CRS cell lines HK-2 was obtained from Hanpu Nuosai Life Science and Technology Co., Ltd. (CL-0109, Wuhan, Hubei, China). The cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, 11965118, Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FSD500, Excell Bio, Shanghai, China) and 1% cyanine/streptomycin (C0222, Beyotime, Shanghai, China) at 37 °C with 5% CO₂.

An in vitro cell damage model was established by treating HK-2 cells with 1 µg/mL LPS (MFCD00131520, Merck, Kenilworth, NJ, USA) for 48 hours [18]. Subsequently, the calcium ion channel activator Yoda1 (0.2 µM, HY-18723, Medchem Express, Elizabeth, NJ, USA) was used to activate the calcium ion channels in the cells for an additional 24 hours [19]. All cell lines were validated by short tandem repeat (STR) profiling and tested negative for mycoplasma.

The small interfering RNAs (siRNAs) targeting TRPM2 and the nonsense control (si-NC) were obtained via chemical synthesis (Gemma Genetics, Suzhou, China). Subsequently, transfections were carried out with Lipofectamine 3000 reagent (L3000015, ThermoFisher, Boston, MA, USA) in HK-2 cells following the manufacturer’s instructions. Stable cell lines were generated through with puromycin (10 µg/mL, HY-B1743A, MedChem Express, NJ, USA) selection for 7–14 days. The specific sequences of si-TRPM2: 5^′-GGACAAGCTCTGTCTGCAAA -3^′; si-NC: 5^′- GTTCTCCGAACGTGTCACGT -3^′.

All animal experiments were carried out with approval by the Institutional Laboratory Animals Care and Use Committee of Liaoning University of Traditional Chinese Medicine (Approval No. 21000042024002). SPF-grade SD rats (male, 6–7 weeks old, weighing 220–250 g) were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd (China). Before the experiment, all animals were acclimated for one week.

The rats were randomly divided into Sham group (n = 6) and CRS group (n = 24). Rat model of cardiorenal syndrome (CRS) group: according to the previous method, the rat model of CRS was established by ligating the left anterior descending coronary artery and inducing acute renal ischemia-reperfusion [20]. In simple terms, after ligation with 2% isoflurane, the left anterior descending coronary artery was permanently ligated to induce myocardial infarction. Two weeks after myocardial infarction, the left kidney was removed and subtotal nephrectomy was performed. The rats underwent right subcapsular nephrectomy and about 2/3 renal infarction (because 2/3 of the right renal artery was ligated). The heart-kidney rat model was successfully established 4 weeks after myocardial infarction.

Then, CRS rats were randomly divided into CRS+KD-TRPM2, CRS+Yoda1, and CRS+KD-NC groups, with 6 rats in each group. CRS+KD-TRPM2 group: After the CRS model was constructed by the same operation method as the CRS group, AAV2/2-U6-sh-TRPM2 (TRPM2 knockdown lentiviral expression vector) recombinant vector was injected into the tail vein on the 7th, 14th, 21th and 28th days. CRS+Yoda1 group: After surgery, Yoda1 was alternately injected into the left and right arms at 5 mg/kg/d for 10 days. CRS+KD-NC group: AAV2/2-U6-sh-NC (empty vectors) recombinant vector was injected into the tail vein on the 7th, 14th, 21st and 28th day after surgery. After two operations, rats need intramuscular injection of ampicillin to prevent infection. Following the observation period, the rats were sacrificed by exsanguination following intraperitoneal injection of pentobarbital sodium (50 mg/kg), and their blood samples, and kidney tissues were collected for further study.

Total RNA was extracted from treated cells using the Trizol reagent (RC112, Vazyme, Nanjing, China) and reverse-transcribed using the HiScript lll 1st Strand cDNA Synthesis Kit (R312, Vazyme, China). Subsequently, qRT-PCR was performed on an applied biosystems Inc. (ABI) (Foster，CA，USA) real-time PCR system following the manufacturer’s recommended cycling parameters. The specific cycle parameters are shown in Table 1. Relative fold changes in gene expression were analyzed by normalizing to the endogenous controls GADPH or U6 to account for loading variation. The primer sequences are as followed: TRPM2 (Rat), Forward: CGACGAGCCAGATGCTGAG; Reverse: ATCAGGGTAGAGGAGGTGCC; GAPDH (Rat), Forward: GAAGCTGGTCATCAACGGGA; Reverse: ACGACATACTCAGCACCAGC; TRPM2 (Human), Forward: CCGAGCAGAAGATCGAGGAC; Reverse: GGGTGGTTACTGGAGCCTTC; GAPDH (Human), Forward: AATGGGCAGCCGTTAGGAAA; Reverse: GCGCCCAATACGACCAAATC.

Protein samples were extracted from cells or tissues using RIPA lysis buffer. Protein quantification was performed by bicinchoninic acid (BCA) method. Total protein extracts (30 µg) from each sample were subjected to SDS-PAGE gels and transferred onto PVDF membranes for western blotting. At room temperature, the PVDF membrane was blocked with a rapid blocking solution for 30 min, and then incubated with primary antibody overnight at 4 °C Then the secondary antibody was added and incubated at room temperature for 2 h. The primary antibody: anti-TRPM2 (1:1000, ab11168, Abcam, Cambridge, UK) and anti-GAPDH (1:10,000, bsm-33033M, Bioss, Beijing, China); The second antibody: Goat Anti-Rabbit IgG H&L (bs-0295G-HRP), Goat Anti-Mouse IgG H&L (1:20,000, bs-0296G-HRP, Bioss, Beijing, China). Finally, JP-K6000 chemiluminescence imager (Jiapeng, Shanghai, China) was used to develop and Image J software 1.8.0 (NIH, Bethesda, MD, USA) was used for quantitative analysis.

HK-2 cells were plated in 96-well plates at a suitable density of 2000 cells/well. After the cells adhered, the old complete medium was removed and replaced with fresh serum-free medium for 12 hours. Subsequently, the cells were incubated with a 10% CCK8 solution, protected from light, for 1 hour. Finally, cell viability was assessed by measuring absorbance at 450 nm by an RT-6000 enzyme microplate reader from Rayto (Santa Cru, CA, USA).

The BD Pharmingen FITC Annexin V Apoptosis Detection Kit (C1062L, Beyotime, China) was used for evaluating cell apoptosis. Briefly, the cells were washed, collected, and resuspended in binding buffer. Next, the cells were stained with 5 µL Annexin V-FITC and 5 µL PropidiumIodide (PI) in the dark for 15 minutes, and positive cells were analyzed on an Attune NxT (Themo Fisher, Boston, MA, USA).

The pre-cultured cells were taken out, the medium was removed, and the cells were washed with buffer 3 times. Then the Rhod-2/Acetoxymethyl ester (AM) working solution was added to the cells, and the amount of addition was based on the coverage of the cells, and the cells were cultured at 37 °C for 30 min; after the Rhod-2/AM working solution was poured out, the buffer was added and the cells were washed three times. Next, the cells were covered with buffer and incubated at 37 °C for about 30 min. Finally, the cells were detected under a microscope (KEYENCE, Osaka, Japan).

The expression levels of interleukin 10 (IL-10), tumor necrosis factor-$\alpha$ (TNF-$\alpha$), malondialdehyde (MDA), ROS, total antioxidant capacity (T-AOC), and Ca²⁺ were measured using enzyme-linked immunosorbent assay (ELISA) kits (COIBO BIO, Shanghai, China) according to the manufacturer’s guidelines. In simple terms, the cells in logarithmic phase were inoculated in 6-well plates with 1 $\times$ 10⁶ cells per well, and the cells were treated in groups and cultured in 37 °C, 5% CO₂ cell incubator for 24 h. Configure standard dilutions according to the instructions. The prepared standard dilutions and samples were added to a 96-well plate (50 µL/well), sealed with a sealing film, incubated at 37 °C for 30 minutes, washed with detergent, and dried. After that, the enzyme-labeled reagent 50 µL/well was added, and the incubation was continued at 37 °C for 30 minutes. The washing solution was washed and dried. Add the chromogenic agent A and B each 50 µL/well, 37 °C away from light color for 15 minutes, then add the stop solution (50 µL/well). Finally, the absorbance (OD value) of each group of samples at 450 nm wavelength was measured using a microplate reader (357-714018, Thermo scientific, Boston, MA, USA).

The samples from each experimental group were exposed to 4% paraformaldehyde at ambient temperature overnight. For the TUNEL assay, the sections were incubated with proteinase K solution and labeled with TdT reaction solution following the instructions. Cell nuclei were counterstained with DAPI. Then images for apoptotic cells were captured using a Nikon Eclipse 80i light microscopy (BZ-H4XD, Keyence Corporation, Osaka, Japan) with identical parameters.

Briefly, collected rat kidneys were routinely dehydrated, embedded in paraffin and sliced into 4 µm-thick sections. Then, Hematoxylin and eosin (H&E) staining was carried out and representative photographs of the stained sections were captured to observe the histomorphological and structural changes as previously described [21].

Statistical analysis was conducted via Graphpad Prism 9 software (Graphpad, Boston, MA, USA). Continuous variables were first tested for normal distribution using the Shapiro-Wilk method. For normally distributed continuous data, the format (mean $\pm$ SD) was employed. Non-normally distributed data was analyzed using Wilcoxon rank-sum test, and the [median (25% quantile,75% quantile)] was used for presentation. p-value less than 0.05 were considered statistically noteworthy.

We initially investigated the role of TRPM2 in LPS-injured HK-2 cells and in cells with Yoda1-activated calcium ion channels. HK-2 cells were treated with 1 µg/mL LPS for 48 hours, after which TRPM2 expression was quantified using Western blot and qRT-PCR. Our findings revealed significantly elevated TRPM2 expression in LPS-injured HK-2 cells, with further increases upon Yoda1-induced activation of calcium ion channels (p 0.05, Fig. 1A–C). To explore the impact of TRPM2 on HK-2 cell injury, we constructed a TRPM2-silencing expression vector and transfected it into HK-2 cells (p 0.05, Fig. 1D). CCK-8 assays demonstrated that TRPM2 knockdown enhances the viability of LPS-injured HK-2 cells, while Yoda1 treatment significantly reduced cell viability (p 0.05, Fig. 1E). Additionally, flow cytometry analyses indicated that TRPM2 silencing attenuates apoptosis in LPS-injured HK-2 cells, while Yoda1 promotes apoptosis (p 0.05, Fig. 1F,G). Collectively, our data confirm that TRPM2 is upregulated in LPS-injured HK-2 cells, and that excessive calcium influx augments TRPM2 activity. These findings suggest that TRPM2 may modulate calcium signaling to suppress the proliferation of HK-2 cells and induce apoptosis.

Fig. 1.

Transient receptor potential melastatin 2 (TRPM2) is highly expressed in LPS-induced renal tubular epithelial cells, and TRPM2 promotes proliferation and inhibits apoptosis of LPS-stimulated HK-2 by inhibiting calcium ion channel activation. (A,B) Western blot results of TRPM2 protein exhibition. (C) qRT-PCR analysis of TRPM2 mRNA expression. (D) qRT-PCR analysis of TRPM2 transfection efficiency. (E) CCK-8 assay measuring cell viability. (F,G) Flow cytometry assay detecting cell apoptosis. n = 3, *p 0.05, **p 0.01, ***p 0.001. LPS, lipopolysaccharide; qRT-PCR, quantitative real-time polymerase chain reaction; si-NC, small interfering RNA negative control.

To elucidate the role of TRPM2 in modulating cellular inflammatory responses and OS through the activation of calcium ion channels, this study involved the transfection of LPS-injured HK-2 cells with a TRPM2-targeting small interfering RNA (siRNA) expression vector (p 0.05, Fig. 1D). ELISA results indicated that TRPM2 deficiency inhibits the expression of the inflammatory cytokine TNF-$\alpha$, as well as MDA and ROS levels, while promoting T-AOC expression. Calcium channel inhibitor Yoda1 showed the opposite effect after treatment. (p 0.05, Fig. 2A–D). Ion fluorescence probe results showed that silencing TRPM2 inhibits the activation of calcium ion channels (p 0.05, Fig. 2E,F). These findings demonstrate that TRPM2-Ca²⁺ signaling plays a prominent part in the cellular inflammatory and OS reactions in LPS-induced renal injury.

Fig. 2.

TRPM2 inhibits the activation of calcium ion channels, thereby suppressing cellular inflammatory and oxidative stress (OS) reactions. (A–D) ELISA detection of TNF-$\alpha$, MDA, ROS, and T-AOC expression. (E,F) Ion fluorescence probe detection of Ca²⁺ expression. Scale bar = 100 µm, n = 3, *p 0.05, **p 0.01, ***p 0.001. ROS, reactive oxygen species; T-AOC, total antioxidant capacity; TNF-$\alpha$, tumor necrosis factor-$\alpha$; MDA, malondialdehyde.

The expression of biomarkers such as IL-10 and TNF-$\alpha$ in the blood directly reflects the degree of renal injury and the state of inflammatory response [22]. In order to study whether TRPM2 affects inflammation and OS response in CRS rats, blood and kidney tissues of CRS rats were detected respectively. The CRS rat was made by ligating the left anterior and descending coronary artery united with acute renal ischemia-reperfusion. The sh-TRPM2 plasmid was injected into CRS rats to silence TRPM2 gene expression, and Yoda1 was used for intervention. ELISA results showed that silencing TRPM2 inhibited IL-10 and TNF-$\alpha$ inflammatory markers, as well as MDA and ROS level in the blood of CRS rats, while promoting T-AOC expression and increasing Ca²⁺ levels in the blood following TRPM2 silencing as well (p 0.05, Fig. 3A–F). Western blot and qRT-PCR results demonstrated high TRPM2 expression in kidney tissues of CRS rats, which was further enhanced after calcium ion channel activation (p 0.05, Fig. 3G–I). The data show that TRPM2 is highly expressed in CRS rats, and silencing TRPM2 suppresses inflammatory and OS reactions in CRS rats, Yoda1 treatment showed the opposite effect.

Fig. 3.

TRPM2 is highly expressed in cardiorenal syndrome (CRS) rats, and silencing TRPM2 suppresses inflammatory responses and oxidative stress reactions in CRS rats, which can be reversed by Yoda1. (A–F) ELISA detection of IL-10, TNF-$\alpha$, MDA, ROS, T-AOC and Calcium ion. (G–I) Western blot and qRT-PCR results of TRPM2 expression in kidney tissues of CRS model rats. n = 3, *p 0.05, **p 0.01, ***p 0.001. IL-10, ̵‌interleukin 10‌; KD, knockdown.

To investigate the effects of intervening TRPM2 expression on renal tissue damage and cell apoptosis, this study focused on type 2 CRS rats. H&E staining revealed focal interstitial fibrosis, inflammatory cell infiltration, irregular tubular structure, minimal tubular dilation, decreased glomeruli with unclear structure in type 2 CRS rat kidney tissues. Conversely, silencing TRPM2 reduced focal interstitial fibrosis, decreased inflammatory cell infiltration, restored tubular structure with increased tubular dilation, and clearer glomerular structure. After injection of Yoda1 into type 2 CRS rats, compared with CRS model rats, Yoda1 further inhibited renal tubular atrophy, renal tubular wall thickening with lumen expansion and irregular arrangement, which was different from the results after silencing TRPM2 (Fig. 4A). TUNEL staining showed that TRPM2 silencing reversed cell apoptosis in type 2 CRS rat kidney tissues, which was promoted upon Ca²⁺ channel activation (p 0.01, Fig. 4B).

Fig. 4.

TRPM2 mitigates renal tissue damage and alleviates cell apoptosis in type 2 CRS rats by inhibiting calcium ion channel activation. (A) H&E staining to observe histopathological changes in kidney tissue. Red, glomerulus; Yellow, renal tubule. Scale bar = 100 μm. (B) TUNEL staining to observe cell apoptosis in kidney tissue. Scale bar = 50 µm, n = 3, **p 0.01, ***p 0.001.