control. Scale bar: 10
To further confirm the effect of Trem2 on BV2 microglia activation, the
Trem2 over-expression lentiviral vector and Trem2 siRNA were
used to transfect BV2 cells. The expression of microglia activation marker
proteins was then evaluated by Western blot. Results showed that Trem2
over-expression significantly reduced the protein expression level of iNOS,
whereas increased expression of Arg1 in BV2 cells (Fig. 2A,B). In
contrast, Trem2 silencing obviously enhanced iNOS expression and
inhibited Arg1 production. Results further revealed that Trem2
induced a shift of M1 microglia towards the M2 phenotype (Fig. 2C,D). The effect
of Trem2 on the A
Fig. 2.Effect of Trem2 on microglia polarization and
A
To investigate the effect of DSS on BV2 cell viability, BV2 cells were cultured with different concentrations of DSS-containing serum (3.2 g/kg/d, 4.8 g/kg/d, and 6.4 g/kg/d) for different durations (12 h, 24 h and 48 h). As shown in Fig. 3A, compared with the normal group, cell viability significantly increased in the low, medium, and high dose DSS-containing serum groups. These findings showed that DSS-containing serum increased BV2 cell viability in a dose- and time-dependent manner.
Fig. 3.DSS enhanced cell viability in a dose-dependent manner and
increased Trem2 expression, which promoted the conversion of microglial
cells to the M2 state. (A) Cell viability was detected by CCK8 Assay. (B,C)
Western blot analysis of Trem2 in control and DSS treated groups.
GAPDH served as control. (D,E) mRNA level of the M2 biomarker
Arg1 and IL-10 treated in four different groups for 48 h using
RT-qPCR technology. *p
To verify the effect of DSS on Trem2 expression in BV2 cells,
Trem2 protein expression levels were examined in BV2 cells treated with
different concentrations of DSS-containing serum for 12 h, 24 h, and 48 h. As
shown in Fig. 3B,C, the results of Western blot showed that DSS enhanced
Trem2 expression in BV2 cells and these effects were dose and time
dependent. Next, at the 48 h time point, the effect of DSS on the M2-associated
mRNA expression levels of Arg1 and IL-10 were determined and it
was found that DSS-containing serum dramatically increased the expression of
Arg1 and IL-10 mRNA (Fig. 3D,E). Alternatively, it was observed
that DSS-containing serum significantly reduced the M1-associated mRNA levels of
iNOS and TNF-
Fig. 4.DSS enhances the phagocytosis capacity of microglial
cells in a dose-dependent manner. (A) Fluorescence intensity of cells was
measured by flow cytometry to determine the phagocytosis capacity of A
The effect of DSS on the A
Different concentrations of DSS-containing serum were used to treat BV2 cells
transfected with siRNA-Trem2 and it was found that DSS increases the
A
Fig. 5.DSS did not recover A
Fig. 6.Trem2 silencing inhibited DSS-mediated microglia
polarization toward M2 phenotype and A
Microglia are the main endogenous immune cells of the CNS. Microglia not only
exert a classic role as “scavengers” for the maintenance and restoration of the
CNS, but also play a key role in neuron functioning such as cell migration,
apoptosis, survival, and synaptic plasticity. The effects of microglia in various
neurodegenerative diseases including AD have recently drawn increasing attention
[27, 28]. Trem2 is a transmembrane protein selectively expressed on
microglia in the brain, which enables microglial responses including
proliferation, survival, clustering, and phagocytosis through sustaining cellular
energetic and biosynthetic metabolism during AD [28, 29, 30]. An analysis of genetic
variability revealed that genetic variants of Trem2 were associated with
a threefold increase in the risk of developing AD and that the complete loss of
Trem2 resulted in an early-onset dementia [31, 32]. Furthermore, recent
studies in AD mouse models have confirmed that the loss of Trem2
function caused classic AD pathology and suggested an important role of
Trem2 in microglia function [33, 34, 35]. In the current study, it was found
that Trem2 had positive effects on improving a shift of M1 microglia
towards an M2 phenotype. Moreover, it was shown that Trem2 enhanced the
A
Fig. 7.
The underlying molecular mechanisms of Trem2 displayed
a positive effect on anti-inflammatory M2 polarization of microglia and
A
DSS is a classical Chinese complex prescription for the treatment of AD. Recent
studies have drawn attention to the fact that DSS exhibits anti-inflammatory and
antioxidant activities and prevented cell apoptosis in the hippocampus [36, 37, 38].
Furthermore, DSS administration was shown to ameliorate a scopolamine-induced
decrease in the levels of acetylcholine in AD model mice [39]. Importantly, DSS
treatment has been reported to inhibit neuroinflammation in LPS-induced BV-2
microglia cells [40]. However, the specific mechanisms of action of DSS on
microglia in AD have not yet been completely elucidated. In this study, it was
observed that DSS elevated the viability of BV2 cells and Trem2 protein
expression in a dose and time dependent manner. Furthermore, DSS remarkably
enhanced the expression of M2 microglia phenotype markers Arg1 and
IL-10 mRNA, while reducing the expression levels of M1 microglia
phenotype markers iNOS and TNF-
AD is the most prevalent neurodegenerative disorder leading to severe cognitive
and functional deterioration in an aged population [41]. The presence of
A
However, this study had some limitations. First, DSS prevented the development
of A
In conclusion, this study confirmed that DSS administration promotes the
clearance of A
The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.
QW, XC and CY designed, supervised the study, and supported funding acquisition. GCC, MMH, YC, and CY per-formed the experiment. YLL, ML and LW analyzed the data. GCC wrote the manuscript, CW, YXH and JHN acquired the data and revised the manuscript. YSM and LY constructed the figures and revised the manuscript. LY, XC, and CY finalized the paper. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript.
The experiment was approved by the Laboratory Animal Ethics Committee of Guangzhou University of Chinese Medicine (approval ID: 20200721005) and performed in accordance with guiding principles of the United States National Institutes of Health for the care and use of laboratory animals.
Not applicable.
This work was funded by National Natural Science Foundation of China (No. 81704131 and No. 81904168), Key laboratory project of colleges and universities in Guangdong province (No. 2019KSYS005), Guangdong province science and technology plan international cooperation project (No. 2020A0505100052).
The authors declare no conflict of interest.
References
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.







