GB (HPLC purity $>$98%) was purchased from Chengdu Pufei De Biotech Co., Ltd. Its molecular weight is 424.3986 g/mol and molecular formula is C${}_{20}$H${}_{24}$O${}_{10}$ (Fig. 1c). It was dissolved in dimethyl sulfoxide (DMSO, Sigma, St. Louis, MO, USA) and prepared in a stock solution of 5 mmol/L with culture medium. The stock solution was diluted to required concentrations with the same culture before use. DMSO concentration was kept below 0.1% to prevent cytotoxic reaction [17].

Fig. 1.

Effect of Ginkgolide B (GB) on A$\beta$${}_{\mathrm{1}\mathrm{-}\mathrm{42}}$-induced cytotoxicity in N2a neuroblastoma cells. (a) The TEM images of A$\beta$${}_{1-42}$ oligomers via negative staining. (b) N2a cells were treated with 0, 2.5, 5, 10 and 20 $\mu$M A$\beta$${}_{1-42}$ oligomers for 24 h, and the cell survival rates were then measured by MTT assay (n = 5). (c) The chemical structure of GB. (d) Cells were treated with GB at various concentrations (0, 20, 40, 100 and 200 $\mu$M) for 24 h, and the cell viability was measured by MTT assay (n = 5). (e) Cells were pretreated with various concentrations of GB (0, 20, 40, 100 and 200 $\mu$M) for 2 h, followed by incubation with 10 $\mu$M A$\beta$${}_{1-42}$ oligomers for another 24 h. Cell survival rates were measured by MTT assay (n = 5). (f) Bax and Bcl-2 mRNA levels determined by quantitative PCR (qPCR) (n = 3). (g) The number of apoptotic cells in the existence of A$\beta$${}_{1-42}$ oligomers and GB analyzed by flow cytometry. Quantified apoptotic cells in all groups (n = 3). Data were presented as mean $\pm$ SEM. **p 0.01 and ***p 0.001 vs. control group; ##p 0.01 and ###p 0.001 vs. A$\beta$ group.

The preparation of A$\beta$${}_{1-42}$ oligomers was based on a widely recognized method [18, 19]. 1 mg lyophilized A$\beta$${}_{1-42}$ peptide (AS-20276; AnaSpec, shanghai, China) was dissolved in 221 $\mu$L of 100% hexafluoroisopropanol at a concentration of 1 mM and evenly divided into two tubes. Then, the peptide film was dried under vacuum. Approximately 0.5 mg dried peptide film was redissolved in 20 $\mu$L of fresh dry DMSO to a concentration of 5 mM and diluted with F12 cell culture medium to 100 $\mu$M [17]. The solution was incubated at 4 °C for 24 h and centrifugated at 14,000 $\times$g at 4 °C for 10 min for elimination of fibrils. The supernatant that consists of soluble oligomerized A$\beta$${}_{1-42}$ was used for experiments.

Oligomerized A$\beta$${}_{1-42}$ was identified by means of TEM. Briefly, 10 $\mu$L of A$\beta$${}_{1-42}$ oligomers was added to copper mesh grids with formvar coating and carbon stabilizing for 1 min. A$\beta$${}_{1-42}$ oligomers were stained with 5 $\mu$L of 1% uranyl acetate for 30 s using negative staining technique [17]. The completely dried grids were observed using a 200 kV electron microscope (Tecnai G2 20 Twin, FEI, Czech Republic).

The mouse neuroblastoma N2a cells were donated by Ji Jianguo Lab (the State Key laboratory of Protein and Plant Gene Research, College of Life Sciences, Peking University) and cultured in Dulbecco’s Modified Eagle Medium (DMEM, Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (Hyclone, Logan, UT, USA). N2a cells were maintained in a humidified atmosphere containing 5% CO${}_2$ at 37 °C. The cells were pretreated with GB or vehicle for 2 h, followed by incubation in the presence or absence of 10 $\mu$M A$\beta$${}_{1-42}$ oligomers for an additional 24 h. The experiments involve the control group (treated with 0.1% DMSO for 24 h), the A$\beta$ group (treated with 10 $\mu$M A$\beta$${}_{1-42}$ for 24 h) and the A$\beta$ + GB group (pretreated with 100 $\mu$M GB for 2 h followed by 10 $\mu$M A$\beta$${}_{1-42}$ for 24 h).

Cell survival rates were tested by a colorimetric 3-4,5-dimethylthiazol-2-yl-2,5-diphenyl-tetrazolium bromide (MTT) assay (Beyotime Biotechnology, Shanghai, China). N2a cells were seeded in 96-well plates and treated according to the experiment designed when the cells reached to 60% confluence. Then the cells were incubated with 10 $\mu$L MTT (5 mg/mL) at 37 °C for 4 h, and the MTT formazan was extracted with 150 $\mu$L DMSO. The absorbance of each well was measured at 570 nm using a Multiskan FC microtiter plate reader (Thermo Fisher Scientific, Waltham, MA, USA).

Apoptotic N2a cells were determined using Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) cell apoptosis detection kit (TransGen Biotech Co, Beinjing, China). After treatments, N2a cells were digested with trypsin, washed, and resuspended in Annexin Ⅴ binding buffer. Then, cells were incubated with 5 $\mu$L of Annexin V-FITC and 5 $\mu$L of PI at room temperature for 15 min in the dark. The number of apoptotic cells were detected using a flow cytometer (FACSVerse, BD Biosciences, Franklin, NJ, USA) and analyzed using FlowJo software (Version 7.6, TreeStar Inc, San Carlos, CA, USA).

Intracellular ROS levels of N2a cells were tested using ROS probe 2’,7’-dichlorofluorescein diacetate (DCFH-DA) (Beyotime Biotechnology, Nanjing, China). After treatment, N2a cells were incubated with 10 $\mu$M DCFH-DA for 30 min and then washed with serum-free cell culture medium. The DCF fluorescence was quantified using a multimode microplate reader with an excitation source at 485 nm and an emission at 530 nm. The values were expressed as the fold of control.

The SOD activity and MDA content were detected using commercially available kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) following the protocols. The SOD activity was tested using the xanthine oxidase method and measured by the absorbance of superoxide anion free radical at 550 nm. The lipid peroxidation level was reflected by MDA concentrations using the thibabituric acid (TBA) method. MDA concentrations were measured by the absorbance of TBA reactive substances at 532 nm.

The proteins of N2a cells were precipitated in pre-chilled (–20 °C) trichloroacetic acid and acetone. The precipitated proteins were then dissolved in 8 M urea buffer, reduced with 100 mM dithiothreitol (Sigma Aldrich, Saint Louis, MO, USA), and alkylated with 200 mM iodoacetamide (Sigma Aldrich, Saint Louis, MO, USA). Protein digestion took place in the existence of Lys-C (1:1000, 37 °C for 3 h) and trypsin (1:50, 37 °C for 8–18 h) [20], and this reaction was terminated with trifluoroacetic acid (TFA). The peptide mixtures were transferred to C18 Extraction Disks (Empore 3M, Agilent Technologies, Sant Clara, CA, USA) and sequentially flushed with anhydrous acetonitrile (ACN), 0.1% TFA/70% ACN, and 0.1% TFA for desalination. Peptides were then vacuum dried and dissolved in 100 mM tetraethylammonium bicarbonate buffer. Each sample (40 $\mu$g peptides) were labeled using six-plex TMT reagents (90061, Thermo Scientific, Waltham, MA, USA) with ACN buffer for 60 min at room temperature [17]. Peptides derived from the control group, A$\beta$ group and A$\beta$ + GB group were labeled with 126 and 127 TMT tags, 128 and 129 TMT tags, 130 and 131 TMT tags, respectively. The labeling reaction was terminated by 8 $\mu$L of 5% hydroxylamine (20 min, room temperature). TMT-labeled peptide mixture was loaded on the C18 extraction disk cartridge and eluted by gradient acetonitrile (10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, and 50%). The fractionated peptides (10% and 50%) were pooled into one fraction, leaving seven fractions in the TMT experiment. These fractions were vacuum dried for subsequent LC-MS/MS measurement.

TMT-labeled peptides were analyzed on an Orbitrap Fusion Lumos Tribrid instrument (Thermo Scientific). Peptides were dissolved in 0.2% formic acid, detached in mobile phase containing 0.1% formic acid and eluted using a nonlinear 194 min acetonitrile gradient of 6%–90% buffer (0.1% formic acid with 80% acetonitrile) at 300 nL/min. The settings of MS parameters were as follows: MS1 resolution at 120,000, mass scan of 300–1500 m/z, automatic gain control (AGC) target at 1 $\times$ 10${}^6$, maximum injection time at 100 ms, and 30% of radio frequency, MS2 mass resolution at 50,000, high-energy collision dissociation for MS/MS, 37% of collision energy, normalized AGC target at 1 $\times$ 10${}^5$, 1.2 m/z isolation width, 30 s dynamic exclusion [17].

Protein identification, quantification, and MS/MS original data were analyzed by SEQUEST search algorithm using Proteome Discoverer (version 2.2, Thermo Scientific, Waltham, MA, USA). Raw files were searched with a mouse Uniprot protein database. Search criteria included maximum missed trypsin cleavages of 2; fixed modification on lysine and N-terminus for TMT six-plex tags; dynamic modification for oxidation of methionine residues; carbamidomethyl on cysteines; mass tolerance of 10 ppm; 0.05 Da for MS/MS tolerance; 1% false discovery rate (FDR) [21, 22]; and 1% FDR at peptide and protein levels [17]. Reporter ion intensities was normalized using the index of total reporter ion intensity.

The protein ratios (A$\beta$ + GB/A$\beta$) were normalized in the transformed Log2 fold change to adjust the unequal protein content. p-value was calculated with an independent student’s t-test (A$\beta$ + GB versus A$\beta$). Proteins with a cut-off of p 0.1 and fold change $>$1.5 from two independent experiments were regarded as DEPs.

The Database for Annotation, Visualization, and Integrated Discovery (DAVID) is an online database that offers systematic and comprehensive functional annotation information of proteins and genes to reveal biological information [23, 24]. KEGG pathway enrichment analysis and GO analysis (biological process, molecular function, and cellular component) of DEPS were carried out using DAVID (version 6.8) to analyze the function of DEPs. p 0.05 was regarded as statistical significance.

N2a cells were lysed in 1% sodium dodecyl sulfate using an ultrasound homogenizer. Protein concentration was quantitatively measured using a Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein (15 $\mu$g) were loaded in to each lane of 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membranes using a semidry blotting apparatus (Bio-Rad, Hercules, CA, USA). The membranes were blocked with 5% nonfat milk and incubated with primary antibodies overnight at 4 ${}^{\circ }$C: anti-FTH1 (1:1000; ab63856, Abcam, Cambridge, UK), anti-SPP1 (1:1000; ab218237, Abcam), anti-A$\beta$${}_{1-42}$ (1:1000; 14974, Cell Signaling, Boston, MA, USA), and anti-$\beta$-actin (1:2000; ab3280, Abcam). After washing, the membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (4050-05 or 1031-05, Southern Biotech, Birmingham, AL, USA) for 1 h at room temperature. Subsequently, the Protein bands were detected using Immobilon Western Chemiluminescent HRP substrate (Millipore, Billerica, MA, USA), and images were scanned using X-ray films. Kodak Digital Science 1D software (Eastman Kodak Company, Rochester, NY, USA) was used to analysis the sum optical density.

Total RNA was extracted from N2a cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the supplier’s recommendations. Total RNA (1.5 $\mu$g) was reversely transcribed to cDNA using a HiFi-Script cDNA Synthesis kit (CW Bio, Beijing, China). Quantitative analysis of FTH1 and SPP1 expressions was performed using CFX96™ Real Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The mRNA levels were calculated using the 2${}^{-\mathrm{\Delta }\mathrm{\Delta }\text{CT}}$ algorithm and normalized to GAPDH. The primers in this article were as follows: SPP1, Forward (5${}^{\prime }$-$>$3${}^{\prime }$): AGCAAGAAACTCTTCCAAGCAA, Reverse (5${}^{\prime }$-3${}^{\prime }$): GTGAGATTCGTCAGATTCATCCG. FTH1, Forward (5${}^{\prime }$-3${}^{\prime }$): TAAAGAAACCAGACCGTGATGACT, Reverse (5${}^{\prime }$-3${}^{\prime }$): TGCAGTTCCAGTAGTGACTGATTC. GAPDH, Forward (5${}^{\prime }$-3${}^{\prime }$): GGTCGGTGTGAACGGATTT, Reverse (5${}^{\prime }$-3${}^{\prime }$): GTGGATGCAGGGATGATGTT.

All data were shown as mean $\pm$ SEM and analyzed by one-way analysis of variance (ANOVA) followed by Student-Newman-Keuls test for intergroup comparisons. All analyses were conducted using SPSS statistical software (Version 17.0, SPSS, Chicago, IL, USA). A p value 0.05 was identified as statistical significance.

The A$\beta$${}_{1-42}$-injured N2a cell model was established in the present study. The characteristic of A$\beta$${}_{1-42}$ oligomers was revealed by TEM (Fig. 1a), and the toxicity of A$\beta$${}_{1-42}$ oligomers was tested by MTT assay. The MTT results showed a dose-dependent association between A$\beta$${}_{1-42}$ concentration and cell injury. 10 $\mu$M A$\beta$${}_{1-42}$ treatment markedly decreased cell survival rate compared with the control group (Fig. 1b). However, 20 $\mu$M A$\beta$${}_{1-42}$ produced no notable changes in cell viability compared with 10 $\mu$M A$\beta$${}_{1-42}$ (Fig. 1b, p $>$ 0.05). Therefore, A$\beta$${}_{1-42}$ oligomers at a concentration of 10 $\mu$M was chosen for A$\beta$-induced cell model. GB, a kind of diterpenoids isolated from the leaves of Ginkgo biloba, provides neuroprotective functions against A$\beta$-induced neurotoxicity in previous studies [14]. To verify whether GB exerts any effect on N2a cells themselves, the viability of various concentrations of GB intervened N2a cells was detected. GB (20–200 $\mu$M) alone caused no obvious effects on cell viability, with the maximal cell viability occurring at 100 $\mu$M (Fig. 1d). GB (20–200 $\mu$M) pretreatment showed certain inhibitory effect on cell injury caused by A$\beta$${}_{1-42}$ oligomers, especially at a concentration of 100 $\mu$M (Fig. 1e). Hence, 100 $\mu$M GB was used for further experiments.

The functions of GB on cell apoptosis stimulated by A$\beta$${}_{1-42}$ oligomers were measured by Annexin V-FITC/PI staining and flow cytometry. Cells incubated with A$\beta$${}_{1-42}$ alone showed the highest apoptosis rate (10.46%), and the apoptosis rate was significantly reduced with 100 $\mu$M GB treatment (5.61%) (Fig. 1g). GB also alleviated A$\beta$${}_{1-42}$-induced elevation of Bax expression and downregulation of Bcl-2 level (Fig. 1f). These results showed that GB relieved cell apoptosis caused by A$\beta$${}_{1-42}$ oligomers.

The levels of oxidative stress in N2a cells in various groups were tested by measuring intracellular levels of ROS, SOD and MDA. Compared with the control group, 10 $\mu$M A$\beta$${}_{1-42}$ gave rise to a prominent reduction of SOD level and a considerable elevation of ROS and MDA levels (Fig. 2a–c). On the contrary, 100 $\mu$M GB pretreatment significantly relieved A$\beta$${}_{1-42}$-induced oxidative injury with increased SOD level and decreased ROS and MDA levels (Fig. 2a–c). Then, we examined whether GB affects A$\beta$${}_{1-42}$ peptide expression. Western blot revealed that A$\beta$${}_{1-42}$ peptide level significantly increased with A$\beta$${}_{1-42}$ intervention, and the uptrend was reversed by 100 $\mu$M GB pretreatment (Fig. 2d).

Fig. 2.

Effect of Ginkgolide B (GB) on A$\beta$${}_{\mathrm{1}\mathrm{-}\mathrm{42}}$-induced oxidative stress in N2a cells. The relative ROS level (a), SOD activity (b) and MDA content (c) from all experimental groups were measured using commercial kits (n = 5). (d,e) Representative images of A$\beta$${}_{1-42}$ peptide levels and relative level normalized to $\beta$-actin (n = 3). Data were presented as mean $\pm$ SEM. **p 0.01 and ***p 0.001 vs. control group; #p 0.05 and ###p 0.001 vs. A$\beta$ group.

To explore the neuroprotective mechanisms of GB against cell injury stimulated by A$\beta$${}_{1-42}$ oligomers, TMT-labeled LC-MS/MS analysis was executed to find out the relative changes in protein abundance. The workflow is exhibited in Fig. 3a. Cells from the control group, A$\beta$ group and A$\beta$ + GB group were labeled with 126 and 127 TMT tags, 128 and 129 TMT tags, and 130 and 131 TMT tags, respectively. In the end, 6969 proteins were identified and 6740 proteins (96.71%) were quantified in two independent biological replicates. The relative abundance ratios (A$\beta$ + GB/A$\beta$) distribution of the quantified proteins was normality (Fig. 3b). Only proteins with fold change $>$1.5 and p value 0.1 were identified to be differentially expressed. 61 proteins were considered as DEPs, including 42 upregulated and 19 downregulated proteins. In the volcano figure, red dots indicate upregulated proteins and blue dots indicate downregulated proteins (Fig. 3c). The DEPs were showed in Table 1.

Fig. 3.

Global proteome profiling of N2a cells with GB pretreatment. (a) Experimental workflow for proteomic analysis of N2a cells. (b) The relative abundance ratios distribution of quantified 6740 proteins in GB treated N2a cells by proteomics. Proteins ratios (A$\beta$ + GB/A$\beta$) were presented on the log2 scale. (c) Volcano plot of quantified proteins was represented as the fold change (log2) and the p value (–log10). The criterion for determining DEPs is fold change $>$1.5 and p value 0.1. Red dots are upregulated proteins, and blue plots are downregulated proteins.

To identify obviously different proteins in GB treated N2a cells, hierarchical clustering analysis was performed. The heatmap of 61 DEPs revealed that DEPs were distinctly separated into three distinct areas (Fig. 4). The expression levels of DEPs in the A$\beta$ group were apparently different from those in the control group, while GB pretreatment attenuated these differences. These results indicated that protein expression undergoes extensive remodeling during AD pathogenesis and this trend can be partially reversed by GB.

Fig. 4.

Hierarchical clustering analysis of the DEPs in N2a cells with GB pretreatment. The map reflects the relative abundance ratios (A$\beta$ + GB/A$\beta$). Red squares indicate high expression proteins, and blue squares indicate low expression proteins.

To explore the biological classification of the DEPs, we annotated the DEPs into some functional categories using DAVID. These proteins were categorized in accordance with GO biological process (GOBP), GO molecular function (GOMF), GO cellular component (GOCC) and KEGG enrichment analysis by DAVID [25]. GOBP analysis showed that DEPs predominantly participate in response to external stimulation (GO:0032101, p = 7.52E-07), immune system process (GO:0002684, p = 2.82E-05), cell activation (GO:0001775, p = 0.0004), and negative regulation of cell death (GO:0060548, p = 0.011) (Fig. 5a). GOMF analysis showed that the DEPs were principally associated with signaling receptor binding (GO:0005102, p = 2.02E-05), transition metal ion binding (GO:0046914, p = 0.003), and peptidase regulator activity (GO:0061134, p = 4.53E-09) (Fig. 5b). In the GOCC analysis, we discovered that most DEPs were localized in the extracellular region (GO:0005576, p = 6.99E-18) and extracellular matrix (GO:0031012, p = 1.59E-07), followed by cell surface (GO:0009986, p = 0.0002) and cell body (GO:0044297, p = 0.015) (Fig. 5c). KEGG pathway analysis indicated that the biological pathways were involved in complement and coagulation cascades (mmu04610, p = 4.05E-08), ferroptosis (mmu04216, p = 0.00027), cytokine-cytokine receptor interaction (mmu04060, p = 0.0006), and PPAR signaling pathway (mmu03320, p = 0.0058) (Fig. 5d).

Fig. 5.

GO and KEGG enrichment analyses of DEPs. GO enrichment analysis of DEPs in three categories: biological process (a), molecular function (b), and cellular component (c). (d) KEGG pathway enrichment analysis of DEPs. The percentages indicate the enriched proteins among all DEPs. p value indicates significantly enriched terms.

To confirm the MS-based quantitative proteomics, we analyzed the expression levels of two key proteins SPP1 and FTH1 in A$\beta$${}_{1-42}$-induced and GB treated N2a cells using western blot and qPCR. FTH1 protein and mRNA levels in the A$\beta$ group decreased markedly, and 100 $\mu$M GB treatment upregulated their expressions (Fig. 6b,c). SPP1 protein and mRNA levels in the A$\beta$ group significantly increased, and these upregulations were potently suppressed by 100 $\mu$M GB pretreatment (Fig. 6a,c). The change tendency of FTH1 and SPP1 expression levels detected by western blot and qPCR is consistent with mass spectrometric data.

Fig. 6.

Validation of SPP1 and FTH1 expression levels in N2a cells. (a) Representative images of SPP1 protein levels and relative level normalized to $\beta$-actin (n = 3). (b) Representative images of FTH1 protein levels and relative level normalized to $\beta$-actin (n = 3). (c) Relative mRNA levels of SPP1 and FTH1 determined by qPCR (n = 3). Data was expressed as mean $\pm$ SEM. *p 0.05 and ** p 0.01 vs. control group; # p 0.05 and ## p 0.01 vs. A$\beta$ group.