Adult Gekko japonicus was used as experimental models as described by Dong et al. [48]. Geckos were housed in the room with humidity- and temperature-controlled and fed with water and mealworms (22–25 °C). To mimic the autotomy in the natural environment, gecko tail amputation was performed at the sixth caudal vertebra according to the unique body structure [49]. The animals were anesthetized by freezing on ice before sacrifice. The number of gecko subjected to amputation was calculated by six per experimental group in triplicate. All experimental protocols were approved by the Animal Ethics Committee of Nantong University.

Injections of 4 $\mu$L of 40 nM MIF inhibitor 4-IPP (Sigma-Aldrich, St. Louis, MO, USA) or 0.1% DMSO (Sigma-Aldrich) were performed using a Hamilton syringe (Hamilton Co., Reno, NV, USA) at the injury sites following gecko tail amputation. The regenerating tails were photographed at 3 and 14 d, respectively.

The amino acid sequences of gecko MMP-1 (gMMP-1) and MMP-3 (gMMP-3) were obtained from the National Center for Biotechnology Information [50]. MegAlign program with the Clustal X 2.0 (http://www.clustal.org/clustal2/) method was used for alignment of multiple protein sequences [51].

Astrocytes (gAS) were isolated and cultured from the spinal cord of adult gecko according to previously described methods [52]. Briefly, the cells were dissociated using 0.25% trypsin (Gibco-BRL, Grand Island, NY, USA) for 20 min at 30 ${}^{\circ }$C, and the suspension was then centrifuged at 1000 rpm for 5 min, before cultured in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS, Gibco-BRL, Grand Island, NY, USA), 1% penicillin/strepto-mycin at 30 °C in 5 % CO${}_2$. A monolayer of astrocytes was obtained nearly 12–14 days after plating in the culture flasks. Third or fourth passage cells were prepared for the experiments. Astrocytes were identified by the staining of the astrocytic marker glial fibrillary acid protein (GFAP, Abcam, Cambridge, MA, USA).

Total RNA of gAS stimulated with 2.5 $\mu$g/mL recombinant gMIF for 0 h and 12 h, was extracted using the mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. The library for RNA-seq analysis was constructed by using the Illumina TruSeq RNA sample Prep Kit v2 and sequenced by the Illumina HiSeq-2000. High-quality reads that passed the Illumina quality filters were kept for the sequence analysis. Using the SOAP program (BGIShenzhen, Shenzhen, China), clean reads were mapped to the reference genomes (Assembly Gekko_japonicus_V1.1 and RGSC Genome Assembly v6.0) and gene sequences. An average read depth of 30$\times$ per sample was achieved, and all samples were analyzed in triplicate.

Differentially expressed mRNA was designated in criteria of greater or less than twofold changes in comparison with control. Function of genes was annotated by Blastx against the NCBI database or the AGRIS database (http://arabidopsis.med.ohio-state.edu/downloads.html) with E-value threshold of 10${}^{-5}$. Gene ontology (GO) classification was obtained by WEGO (http://wego.genomics.org.cn/cgibin/wego/inde-x.pl) via GO id annotated by Perl and R program. For all heatmaps, genes were clustered by Jensen–Shannon Divergence. The reconstructed gene networks were created using IPA on the basis of differentially expressed genes in gMIF-stimulated gAS.

Proteins were extracted from 0.5 cm gecko cord segments above the amputation site or from cultured cells with RIPA lysis buffer (Beyotime, Shanghai, China). The protein concentration of each sample was detected by BCA kit (Beyotime). The extracts were heat-denatured at 95 °C for 5 min, electrophoretically resolved by 10% SDS-PAGE, and transferred to PVDF membranes. The membranes were incubated with primary antibodies in TBS buffer at 4 °C for 18 h, followed with a HRP-conjugated secondary antibody (1:1000, Proteintech Group, Inc., Chicago, IL, USA) at room temperature for 2 h. The signal of HRP activity was detected using an ECL detection kit (Vazyme, Nanjing, Jiangsu, China). Antibodies used in Western blot were: $\beta$-actin (1:5000, Proteintech), Erk1/2 (Cell Signaling Technology, Danvers, MA, USA), p-Erk1/2 (Cell Signaling Technology), SAPK/JNK (Cell Signaling Technology), p-SAPK/JNK (Cell Signaling Techno-logy), P38 (Cell Signaling Technology), and p-P38 (Cell Signaling Technology). The image was scanned with a Tanon-5200 Chemiluminescent Imaging System (Tanon, Shanghai, China), and the data were analyzed using PDQuest 7.2.0 software (Bio-Rad, Hercules, CA, USA).

Total RNA was prepared with Trizol (Thermo Fisher Scientific, Waltham, MA, USA) from gecko cord segments or cultured cells as mentioned above. The first-strand cDNA was synthesized using HisScript Ⅱ Q Select RT SuperMix for qPCR (R223-01, Vazyme, Nanjing, China) in a 20-$\mu$L reaction system that contained 2 $\mu$g total RNA. The cDNA was diluted 1:6 before use in the quantitative PCR (qPCR) assays. Two pairs of primers were designed based on the genome sequences with sense primer 5’- CAA GCC TGC CAT CTG GAA TAG-3’ and anti-sense primer 5’- TAG CCA CGT ACA ATG TCA TAG C -3’ for gMMP-1, sense primer 5’- TCTGACACTTGGGGGTCTCT -3’ and anti-sense primer 5’- TTTCTCCTCGGAAAGTGGCG -3’ for gMMP-3. Reactions were performed in a final volume of 20 $\mu$L according to protocol of ChamQ${}^{\text{TM}}$ SYBR qPCR Master Mix kit (Q711-02, Vazyme, Nanjing, China). The LightCycler96 software (Roche, Basel, Switzerland) was used for real-time PCR analysis. At the end of each PCR run, data were automatically analyzed by the system.

The transverse sections from the spinal cord segments or the cultured cells were incubated with S100$\beta$ antibody (1:500 dilution, Sigma-Aldrich, St. Louis, MO, USA), MMP-1 antibody (1:200 dilution, Abcam, Cambridge, MA, USA), MMP-3 antibody (1:200 dilution, Abcam), CD74 antibody (1:200 dilution, Bioss, Woburn, MA, USA), or GFAP antibody (1:200 dilution, Abcam) at 4 °C for 24 h. Then, the samples were further incubated with Cy3-labeled goat anti-rabbit or anti-mouse IgG (1:400 dilution, Abcam, ab6939, ab97035), or FITC-labeled donkey anti-mouse or anti-rabbit IgG (1:400 dilution, Abcam, ab150105, ab150073) at 4 °C for 18 h. The images were obtained by using Leica TCS SP5 confocal laser scanning microscope system (Leica, Heidelberg, Germany).

The migration of gAS was assayed in triplicates using 24-well transwell chambers with 8 $\mu$m pores (3422, Corning, NY, USA) as previously described [48]. A total of 100 $\mu$L of gAS (3 $\times$ 10${}^{-5}$ cells/mL) with or without siRNA knockdown for 48 h was transferred to the upper chambers at 30 °C in 5 % CO${}_2$. Furthermore, 1.5 $\mu$g/mL recombinant gMIF was added into the lower chambers for 24 h. Cells adhering to the bottom surface of the membranes were fixed and stained with 0.1% crystal violet. Each chamber was imaged under a DMR inverted microscope (Leica Microsystems, Leica, Heidelberg, Germany).

Differences between groups were analyzed by one-way analysis of variance with SPSS 23 software (SPSS, Chicago, IL, USA). Normality and homoscedasticity of the data were verified using Levene’s test before statistical analysis. p 0.05 was considered statistically significant.

To understand the physiological functions of MMP-1 and MMP-3 in gecko after tail amputation, we analyzed the structural characteristics of gMMP-1 (GenBank: XP_015277097) and gMMP-3 (GenBank: XP_015277100) amino acids sequence. The gMMP-1 is composed of 378, while gMMP-3 480 amino acids (Fig. 1). Both matrix metalloproteinases contain a signal peptide, a pro-peptide with a cysteine switch, a catalytic domain and a hemopexin domain, suggesting the conserved primary structure of MMPs in the vertebrates (Fig. 1).

Fig. 1.

Sequence analysis of gMMP-1 and gMMP-3. Multiple alignment of amino acid sequences of gMMP-1 and gMMP-3 with the sequences of other representative vertebrates. Gaps introduced into sequences to optimize alignment are represented by dashes. Signal peptide, Pro-peptide, Catalytic domain, Cysteine Switch motif, Zinc-binding domain, Hinge domain and Hemopexin domain are indicated. Sequences obtained from GenBank: gecko-MMP-1 (XP_015277097), mouse-MMP-1 (NP_032633.1), human-MMP-1 (AIC54763.1), gecko-MMP-3 (XP_015277100), mouse-MMP-3 (NP_034939.1) and human-MMP-3 (NP_002413.1).

To clarify the potential roles of gMMP-1 and gMMP-3 in the injured spinal cord, a 0.5-cm cord segment at lesion site was collected at 0 d, 1 d, 3 d and 7 d after gecko tail amputation. The expression of gMMP-1 and gMMP-3 was detected by RT-PCR, showing that both MMPs transcription dramatically increased from 1 d with a peak at 3 d, and returned to the control level at 7 d (Fig. 2A,B). Immunostaining was then carried out to observe whether gAS was involved in the production of gMMP-1 and gMMP-3 in response to SCI. Results indicated that gecko SCI significantly induced the astrocytic expression of gMMP-1 and gMMP-3, as were analyzed by the colocalization of S100$\beta$-positive astrocytes with anti-gMMP-1 or anti-gMMP-3 antibody at 0 d and 3 d following tail amputation (Fig. 2C).

Fig. 2.

Determination of gMMP-1 and gMMP-3 in the injured spinal cord of gecko. (A,B) RT-PCR analysis of gMMP-1 and gMMP-3 in the 0.5 cm segments of the injured cord following gecko tail amputation (n = 6) at 0 d, 1 d, 3 d and 7 d, respectively. (C) Immunofluorescence showed the colocalization of gMMP-1 (red) with S100$\beta$-positive astrocytes in the injured spinal cord following gecko tail amputation at 0 d and 3 d (n = 5). (D) Western blot analysis for gMIF in the 0.5 cm segments of the injured cord following gecko tail amputation (n = 6) at 0 d, 1 d, 3 d and 7 d respectively. (E) Statistical analysis of (D). (F) The colocalization of CD74 (red) with GFAP-positive astrocytes detected by immunofluorescence in the gecko spinal cord. The rectangle indicates the region magnified. Arrowheads indicate the colocalized signals. Experiments were performed in triplicate. Data are expressed as mean $\pm$ SEM; *p 0.05. Scale bar, 100 $\mu$m in (C) and (F), 20 $\mu$m in the magnification (F).

MMPs can be induced by various inflammatory cytokines including TNF-$\alpha$and IL-1$\beta$ in multiple cell types [53, 54, 55, 56, 57], which however were not inflamed by the gecko SCI [42]. We thus turned to the link between proinflammatory gMIF, a cytokine involved in the neuropathology, with the activation of gMMP-1 and gMMP-3 in astrocytes. Western blot analysis showed that the protein levels of gMIF were temporally increased at lesion site of the cord (Fig. 2D). As MIF initiates intracellular signal transduction through interaction with its cell membrane receptor CD74 [58], immunostaining was performed to examine the expression of CD74 in the astrocytes of the spinal cord, Results revealed that CD74 constitutively colocalized with GFAP-positive astrocytes (Fig. 2F). The data indicate that gMIF may be implicated in the inducing astrocytic expression of gMMP-1 and gMMP-3 following gecko SCI.

To validate the regulatory roles of gMIF on the astrocytic activation of gMMP-1 and gMMP-3, the primary gAS was cultured with purity over 95% (Fig. 3A,B). Transcriptome sequencing (RNA-Seq) was then performed following gAS stimulation with 2.5 $\mu$g/mL gMIF for 12 h. GO analysis of the differentially expressed genes (DEGs) demonstrated gMIF-mediated biological process of gAS was relevant to regulation of cell migration and chemotaxis (Fig. 3C). These DEGs displayed dynamic alteration as shown by Heatmap and cluster dendrogram, among which gMMP-1 and gMMP-3 were found to be significantly induced by gMIF (Fig. 4A). A gene network was constructed by the Ingenuity Pathway Analysis (IPA) using the DEGs, showing that gMMP-1 and gMMP-3 were driven by gMIF (Fig. 4B).

Fig. 3.

Transcriptome sequencing analysis of gAS following stimulation with 2.5 $\mu$g/mL gMIF for 12 h. (A) Primary cultured gecko astrocytes stained with GFAP and Hoechst 33342. (B) Statistical analysis of primary astrocyte purity. (C) GO terms of DEGs in gAS following stimulation with or without 2.5 $\mu$g/mL gMIF for 12 h.

Fig. 4.

Heatmap and the inferred gene network of integrated DEGs. (A) Heatmap of integrated DEGs in response to stimulation of 2.5 $\mu$g/mL gMIF for 12 h. The color scale shown at the right illustrates the relative expression level of the indicated mRNA across all samples: red denotes expression $>$0 and blue denotes expression 0. (B) A reconstructed gene network was created using IPA on the basis of integrated DEGs.

To confirm the inference from RNA-Seq, the expression changes of gMMP-1 and gMMP-3 in gAS were determined by RT-PCR following cell exposure to 0–2.5 $\mu$g/mL recombinant gMIF for 24 h. The primary gAS was examined to constitutively express CD74, gMMP-1 and gMMP-3 (Fig. 5A–C). Once the cells were challenged by gMIF, the transcripts of gMMP-1 and gMMP-3 remarkably increased in concentration-dependent manner (Fig. 5D,E). However, addition of 40 nM 4-IPP, the inhibitor of MIF, obviously attenuated such effects (Fig. 5F,G). These data suggest that gMIF significantly promotes the expression of gMMP-1 and gMMP-3 in gAS.

Fig. 5.

Examination of gMMP-1 and gMMP-3 expression in astrocytes following treatment with gradient recombinant gMIF. (A–C) Immunostaining showed the expression of CD74, gMMP-1 and gMMP-3 in astrocytes. (D, E) RT-PCR analysis for gMMP-1 and gMMP-3 in astrocytes following stimulation with 0–2.5 $\mu$g/mL recombinant gMIF for 24 h. (F, G) RT-PCR shows the expression of gMMP-1 and gMMP-3 following astrocyte treatment with 1.5 $\mu$g/mL gMIF in the presence of 100 $\mu$M 4-IPP. Experiments were performed in triplicate. Data are expressed as mean $\pm$ SEM; *p 0.05. Scale bars, 20 $\mu$m in (A–C).

To explore the roles of gMIF-mediated gMMP-1 and gMMP-3 expression on the cell event of gAS, the gMMP-1 or gMMP-3 was knocked down by siRNA in the presence of gMIF. The siRNA oligonucleotides gMMP-1-s3 and gMMP-3-s2 with the highest efficiency for interference were accordingly selected (Fig. 6A,B). The cells were transfected with gMMP-1-s3 or gMMP-3-s2 oligonucleotides for 48 h, followed by stimulation with 1.5 $\mu$g/mL recombinant gMIF for 24 h. Results demonstrated that gMMP-1-s3 or gMMP-3-s2 was efficient in decreasing gMIF-induced gMMP-1 or gMMP-3 expression (Fig. 6C,D). Subsequently, transwell assays were performed to examine the influence of gMMP-1 and gMMP-3 on the migration of gAS. The results showed that knockdown of gMMP-1 and gMMP-3 significantly attenuated the migratory effects of gMIF (Fig. 6E,F). The data indicate that gMIF-mediated expression of gMMP-1 and gMMP-3 is involved in the migration of gAS.

Fig. 6.

Effects of gMIF-mediated gMMP-1 and gMMP-3 expression on gAS migration. (A, B) Interference efficiency of three siRNA oligonucleotides for gMMP-1 and gMMP-3 was measured by RT-PCR, respectively. gMMP-1-siRNA3 and gMMP-3-siRNA2 were selected for the knockdown experiments. (C, D) The expression of gMMP-1 and gMMP-3 after siRNA knockdown for 48 h, followed by stimulation with 1.5 $\mu$g/mL gMIF for 24 h. (E) Transwell determination of gAS migration after siRNA knockdown for 48 h, followed by stimulation with 1.5 $\mu$g/mL gMIF for 24 h. (F) Quantification data as shown in (E). Experiments were performed in triplicates. Error bars represent the standard deviation (p 0.05). Scale bars, 100 $\mu$m.

MIF influences a variety of cell behaviors through activation of intracellular MAPKs, such as inflammatory response, cellular survival, and proliferation [59]. To unveil the potential regulatory mechanism of gMIF on the expression of gMMP-1 and gMMP-3, 2.5 $\mu$g/mL recombinant gMIF protein was used to stimulate the gAS for 24 h. Results revealed that neither gMIF nor its inhibitor 4-IPP could make any effects on the activation of ERK, P38 and JNK. The data indicate that gMIF-mediated expression of gMMP-1 and gMMP-3 is not governed by MAPKs signaling (Fig. 7A–D).

Fig. 7.

Effects of gMIF on activation of intracellular MAPKs in gAS. (A) Western blot analysis of p-JNK, p-P38 and p-ERK protein levels following astrocytes stimulation with 2.5 $\mu$g/mL recombinant gMIF with or without 4-IPP (40 nM) for 24 h. (B–D) Statistical analysis of (A). Experiments were performed in triplicates. Error bars represent the standard deviation (*p 0.05).

To clarify the physiological significance of gMIF-regulated expression of gMMP-1 and gMMP-3, a total of 4 $\mu$L of 40 nM 4-IPP or 0.1% DMSO was injected into the amputated caudal vertebrae. Immunofluorescence showed that the treatment of 4-IPP significantly suppressed the expression of gMMP-1and gMMP-3 in gAS (Fig. 8A). Meanwhile, the tail regeneration of the animals was attenuated by the inhibitor, as was observed at 3 d and 14 d, respectively (Fig. 8B,C). The data indicate that both gMMP-1 and gMMP-3 induced by gMIF are required for gecko tail regeneration.

Fig. 8.

Inhibitor of gMIF attenuates gecko tail regeneration. (A) Immunofluorescence of gMMP-1 and gMMP-3 expression in gAS after cord treatment with 4-IPP or vehicle following gecko tail amputation (n = 6) at 3 d. The rectangle indicates the region magnified. Arrowheads indicate the colocalized signals. (B) Observation of gecko tail regeneration following injection of 4 $\mu$L of 40 nM 4-IPP at lesion site at 3 d and 14 d (n = 6). (C) Statistical analysis of (B). Experiments were performed in triplicate. Data are expressed as mean $\pm$ SEM; *p 0.05. Scale bars, 100 $\mu$m in (A) and 10 mm in (B).