All procedures involving animals in this study complied with the NIH Guide for the Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee of Tianjin Medical University (approval No. IRB2024-DWFL-173). Male C57BL/6J mice, weighing between 22 and 24 g, were obtained from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). and maintained in the animal facility of Tianjin Medical University General Hospital at 22–25 ℃ temperature and 50% relative humidity under a 12 h light/dark cycle. All animals had access to food and water.

The mice were subjected to microsurgical creation of BOO under anesthesia using isoflurane essentially as described [10]. Briefly, mice were anesthetized with 1.5% isoflurane and placed in a supine position with a 1–2 cm incision to expose the urethrovesical junction. A 0.5-mm inner diameter polyethylene tube was placed around the bladder neck, and a 3-0 polypropylene suture was used to tie gently around the bladder neck and then draw out the catheter. Then the incision was closed and disinfected. Mice were anesthetized with 1.5% isoflurane and euthanized via cervical dislocation at day 21 post-operation. Some parts of the bladder tissues were collected immediately for histology or immunochemistry, and the remaining tissues were snap-frozen in liquid nitrogen for performing microarray, qPCR, or western blotting.

In vivo siRNA transfection was performed using Lipofectamine-3000 (Thermo Fisher Scientific, Waltham, MA, USA). Both siRNA-CTSS (0.5 nmol, RiboBio, Guangzhou, China) and siRNA-control (0.5 nmol, RiboBio) were complexed with an equal volume of Lipofectamine-3000 prior to delivery. The mixed solutions were injected through the tail vein daily. The BOO model was administered immediately post-transfection.

Mice smooth muscle cell line (mBSMC) and macrophage cell line (RAW264.7) were purchased from Yipu Biotechnology (Wuhan, China) and cultured in DMEM-basic medium (Gibco, Waltham, MA, USA) with 10% FBS and 1% penicillin/streptomycin (Thermo Fisher Scientific). The interaction between mBSMC and RAW264.7 was detected by a Transwell system (Corning Corporation, Corning, NY, USA). mBSMC were inoculated into the lower chamber, while RAW264.7 cell was cultivated in the upper chamber of the Transwell system. The cells were maintained in a culture chamber (Thermo Fisher Scientific) at 37 ℃ with 5% CO₂. We incubated the cells with 10 ng/mL TGF$\beta$ (HY-P78360, MedChem Express LLC, Monmouth Junction, NJ, USA) for 15 minutes to induce cell hypertrophy. In vivo siRNA transfection was performed using Lipofectamine-3000 (L3000075, Thermo Fisher Scientific). Both siRNA-CTSS (0.5 nmol, RiboBio) and siRNA-control (0.5 nmol, RiboBio) were complexed with an equal volume of Lipofectamine-3000 prior to delivery and added to the culture medium for 5 h. All cell lines were validated by short tandem repeat (STR) profiling and tested negative for mycoplasma.

The mice were placed in individual metabolic cages for 1 h with an underlying Whatman filter paper, and food and water were obtained ad libitum. The filter paper sheets were then imaged using UV light. The number and pattern of voids were noted, and the area of each voiding stain was measured using Image J (v1.8.0, NIH, Bethesda, MD, USA). The volume of urine was onverted from the stain area by using a standard curve. Sporadic noncircular small-diameter urine spots were excluded.

Total RNA was extracted from the samples using standard extraction methods. Total RNA (with the addition of PolyA control), cDNA first-strand and second-strand were synthesized, and cRNA was synthesized by in vitro transcription. After purification and quantification of cRNA, cRNA was diluted to 625 ng/µL for subsequent experiments. After purification of the synthesized 2nd-cycle single-stranded cDNA, 5.5 µg of sscDNA was diluted to 31.2 µL with enzyme-free water for subsequent fragmentation and labeling. The fragmented and labeled samples are added to the corresponding microarrays and placed into the GeneChip Hybridization Oven 645 (Affymetrix, Santa Clara, CA, USA) for hybridization at a specific temperature and speed; after reaching the specified time, the microarrays were eluted using the GeneChip Fluidics Station 450 (Affymetrix, Santa Clara, CA, USA) according to the corresponding protocol. After completion, the GeneChip 3000 7G scanner (Affymetrix, Santa Clara, CA, USA) was used for scanning. The scanner captures the fluorescence signal and converts the signal by GCOS software to obtain the signal value of each probe and generate a CEL file. False Discovery Rate (FDR) correction for high-throughput gene data.

The bladder tissues were submerged overnight in 4% paraformaldehyde and then embedded in paraffin, and 5 µm sections were sliced. Masson’s trichrome staining method was used to evaluate the extent of bladder tissue fibrosis. For immunohistochemical (IHC) staining, bladder sections were blocked with 0.3% Triton X-100 (Solarbio, Beijing, China) and 3% albumin bovine V (biotopped, Beijing, China) and incubated overnight with antibodies as follows: Anti-alpha smooth muscle Actin 2 (ACTA2) (ab5694, Abcam, Cambridge, UK), Collegen-I (Col-I) (ab270993, Abcam), Col-III (22734-1-AP, Proteintech, Chicago, IL, USA). Following incubation with a secondary antibody, 3,3-diaminobenzidine (Gene Tech) was used as a substrate, and re-staining was performed with hematoxylin (Solarbio). These slices were observed and imaged using a DM500 light microscope (Leica, Wetzlar, Germany). The results of immunochemistry were measured by using the Image J software (v1.8.0, NIH). A total of 5 randomly selected fields were captured and analyzed. For immunofluorescence (IF) staining, the cell creep was placed in a cell culture dish and cleaned 3 times using PBS. After cleaning, the cells were fixed at room temperature with 4% paraformaldehyde for 20 minutes and then rinsed with PBS 3 times. Subsequently, slides were treated with 5% BSA for 30 minutes at room temperature to block nonspecific staining. Slides were incubated with different primary antibodies (Abcam) overnight at 4 °C. On the second day, slides were cleaned with PBS 3 times and incubated with the corresponding secondary antibody (Abcam) for 1 hour at room temperature. Finally, the slides were washed with PBS 3 times, and the slides were sealed. The nuclei were counterstained with DAPI. The slides were used to observe and quantify with a DMILLED immunofluorescence microscope (Leica). The fluorescent intensity was determined using Image J (v1.8.0, NIH). A total of 5 randomly selected fields were captured and analyzed.

The bladder tissues were placed in Radio Immunoprecipitation Assay (RIPA) Lysis buffer, which was sonicated for 10 minutes and then centrifuged at 13,000 rpm for 15 minutes at 4 °C. Protein concentration was determined by the kit (Solarbio). Equal amounts of proteins were separated on the gel by sodium dodecyl sulfate - polyacrylamide gel electrophoresis and then transferred to Polyvinylidene Fluoride membranes. The membranes were then blocked in 5% skim milk and reacted overnight at 4 °C with different primary antibodies: IL-6 (AMC0864, Invitrogen, Carlsbad, CA, USA), interleukin-6 receptor (IL-6R) (ab83053, Abcam), CTSS (ab232740, Abcam), ACTA2 (ab5694, Abcam), Actin (ab8226, Abcam), Col-I (ab270993, Abcam), Col-III (22734-1-AP, Proteintech), CXCL17 (MA5-24157, Invitrogen), Tubulin (11224-1-ap, Proteintech), Angptl7 (PA5-36575, Invitrogen). After incubation with secondary antibodies coupled to horseradish peroxidase membranes, they were observed using an enhanced chemiluminescence detection kit (Millipore Sigma, Burlington, MA, USA), and the mean pixel density of protein bands was quantified by ImageJ software (v1.8.0, NIH) and was standardized to GAPDH or tubulin.

RT-qPCR was performed to detect cytokine RNA levels in bladder tissues. Total RNA was extracted using the kit (Accurate Biology, Changsha, China). The obtained RNA samples were then reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, Kusatsu, Japan). Finally, quantitative PCR was performed on an Applied Biosystems 7300 Plus using a Direct TB Green qPCR kit (Takara). Results were normalized using GAPDH gene expression and expressed as relative expression values. The primer sequences were as follows:

① CTSS:

Primer-F: 5^′ TGACGAGGATGCCCTGAAAGA 3^′

Primer-R: 5^′ GTCCCATAGCCAACCACAAGA 3^′

② CXCL17:

Primer-F: 5^′ AAAAGCACCACAGGAAGTCGC 3^′

Primer-R: 5^′ TCTTGTAGGGTAAACAGAAGGCATAA 3^′

③ Angptl7:

Primer-F: 5^′ TCTACCATAACAACACCGTCTTCAGC 3^′

Primer-R: 5^′ GATGCCATCCATGTGCTTTCG 3^′

The bladder samples were homogenized according to the manufacturer’s protocol. Inflammatory factors were detected in the bladder samples using ELISA kits for CTSS, IL-6, and soluble IL-6R (sIL-6R) (KND, Wenzhou, China). The measured OD values were converted into concentration values.

All results were expressed as mean $\pm$ standard deviation (SD). Student’s t-test or one-way analysis of variance (ANOVA) test followed by Tukey’s post hoc test were used among the groups. The Statistical Package for the Social Sciences (SPSS) software version 26.0 (IBM Corporation, Armonk, NY, USA) was used to conduct the statistical analysis. A p-value less than 0.05 was considered significant.

To identify the pathological change of mice’s bladder post-obstruction, we established an animal model using the Leadbetter operation and obtained the result of bladder function change in mice by observing urination behavior with VSOP. The results showed a dramatic decrease in urination volume after the obstruction occurred, which, in particular, started on day 7 post-obstruction (64.018 $\pm$ 94.431 µL vs control 345.2 $\pm$ 161.339 µL), and reached its lowest point by day 28 (6.878 $\pm$ 12.441 µL vs control 468.348 $\pm$ 109.671 µL) (Fig. 1A). Furthermore, ladder tissues were collected on the 28th day after obstruction. The Masson’s staining and IHC results indicated the development of bladder fibrosis, along with elevated levels of fibrogenic or hypertrophy factor ACTA2, Col-I, and Col-III in the obstruction group (Fig. 1B–E). We carried out in vitro studies using bladder smooth muscle cells, and the IF results showed that after TGF$\beta$ stimulation, significant hypertrophy of bladder smooth muscle cells was observed (Fig. 1F,G).

Fig. 1.

Bladder function and pathological change following BOO. (A) Voiding behavior was assessed using VSOP. And the results showed that urine volume decreased dramatically in the obstruction group. (B–E) Masson’s staining showed more fibrosis, and IHC showed higher expression levels of ACTA2, Col-I, Col-III in the obstruction group. The representative images and IHC positivity statistics are shown. Scale bar = 100 µm. (F,G) TGF$\beta$ can induce smooth muscle cell hypertrophy. Scale bar = 100 µm. The data are expressed as the mean $\pm$ SEM, and n = 10 for each group in VSOP, n = 6 for each group in others. *p 0.05; **p 0.01.

The volcano plot displayed the distribution of differential genes, with a total of 541 genes up-regulated and 943 genes down-regulated in the Obs group compared to the SHAM group (Fig. 2A). The heatmap showed the differential gene clustering analysis (Fig. 2B). Subsequent Gene Ontology (GO) enrichment analysis revealed that the up-regulated genes were concentrated in the functions of the innate immune response, immune system process, and cellular response to interferon-beta (Fig. 2C). Among these differential genes, we focused on the top ten most significantly upregulated genes in this Obs group (Fig. 2D). Combining the results of GO analysis with literature reports, we identified CTSS, CXCL17, and ANGPTL7 as candidate genes because they are all associated with immune response. We checked the expression level of selected proteins with qPCR, and the results indicated that CTSS, CXCL17, and ANGPTL7 increased dramatically after obstruction (Fig. 3A). We again examined the expression of these three candidate proteins in bladder tissues of mice with bladder obstruction. Western blot results showed that CTSS was most significantly upregulated compared to the control group; the level increased approximately nine-fold (Fig. 3B,C). Consistent with these in vivo findings, in vitro experiments demonstrated that CTSS expression was markedly up-regulated along with ACTA2 in bladder smooth muscle cells following TGF$\beta$ stimulation (Fig. 3D,E).

Fig. 2.

Gene expression analysis for BOO and sham mice. (A) Volcano Plot shows the distribution of differential genes between the control group and obstruction group. (B) Hierarchical Clustering was done for differentially expressed genes and displayed in the form of heatmap. (C) Gene Ontology (GO) analysis of the main functions of the genes upregulated in the Obs group. (D) The top ten most significantly upregulated genes in the Obs group. p 0.05, $|$FC$|$ $>$1.2.

Fig. 3.

The differential expression of selected gene or protein following BOO in vivo or in vitro. (A) qPCR test results in genes selected from microarray result, and CTSS, CXCL17, and ANGPTL7 identified as candidate genes in the following verification. (B,C) the expression of CTSS, CXCL17, ANGPTL7 in mice model. (D,E) the expression of ACTA2, CTSS, CXCL17, ANGPTL7 in smooth muscle cells. The protein levels of CTSS and CXCL17 were upregulated in vivo and in vitro. But the expression of ANGPTL17 was only significantly elevated in vitro. The data are expressed as the mean $\pm$ SEM, and n = 6 for each group. **p 0.01; ***p 0.001.

To study the effect of CTSS on the mice bladder, VSOP showed that, compared with the obstruction group treated with siCTSS, the urine volume of the obs/siCTSS group starting from the 7th day following BOO. Particularly, the improvements were most significant on day 28 (123.956 $\pm$ 36.233 µL vs obs 24.878 $\pm$ 25.899 µL) and day 56 (82.256 $\pm$ 61.788 µL vs obs 18.386 $\pm$ 16.509 µL) (Fig. 4A). Masson’s staining showed that the fibrosis condition improved when CTSS was suppressed (Fig. 4B). Furthermore, we performed IHC and Western blot on proteins from bladder tissues of various groups of mice, and the results showed that the expression of ACTA2 and Col-I, Col-III decreased due to down-regulation of CTSS in IHC and western blotting (Fig. 4B–G). All of these results indicated that CTSS induced bladder dysfunction and fibrosis following BOO.

Fig. 4.

Downregulation of CTSS improved bladder function and bladder fibrosis after BOO. (A) VSOP showed that bladder function of the Obs/siCTSS group was improved since the 28th day after obstruction, compared with control. (B–E) Downregulation of CTSS improved bladder fibrosis in Masson’s staining and IHC. Representative images and IHC positivity statistics are shown. Scale bar = 100 µm. (F,G) Downregulation of CTSS decreased the expression level of ACTA2, Col-I, and Col-III in western blotting. The data are expressed as the mean $\pm$ SEM, and n = 10 for each group in VSOP, n = 6 for each group in others. *p 0.05; **p 0.01; ***p 0.001.

Our results demonstrated that the expression levels of CTSS were elevated in both TGF$\beta$-stimulated smooth muscle cells (SMCs) and TGF$\beta$-stimulated SMCs/monocyte–macrophages. For ACTA2, expression increased under both conditions; a substantial elevation was observed only in the presence of monocyte–macrophages existed (Fig. 5A,B). The upregulation of CTSS was abolished by siCTSS treatment; however, the most pronounced reduction in ACTA2 expression occurred when SMCs were co-cultured with monocyte–macrophages (Fig. 5C,D). Additionally, we also observed a reversal of TGF$\beta$-induced SMCs hypertrophy following co-culturing with monocyte–macrophages and treated with siCTSS (Fig. 5E,F).

Fig. 5.

CTSS contributed to hypertrophy in smooth muscle cells when co-cultured with monocytes. (A,B) The expression level of CTSS and ACTA2 with TGF$\beta$ stimulation. (C,D) The expression level of CTSS and ACTA2 with CTSS downregulation. (E,F) Downregulation of CTSS inhibited hypertrophy induced by TGF$\beta$ in smooth muscle cells/monocytes. Scale bar = 100 µm. The data are expressed as the mean $\pm$ SEM, and n = 6 for each group. *p 0.05.

The expression levels of both CTSS and IL-6 in the cell supernatant were increased in TGF$\beta$-stimulated SMCs (CTSS: 955.437 $\pm$ 16.315 pg/mL vs control 377.7 $\pm$ 7.231 pg/mL; IL-6: 155.143 $\pm$ 3.272 pg/mL vs control 19.183 $\pm$ 2.225 pg/mL) and in TGF$\beta$ stimulated SMCs/monocyte–macrophages (CTSS: 983.767 $\pm$ 27.134 pg/mL vs control 402.943 $\pm$ 34.184 pg/mL; IL-6: 198.08 $\pm$ 7.931 pg/mL vs control 54.757 $\pm$ 1.114 pg/mL) (Fig. 6A,B). In contrast, elevated levels of sIL-6R in supernatant were observed only in TGF$\beta$ SMCs/monocyte–macrophages (148.653 $\pm$ 2.551 pg/mL vs control 52.217 $\pm$ 4.11 pg/mL) (Fig. 6C). Conversely, when we blocked ADAM17 (a canonical protein that promotes the generation of sIL-6R) in the co-culture system, no significant effect was observed. By comparison, CTSS was identified as the primary mediator in this process (Supplementary Fig. 1). When CTSS expression was reduced using siCTSS, IL-6 levels remained unchanged in both the stimulated SMCs alone and the stimulated co-cultured group (Fig. 6D,E). However, sIL-6R expression decreased significantly only in the stimulated co-cultured group (115.52 $\pm$ 5.133 pg/mL vs control 181.11 $\pm$ 6.154 pg/mL) (Fig. 6F). Results from in vivo experiments in mice further confirmed this signaling pathway (Fig. 6G–I). These findings indicate that sIL-6R/IL-6 signaling is upregulated after bladder obstruction and that CTSS knockdown inhibits this signaling axis. To block sIL-6R/IL-6 trans-signaling, we treated BOO mice daily with sgp130FC (0.5 mg/kg). The VSOP results showed improved bladder function on Day 21 (132.714 $\pm$ 32.118 µL vs obs 27.248 $\pm$ 21.324 µL) and Day 28 (92.713 $\pm$ 52.641 µL vs obs 16.267 $\pm$ 13.352 µL) (Fig. 7A). Bladder sensitivity was also improved (Fig. 7B).

Fig. 6.

CTSS activated CTSS/sIL-6R/IL-6 signal pathway after BOO. (A–C) TGF$\beta$ induced expression change of CTSS, IL-6, sIL-6R in vitro. The expression levels of CTSS and IL-6 both increased in mBSMC and the mBSMC/RAW group stimulated by TGF$\beta$, while IL-6R was only evaluated in the mBSMC/RAW group stimulated by TGF$\beta$. (D–F) Downregulation of CTSS affected the expression change of IL-6, sIL-6R induced by TGF$\beta$ in vitro. sIL-6R expression decreased significantly only in the stimulated co-cultured group treated with siCTSS. (G–I) Downregulation of CTSS affected the expression change of IL-6, sIL-6R induced by BOO in vivo. The data are expressed as the mean $\pm$ SEM, and n = 10 for each group in the IL-6R test in vivo, n = 6 for each group in others. *p 0.05; **p 0.01; ***p 0.001.

Fig. 7.

CTSS affected bladder function through CTSS/sIL-6R/IL-6 trans-signaling after BOO. (A) VSOP showed bladder function was improved when CTSS/sIL-6R/IL-6 trans-signaling was blocked by sgp130FC. (B) Von Frey filament test showed bladder sensibility was improved when CTSS/sIL-6R/IL-6 trans-signaling or CTSS was blocked by sgp130FC or siCTSS. The data are expressed as the mean $\pm$ SEM, and n = 6 for each group. *p 0.01.