1 Cerebrovascular Disease Center, Nanjing Brain Hospital Affiliated to Nanjing Medical University, 210029 Nanjing, Jiangsu, China
2 Neonatal Medical Center, Children’s Hospital of Nanjing Medical University, 210008 Nanjing, Jiangsu, China
3 Department of Clinical Laboratory, Children’s Hospital of Nanjing Medical University, 210008 Nanjing, Jiangsu, China
†These authors contributed equally.
Abstract
Introduction: Parkinson’s disease (PD), which is a neurodegenerative disease, requires urgently needed biomarkers to explore its mechanism. We screened for differences in the expression of microRNAs (miRNAs) and identified miR-1976 as a possible biomarker. Methods: Twenty-three patients and 30 controls were included in this study. Dopaminergic neurons from C57/BL mice were cultured. The miRNA expression profiles were analyzed using an miRNA microarray. MiR-1976 was identified as an miRNA that was differentially expressed between PD patients and age-matched controls. Lentiviral vectors were constructed, then apoptosis in dopaminergic neurons was analyzed using MTS (multicellular tumor spheroids) and flow cytometry. Transfection of miR-1976 mimics into MES23.5 cells was performed, and target genes and biological effects were analyzed. Results: Overexpression of miR-1976 increased apoptosis and mitochondrial damage in dopaminergic neurons. PINK1 (PINK1-induced kinase 1) was the most common target protein of miR-1976, and silencing of PINK1 caused mitochondrial damage and increased apoptosis of MES23.5 cells. Conclusions: MiR-1976 is a newly discovered miRNA that exhibits a high degree of differential expression with respect to the apoptosis of dopaminergic neurons. Given these results, increased expression of miR-1976 may increase the risk of PD by targeting PINK1 and may therefore be a useful biomarker for PD.
Keywords
- Parkinson's disease
- miR-1976
- PINK1
- biomarker
- target protein
- dopaminergic neuron
- apoptosis
Parkinson’s disease (PD) is a multifarious neurodegenerative disease that
affects the neurons in the substantia nigra pars compacta. The incidence of PD in
those aged 65 years is 1.7%, but this prevalence increases to 4%–5% for those
aged
It is widely speculated that complex interactions between genetic and
environmental factors may play a part in triggering the neurodegenerative changes
that lead to the symptoms of PD [3, 4, 5, 6]. Most dopaminergic neurons are
located on the dense part of the substantia nigra and are extremely vulnerable to
oxidative stress, a commonly reported risk factor for PD [7]. By studying the
biological regulatory mechanisms of the dopaminergic neurons, it may prove
possible to gain important insights into the pathogenesis of PD. For example,
some research has shown that excessive apoptosis of dopaminergic neurons that
lead to the changes underpinning PD was associated with specific dysfunction of
the neurons themselves [8, 9]. To evaluate the key factors that regulate the
apoptosis of dopaminergic neurons, we utilized dopaminergic neurons as
experimental cells in the hope of better understanding how PD develops. In many
instances, neuronal cell death is modulated by changes in gene expression. The
myocyte enhancer factor, encoded by the myocyte enhancer factor-2 gene, is
expressed in neurons and plays a key role in the nitrosative stress-induced
dysfunction in the isogenic human induced pluripotent stem cell Parkinson’s model
[10]. Both glycogen synthase kinase-3
MicroRNAs (miRNAs) are small RNA molecules that perform non-coding functions in both plants and animals. According to previous studies, dysregulation of miRNAs and their associated biological processes is a possible cause of common pathophysiological conditions such as PD [12, 13]. Some miRNAs have been identified to be dysregulated in PD in three areas: brain/neuronal models, cerebrospinal fluid, and blood [14]. Among these miRNAs, some play potential roles in interactions with PD risk genes, mitochondrial function, and immune pathways. To date, research has identified several different functions of miRNAs in humans, but the potential function of miRNAs on dopaminergic neurons is still unknown. It was observed in our previous pilot study [15] that miR-1976 showed high differential expression concerning apoptosis of dopaminergic neuronal cells; therefore, it may be involved in the development of PD and has potential as a new biomarker.
MiR-1976 is an miRNA molecule that is 20 nucleotides in length and is located on chromosome 1p36.11. A high-through sequence study has demonstrated that compared with healthy lung tissue, this miRNA was downregulated in non-small cell lung cancer tissue [16]. Similarly, low expression of miR-1976 has been implicated in the biological function of breast cancer [17]. Although several studies have reported an association between miR-1976 and certain cancer types, it remains unclear whether this miRNA plays a role in the development of PD.
In our study, we profiled differentially expressed miRNAs in PD patients and non-PD control subjects. To ascertain the biological functions and the predicted target genes of miR-1976, we cultured and analyzed dopaminergic neurons (MES23.5) in this study.
Twenty-three PD patients (male: 12; female: 11) with a mean age of 63.5
| Control (n = 30) | PD (n = 23) | p value | |
|---|---|---|---|
| Age (y) | 65.5 |
63.5 |
0.078 |
| Gender (Male%) | 50% | 52% | |
| Height (cm) | 166.4 |
166.1 |
0.722 |
| Weight (kg) | 67.6 |
63.4 |
0.091 |
| BMI (kg/m |
24.4 |
23.0 |
0.073 |
Data are mean
The PD participants were predominantly in the early stages of the disease (Hoehn
& Yahr score 1.4
| UPDRS I | 2.8 (2.2) |
|---|---|
| UPDRS II | 11.5 (7.4) |
| UPDRS III | 26.6 (10.8) |
| UPDRS Total | 40.9 (17.9) |
Abbreviations: UPDRS, Unified Parkinson’s Disease Rating Scale. Data are mean (SD).
Eight-week-old C57/BL mice were provided by Nanjing Medical University (Nanjing,
Jiangsu, China). Forty C57/BL mice (20 males and 20 females) were acclimatized
and kept at a temperature of 22
The dopaminergic neuronal cell line (MES23.5) used in this study was cultured in
Gibco Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 15% fetal bovine
serum at 37 °C and 5% CO
To facilitate analysis, HSA-miR-1976 mimics (and negative controls), PINK1
shRNA, and PINK1 inhibitors were purchased from Shengbo Biotechnology Co., Ltd
(Shanghai, China). Once the MES23.5 cells that were cultured in DMEM had reached
approximately 50% confluence, cells (1
Blood samples (3 mL) were drawn from each subject and were centrifuged at 3500 rpm for 5 min. Plasma samples were then stored at –80 °C before analysis.
Total RNA was isolated using the TRIzol protocol. In brief, TRIzol (15596,
Ambion, Carlsbad, CA, USA) was added to the plasma samples. Following a 10 min incubation
at ambient temperature, 200
Total RNA (100
Microarray data was normalized using the R package fRMA from Bioconductor and
analyzed with the R limma package. Unless otherwise indicated, data were
considered significant with a p-value lower than 0.05 and absolute fold
change higher than 1. First, the solution used for microarray hybridization was
prepared by combining 2.4
Total RNA was extracted using the procedures described above for microarray
hybridization. Both primers for each miRNA (miR-1976, miR-153, miR-103a, miR-29a,
miR-210, miR-375, miR-146a, and miR-101a) and the internal reference U6 reverse
transcription primers were provided by Ribobio (Guangzhou, Guangdong, China). For
real-time PCR, the cDNA from individual samples of total RNA was synthesized
using the FastQuant RT kit (KR106, TIANGEN, Beijing, China). The real-time PCR
was performed in a 20
The 3’UTR fragment of PINK1, which contains binding sites for miR-1976 (WT) and
a 3’UTR fragment with a corresponding mutation (MUT), were designed based on the
results of information prediction. The primers used in this assay were miR-1976-F
(CTC CTG CCC TCC TTG CTG T) and U6-F (CCT AGC ACC ATG AAG ATC AAG AT). They were
then plated into a 24-well plate and co-transfected with 40 nM of either an
miR-1976 mimic or a negative control and 100 ng of either the PINK 3’UTR WT or
MUT reporter using the Lipofectamine
The MES23.5 cells were first cultured and then digested using pancreatin. After washing with phosphate-buffered saline, cells were centrifuged for 10 min at 800–1000 rpm, after which the supernatant was discarded, and the remaining precipitate was resuspended at 1500 rpm for 10 min. The compacted cell mass was then fixed with 2.5% glutaraldehyde and 1% osmic acid. After embedding with Epon 812, cells were stained and observed using a transmission electron microscope (JEM-1010, JEOL, Tokyo, Japan).
The MES23.5 cells were seeded into 64-well plates, pretreated with pancreatic
enzymes in their logarithmic phase and washed twice with phosphate-buffered
saline. Each pellet was resuspended in 250
Focusing on miR-1976, we predicted its putative mRNA targets using TargetScan (https://www.targetscan.org) and microrna.org, respectively. First, we searched the target genes from these two databases (Target gene dataset A), then the common target genes were collected and intersected with Target gene dataset B (different expression genes that were negatively related with miR-1976 and detected based on the miRNA microarray).
GO (http://geneontology.org) and pathway analysis (https://www.kegg.jp) were performed to detect the coordinated changes in functionally related genes. GO analysis was carried out by using the database, while the pathway analysis of obtained predicted target genes was conducted using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.
The statistical analyses were conducted using SPSS 20.0 software (20, SPSS,
Chicago, IL, USA). The differences in miR-1976 expression among different groups were
analyzed using the Student’s t test when only two groups were compared,
or assessed by one-way analysis of variance (ANOVA) when there were more than two
groups. The nonparametric Mann-Whitney U test was performed to compare the miRNA
expression between patients and normal controls, and the Kruskal-Wallis test was
used when there were more than two groups. The Mann-Whitney U test and the
Kruskal-Wallis test were used to evaluate the correlations between the results of
the miRNA expression and other parameters. A two-tailed p-value of
To assess differences in the expression of miRNAs between the healthy volunteers
and the PD cohort, total RNA from plasma was collected from the 13 participants
with PD and the 11 age-matched controls to facilitate miRNA microarray expression
profiling. Based on the bioinformatics evaluation, 18 miRNAs that were
differentially regulated between the two study cohorts (p
Fig. 1.Differences in the expression of miRNAs between the 13 PD
patients and the 11 controls. (a) The miRNA microarrays of PD patients.
(b) Expression of miRNAs in PD patients and control individuals. (c) Expression
level of miR-1976 in PD patients and control individuals. NC, Normal control. ***, p
To examine whether these miRNAs were related to PD progression, plasma RNA was
collected again from the same cohorts, PD patients and the healthy controls, and
the expression of these miRNAs were detected using real-time PCR. The results
confirmed that the expression of miR-1976, miR-153, miR-103a, and miR-29q was
significantly upregulated in PD patients, while the expression of miR-210,
miR-375, miR-146a, and miR-101a was significantly downregulated in PD patients
compared with controls. Of these miRNAs, the greatest difference was observed in
the expression of miR-1976, with the PD cohort having a 5.64
The expression level of miR-1976 was determined in PD patients and normal controls using real-time PCR. Results showed that miR-1976 was significantly upregulated in the serum of PD participants compared with that of matched non-PD controls (Fig. 1c). We then examined the sequence conservation of miR-1976 among different species via miRBase searching. Alignment results showed that the sequence “CCUCCUGCCCUCCUUGCUGU” had high conservation among many species, including humans, Macaca mulatta, horses, house mice, zebrafish, Rattus norvegicus, tropical clawed frogs, Pongo pygmaeus, and ornithorhynchus anatinus (Table 3).
| Species | miRNA | Conserved sequence |
|---|---|---|
| Human | has-miR-1976 | 33-CCUCCUGCCCUCCUUGCUGU-52 |
| Macaca mulatta | mml-miR-1976 | 33-CCUCCUGCCCUCCUUGCUGU-52 |
| Horse | eca-miR-1976 | 31-CCUCCUGCCCUCCUUGCUGU-50 |
| House mouse | mmu-miR-1976 | 37-CCUCCUGCCCUCCUUGCUGU-55 |
| Zebrafish | dre-miR-1976 | 53-CCUCCUGCCCUCCUUGCUGU-72 |
| Rattus norvegicus | rno-miR-1976 | 33-CCUCCUGCCCUCCUUGCUGU-51 |
| Tropical clawed frog | xtr-miR-1976 | 34-CCUCCUGCCCUCCUUGCUGU-56 |
| Pongo pygmaeus | ppy-miR-1976 | 35-CCUCCUGCCCUCCUUGCUGU-56 |
| Ornithorhynchus anatinus | oan-miR-1976 | 38-CCUCCUGCCCUCCUUGCUGU-57 |
To evaluate the overexpression of miR-1976 on apoptosis of MES23.5 cells, the miR-1976 mimics or mock control mimics were transfected using liposomes into MES23.5 cells. Real-time PCR confirmed the high overexpression at 12 h, 24 h, and 36 h post-transfection (Fig. 2a). The effects of miR-1976 overexpression on cell apoptosis were subsequently further evaluated. The FITC staining results showed more apoptotic bodies observed under the electron microscope when cells were transfected with miR-1976 mimics (Fig. 2b). Similarly, the overexpression of miR-1976 showed a strong cell apoptotic rate as reflected using a flow cytometry chart (Fig. 2c,d).
Fig. 2.Overexpression of miR-1976 increased apoptosis of
dopaminergic neurons. (a) Overexpression of miR-1976 was verified using real-time
PCR. (b) Apoptotic bodies stained with FITC observed under the electron
microscope. (c,d) Cell apoptosis rate reflected using a flow cytometry chart. (e)
MiR-1976 induced greater cell apoptotic bodies in C57/BL mice. (f) MiR-1976
induced more cell apoptosis shown via the TUNEL assay. NC, normal control. TUNEL,
terminal deoxynucleotidyl transferase dUTP nick end labeling. ***, p
For the in-vivo study, the effects of overexpression of miR-1976 on the dopaminergic neuronal cells of mice were assessed by constructing an overexpressing miR-1976 mouse model that involved injecting miR-1976 mimics via a lentiviral vector into the substantia nigra of C57/BL mice. As a result, miR-1976 induced more cell apoptotic bodies with relatively integrated cell cytomembranes and organelles (Fig. 3e). These results were supported by the TUNEL assay, which showed cell apoptosis in the group treated with the miR-1976 mimics (Fig. 3f). Collectively, these data suggest that the miR-1976-induced nerve cell apoptosis might be crucial in the development of PD.
Fig. 3.The prediction and analysis of miR-1976 target genes.
(a) The effect of miR-1976 on the PINK or MAPK signaling pathways. (b) The target
sequence of miR-1976 in PINK1 was detected using TargetScan. (c) Dual-luciferase
assay demonstrated that the PINK1 expression was regulated by miR-1976. NC,
normal control. ***, p
Using the GO and pathway programs, as well as the microarray that we had
performed in our preliminary study, we identified that phosphatidylinositol
3-kinase (PI3K) was a predicted target of miR-1976. Furthermore, bioinformatics
analysis identified two pathways (PINK1 and MAPK-mitogen-activated protein
kinase) that were significantly correlated with miR-1976 (p
To detect the effects of miR-1976 on the PINK or MAPK signaling pathways, the
mRNAs of the proteins PINK1, MAPK4, 6, 16, and BP1 (binding protein1) were
evaluated via real-time PCR in miR-1976 mimic treated MES23.5 cells or empty
vector treated cells (NC). Results showed that the high expression of miR-1976
significantly inhibited the expression of PINK1 (p
We subsequently explored whether the target sequence of miR-1976 was in PINK1. We found that PINK1 harbors one conserved miR-1976 cognate site named 89-91 of PINK1 3’-UTR (Fig. 3b), which is a predicted target of miR-1976. To identify whether PINK1 expression was indeed regulated by miR-1976, the PINK1 3’-UTR was cloned into a luciferase reporter plasmid (Fig. 3c) that was used to quantify the ability of miR-1976 to inhibit expression of the PINK1 coding region. The luciferase assay showed that miR-1976 suppressed luciferase activity when the reporter plasmid carried the wild type PINK1 3’-UTR. However, no significant suppression was observed when the reporter plasmid carried a mutant PINK1 3’-UTR. These results demonstrated that miR-1976 directly binds to the predicted binding site in the PINK1 3’-UTR.
To detect the effect of PINK1 on dopamine neuronal cells, we constructed the PINK1 shRNA lentivirus vector to infect MES23.5 cells. We first observed cell apoptosis using flow cytometry at 0-, 12-, 24-, and 36-h time points after transfection. As shown in Fig. 4a, low expression of PINK1 induced more cell apoptosis in a time-dependent fashion, indicating that the inhibition of PINK1 regulated cell apoptosis. This result was supported by the observed changes in mitochondrial morphology, which showed that the number of mitochondria was reduced with increased time. Furthermore, relative to the 0-h time point, a greater number of physalides and fewer mitochondrial cristae were found at the 36-h mark (Fig. 4b).
Fig. 4.Silencing of PINK1 expression increases the apoptosis of MES23.5
cells and affects the morphology of mitochondria. (a) Cell apoptosis was observed
via flow cytometry at 0-, 12-, 24-, and 36-h time points after transfection. (b)
Electron microscopy showed more physalides and fewer mitochondrial cristae. NC,
Normal control. ***, p
In the present research, we first identified several differences with respect to the expression of miRNAs in people with PD. High expression of miR-1976 was found in these individuals and was prominent in dopamine neurons (MES23.5 cells). To assess the functional results of miR-1976 upregulation in-vitro and in-vivo, we examined cell apoptosis in both the dopamine neuronal cells and the neurons in the substantia nigra of mice. We found that the introduction of the miR-1976 molecule into the substantia nigra neurons of mice induced neuronal apoptosis both in vitro and in vivo. This suggests that miR-1976 can trigger neuronal apoptosis, leading to the underlying mechanism of PD. Via bioinformatics analysis, we identified PINK1 as the target gene of miR-1976, and these results were confirmed via dual-luciferase assay. Furthermore, lower expression of PINK1 turned out to contribute to higher neuronal apoptosis. Thus, the target gene, PINK1, was shown to be involved in the apoptosis of dopaminergic neurons. Collectively, these results indicated that miR-1976 might play a crucial role in the development of PD by targeting the PINK signaling pathway.
It has been noted that miRNAs were stable in plasma and serum samples and can be useful for detecting disease conditions [18, 19]. In the circulatory system, miRNAs exist in the form of high-density lipoproteins (HDLs) and are mainly derived from the budding exocytosis or active secretion of various cells [20]. Conversely, the plasma miRNA can re-enter the cell and function as specific protein binders and in endocytosis [21, 22]. Therefore, miR-1976 present in the blood can reflect its expression levels in brain tissue. In this study, we found that the plasma miR-1976 level was higher in people with PD compared to controls, indicating that miR-1976 might be associated with PD progression. Based on this hypothesis, we subsequently identified the target gene of miR-1976 and investigated the biological function of miR-1976 in dopaminergic cells via transfection involving miR-1976 mimics. Results showed that miR-1976 induced dopaminergic neuronal apoptosis. Bioinformatics were used to screen for possible targets of miR-1976 using KEGG analysis, and PINK, MAPK, transmembrane protein, and PI3-K/AKT signaling pathways were identified as potentially being associated with miR-1976. Among these pathways, PINK proved to be the most plausible protein that was targeted by miR-1976. Therefore, it was hypothesized that the risk of developing PD might be because of the higher levels of miR-1976 in PD serum targeting PINK1. Results from the dual-luciferase assay provided support for this hypothesis.
Subsequently, in this study we addressed why the downregulation of PINK1 significantly reduced the proliferation of dopaminergic neurons. Previous research has shown that knockout/knockdown of PINK1 was associated with the increased susceptibility of several types of cancer cells to apoptosis by decreasing mitochondrial respiration, ATP generation, and mitochondria membrane potential, or by increasing reactive oxygen species [23, 24]. Therefore, while PINK1 has been observed to be related to the cancer process, it has also been linked with the presence of PD. The PINK1 protein synthesis process is well known. It is first transcribed in the nucleus and then translated in the cytoplasm before being transported into the mitochondria. It promotes mitochondrial health and protects the cell against mitochondrial-mediated apoptosis caused by cell death [25]. For instance, a previous study has shown that silencing of the PINK1 gene resulted in inactivity of the myocyte enhancer factor-2 protein, which induced tumor cell apoptosis [26]. Furthermore, in a PD mouse model, mutation of the PINK1 gene resulted in mitochondrial dysfunction and neuronal apoptosis, which ultimately resulted in the development of PD [27]. To determine the effect of PINK1 on cell death, we silenced the PINK1 gene by using a shRNA lentiviral vector. We demonstrated that silencing the PINK1 gene induced apoptosis and mitochondrial damage in the dopaminergic neurons, which was similar to what was found in the PD mouse model.
In the dopaminergic neurons, PINK1 downregulation reduced mitochondrial defects and dysfunction, as demonstrated by the reduced mitochondrial mass, increased physalides, and fewer mitochondrial cristae. Dysfunction of the mitochondria could affect the signaling pathways that mediate apoptosis of dopaminergic neurons. Therefore, we hypothesized that the upregulation of miR-1976 might be associated with apoptosis in dopaminergic neurons and the development of PD by targeting PINK1. It is interesting to note that up to now, more than 100 homozygous mutations in the PINK1 gene have been reported to be associated with PD [28].
In conclusion, we screened for differences in the expression of miRNAs between people with PD and healthy age- and gender-matched controls, and via our miRNA expression profiling study, we identified miR-1976 as a possible biomarker of PD. To further investigate the relationship between miR-1976 and PD, we performed a bioinformatics analysis and showed that PINK1 may be a target of miR-1976 and hence, may play a key role in PD progression.
Our study had several limitations. One major problem involves the delivery of candidate miRNA-1976 to specific sites in the brain by getting it across the blood–brain barrier, which will be required if miRNA-1976 is to be used as a therapeutic. Stabilizing and extending the life of delivered miRNAs could be difficult to accomplish because miRNAs are degraded easily. Furthermore, utilizing miRNAs as a treatment may be a double-edged sword. While it is advantageous that miRNAs as powerful modulators of gene expression have the ability to alter several signaling pathways at once to switch the cellular physiology from an apoptotic state to one that favors survival, it also means that side effects in unspecific sites could be problematic. Hence, specific and effective delivery systems for miRNA-based therapy are vital. These challenges could slow down the progress of miRNA research. Furthermore, given the small population, it is recommended that this work be replicated on a larger sample size to further develop our understanding of the possible pathways involved in PD progression. Nonetheless, we believe that the present study provides data that may be useful for furthering our understanding of the mechanism of PD.
The data that support the findings of this study are available on request from the corresponding author. The data are not publicly available due to privacy or ethical restrictions.
FQ—Conceptualization; FQ, YW—Data curation; FQ, YW—Formal analysis; FQ, YW, GX—Investigation; FQ, YW, GX—Methodology; FQ—Supervision; FQ, YW, GX, HC, MD, HJ—Writing and original draft; FQ, YW, GX, HC, MD, HJ—Writing, review and editing.
All experimental procedures were approved by the Human Research Ethics Committee of Nanjing Brain Hospital (Ethics Reference No: 2017-KY010). All experimental procedures complied with the guidelines for human studies and were conducted ethically in accordance with the World Medical Association Declaration of Helsinki. All subjects (or their parents or guardians) have given their written informed consent.
All animals were kept in a pathogen-free environment and fed ad lib. The procedures for care and use of animals were approved by the Ethics Committee of the Nanjing Brain Hospital and all applicable institutional and governmental regulations concerning the ethical use of animals were followed (Ethics Reference No: 2017-KY010).
Thanks to all the peer reviewers for their opinions and suggestions.
This research was supported by: Nanjing Medical Science and technique Development Foundation (No. QRX17086).
The authors declare no conflict of interest.
References
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.




