IMR Press / JIN / Volume 19 / Issue 2 / DOI: 10.31083/j.jin.2020.02.32
Open Access Original Research
Melatonin improves memory defects in a mouse model of multiple sclerosis by up-regulating cAMP-response element-binding protein and synapse-associated proteins in the prefrontal cortex
Show Less
1 Department of Physiology, Faculty of Medicine, King Abdulaziz University, Jeddah, 21589, Saudi Arabia
2 Neuroscience Unit, Faculty of Medicine, King Abdulaziz University, Jeddah, 21589, Saudi Arabia
3 Pre-Clinical Research Unit, King Fahad Medical Research Center, King Abdulaziz University, Jeddah, 21589, Saudi Arabia
*Correspondence: Basalghamdi@kau.edu.sa (Badrah Saeed Alghamdi)
J. Integr. Neurosci. 2020, 19(2), 229–237; https://doi.org/10.31083/j.jin.2020.02.32
Submitted: 7 February 2020 | Revised: 20 March 2020 | Accepted: 7 April 2020 | Published: 30 June 2020
Copyright: © 2020 Alghamdi and AboTaleb. Published by IMR press.
This is an open access article under the CC BY-NC 4.0 license https://creativecommons.org/licenses/by-nc/4.0/.
Abstract

Multiple sclerosis is a progressive autoimmune disorder of the myelin sheath and is the most common inflammatory disease of young adults. Up to 65% of multiple sclerosis patients have cognitive impairments such as memory loss and difficulty in understanding and maintaining attention and concentration. Many pharmacological interventions have been used to reverse motor impairments in multiple sclerosis patients; however, none of these drugs improve cognitive function. Melatonin can diffuse through the blood-brain barrier and has well-known antioxidant and anti-inflammatory properties with almost no side effects; it is, therefore, a promising neuroprotective supplement for many neurological diseases, such as multiple sclerosis, Alzheimer’s disease, Parkinson’s disease, ischemic stroke, and fibromyalgia. However, only some researches have assessed the effect of melatonin on cognitive dysfunction in multiple sclerosis. Here, we evaluated the effects of melatonin supplementation on memory defects induced by cuprizone in a mouse model of multiple sclerosis. Cuprizone (400 mg/kg) and melatonin (80 mg/kg) were administered to SWR/J mice daily for 5 weeks. Open field, tail-flick, and novel object recognition behavioral tests were performed. Also, expression of cAMP-response element-binding protein, synaptophysin, and postsynaptic density protein 95 were measured in the prefrontal cortex. Melatonin significantly improved the memory defects induced by cuprizone toxicity by up-regulating cAMP-response element-binding protein and by increasing expression of the synapse-associated synaptophysin and postsynaptic density protein 95 genes in the prefrontal cortex. These results indicate that melatonin may provide protective effects against memory impairments associated with multiple sclerosis.

Keywords
Multiple sclerosis
melatonin
cuprizone
Creb
synaptophysin
Psd95
1.Introduction

Multiple sclerosis (MS) is a progressive inflammatory autoimmune disease of the myelin sheath that affects around 2.3 million people worldwide (Browne et al., 2014). It is the most common demyelination disorder of the central nervous system (Kashani et al., 2014). Demyelination disrupts the central nervous system signals, leading to various functional abnormalities associated with the affected neurons (Goldenberg, 2012). Moreover, demyelination lesions affect cognitive function in 65% of MS patients (Rahn et al. 2012). However, episodic memory loss and slow information processing speed, which correlate with working memory defects, are the most common mental and cognitive changes seen in MS patients (Mousavi et al., 2018; Sumowski et al., 2018).

Cognition can be described as any form of mental function, intellectual activity, or information processing (Wessinger and Clapham, 2009) with memory forming the basis of these activities (Brod et al., 2013; Unsworth et al., 2009). Memory is a highly complicated process that requires multiple synapses and the coordinated action of many cytoplasmic and nuclear proteins (Takeuchi et al., 2013). There are two broad types of memory, short- and long-term memory, which are subdivided into sensory and working memory, and declarative and non-declarative memory, respectively (Barrett et al., 2010). Each type of memory has a particular mode of action involving various synaptic and cellular events (Takeuchi et al., 2013). Disruption to synaptic plasticity strongly correlates with impaired learning and memory (Peng et al., 2017). cAMP-response element-binding protein (Creb), synaptophysin (Syp), and postsynaptic density protein 95 (Psd95) are proteins that have a fundamental function in axonal transport, synaptic plasticity, and neurogenesis (Ortega-Martínez, 2015). Downregulation of such proteins and focal demyelination in specific brain regions, such as the hippocampus and prefrontal cortex (PFC), are responsible for the cognitive impairments seen in MS patients (Nickel and Gu, 2018). Also, demyelination of the axons that connect the PFC with the hippocampus leads to memory dysfunction (Nickel and Gu, 2018).

Cuprizone (biscyclohexanone oxaldihydrazone) is a copper chelator that is commonly used to induce artificial demyelination in different animal species through oligodendrocyte depletion, microglial activation, and astrocytosis (Abo Taleb and Alghamdi, 2019). Memory impairments are one of the most noticeable effects of cuprizone toxicity (Nickel and Gu, 2018). Other toxic effects of cuprizone include weight gain reduction, a significant decrease in motor activity, oxidative stress, and neuroinflammation (Abo Taleb and Alghamdi, 2019).

Melatonin (N-acetyl-5-methoxytryptamine) is a neurohormone that is mostly produced by the pineal gland (Hevia et al., 2015). It is a small, amphiphilic, nonpolar molecule, that has broad regulatory and neuroprotective functions (Alghamdi, 2018a; Hardeland and Pandi-Perumal, 2005). Melatonin receptors one and two (MT1 and MT2) are present at varying levels in different layers of the cerebral cortex. MT1 receptors are abundant in layers II, III, and V, while a small amount of the MT2 receptor is found in layers V and VI (Ng et al., 2017). Although the physiological function of melatonin in these layers remains unknown, some evidence indicates a role in protecting cognition and preserving memory processes in neurodegenerative diseases (Ng et al., 2017). The biological functions of melatonin are not limited to actions mediated by its receptors. They are not defined by a single pathway because various targets are involved, such as transduction pathways (Shah et al., 2019). Receptor-independent neuroprotective functions of melatonin have been demonstrated, involving antioxidant and anti-inflammatory properties. It acts as a scavenger of free radicals, reduces the production of reactive oxygen species, stimulates the formation and activity of antioxidant enzymes, including catalase, superoxide dismutase, and glutathione peroxidase, and decreases lipid peroxidase levels (Hevia et al., 2015).

Furthermore, melatonin inhibits cyclooxygenase enzyme function and reduces the production of inflammatory cytokines (Alghamdi, 2018a; de la Rocha et al., 2007; Hevia et al., 2015). Moreover, melatonin enhances synaptic growth and protects the neural and glial structures (Alghamdi, 2018a). Recent animal studies have revealed that melatonin reduces memory impairments and neuroplasticity deficits by upregulating Notch1 signaling (Zhang et al., 2016), regulates cognitive function by upregulating the levels of synaptic proteins (Rehman et al., 2019), enhances synaptic integrity by ameliorating stress-activated protein kinase expression, oxidative brain damage, neuroinflammation, and neurodegeneration (Muhammad et al., 2019), attenuates long-term memory defects by calcium channel modulation (Ran et al., 2018), and enhances cognitive deficits by the restoration of myelin and elevating oligodendrocyte function (Chen et al., 2018).

The PFC and hippocampus are the main regions involved in memory processes and are associated with cognitive impairments in MS patients. While some studies have investigated the effect of melatonin on protein levels in the hippocampus, the effect of melatonin on protein levels in the PFC remains poorly understood. We, therefore, designed this study to assess the effect of melatonin in a cuprizone model of MS using a memory test and expression analysis of Creb, Syp, and Psd95.

2. Methods
2.1 Animals

SWR/J mice (male, 20-25 g, King Fahad Medical Research Center, Jeddah, SA) with a total number of 30 were housed in standard laboratory conditions at 20 to 22 °C with a 12-12 hour light/dark cycle. The mice were given free access to chow and water. The animals in each group were marked with different numbers and colors for identification. Male mice were used to exclude any effect of fluctuating hormones (Beery and Zucker, 2011). All animal experiments followed the regulations of the Animal House committee of the King Fahad Medical Research Center, Jeddah, SA.

2.2 Drugs and treatments

Carboxymethyl cellulose (CMC) with a medium viscosity, cuprizone, and crystalline melatonin were purchased from Sigma Aldrich (St. Louis, Missouri, U.S.). A 1% CMC solution was prepared by adding 1 g CMC powder to 100 ml of hot water (60 °C) (Lan et al., 2018). Each day, cuprizone powder (400 mg/kg) was solubilized with CMC solution (cuprizone-CMC) for oral gavage. We administered cuprizone orally to ensure dose consistency among mice to limit the variation of toxic effects (Zhen et al., 2017). Melatonin with a dose of 80 mg/kg was solubilized in normal saline, and intraperitoneally (IP) administrated to mice in a volume of 0.5 ml at around 11:00 a.m. daily, thereby limiting variations in circadian rhythm among the experimental animals. The dose of melatonin was selected as a higher protective dose (Álvarez-Sánchez et al., 2015), and the route of administration was chosen because melatonin is well absorbed after IP injection (Gul et al., 2018).

2.3 Experimental groups

The total duration of the study was 5 weeks. The 30 mice were randomly assigned into three groups, ten mice in each. Group 1. Control: mice were administrated 0.2 ml CMC orally and IP-injected with 0.5 ml normal saline. Group 2. Cuprizone (CPZ): mice received 0.2 ml cuprizone-CMC orally and were IP-injected with 0.5 ml normal saline. Group 3. Cuprizone + melatonin (CPZ + MLT): mice received 0.2 ml cuprizone-CMC orally and were IP-injected with 0.5 ml freshly prepared melatonin. These were administered once daily for the duration of the experiment.

2.4 Behavioral tasks

2.4.1 Tail flick test

The tail-flick test is a widely used technique to measure nociception induced by a thermal stimulus. We used a tail-flick operator (code: 37360, Ugo Basile, Italy), which generates high-temperature stimulus focused on the tail and automatically records the reaction time of the tail-flick. Each mouse was individually was placed in the restrainer at 45 degrees with the tail over the beam source, and the latency of tail-flick was recorded. A cut-off point of 10 s was adopted to avoid tissue injury (Hole and Tjølsen, 1993; Vakilzadeh et al., 2016; Yarushkina et al., 2018).

2.4.2 Locomotor activity (velocity, total distance moved)

An open field test (45 × 45 cm) and EthoVision system XT8A (Noldus, Wageningen, The Netherlands) were utilized for automated calculation of velocity (cm/s), and total distance moved (cm) for each mouse during 3 minutes (Abo Taleb and Alghamdi, 2019; Vakilzadeh et al., 2016).

2.4.3 Novel object recognition test

The novel object recognition test (NORT) has been widely used to assess short-term memory deficits in mice without stress or rewards (Antunes and Biala, 2012). During the experiment, we ensured that the environment was noise-free and that the objects (novel and familiar) could be easily cleaned. Before the experiment, two habituation trials were performed in an empty arena for 10 min per mouse per day. The test was composed of two phases: the sample phase and the test phase (Fig. 2a). In the sample phase, the mouse was placed in the arena for 3 minutes to explore two identical objects placed in the arena (both are familiar objects; FOs). During the test phase, one of the FOs was replaced by a new different object (novel object; NO). The exploration time for each object and the frequency of nose-pointing (sniffing frequency) in the familiar and novel zones were automatically calculated by the EthoVision tracking system. Memory was estimated by measuring the discrimination index (DI), which measures the ability of the mouse to discriminate against the NO as a new object. DI is calculated from the equation (TN - TF)/(TN + TF), where TF is the exploration time for FOs, and TN is the exploration time for NO (Alghamdi, 2018b; Moosavirad et al., 2016).

2.5 Sample collection

Five weeks after cuprizone and melatonin administration, mice were decapitated, and brain tissues were quickly removed and dissected on a dry cold plate. PFC samples were isolated and rinsed with ice-cold saline then kept in -80 °C for gene expression analysis.

2.6 Measurement of Creb, Syp, and Psd95 expression

To detect the expression of Creb, Syp, and Psd95 in the PFC, reverse transcription-polymerase chain reaction (RT-PCR) was performed. The primers for these genes and a housekeeping gene were obtained from the Macrogen Company (Seoul, South Korea) and used following the company’s instructions (Table 1).

Table 1 The nucleotide sequences of PCR primers
Gene Symbol Primer Sequence Length Amplicon Size
Creb Forward CCAAACTAGCAGTGGGCAGT 20 166 bp
Reverse TCCATCAGTGGTCTGTGCAT 20
Syp Forward ACCTCGGTGGTGTTTGGCTT 20 127 bp
Reverse CTGGTTGCTTTTCTGGGGCG 20
Psd95 Forward GACAACCCACACATCGGTGA 20 168 bp
Reverse CTCTTTGAGGGCCTCCACTG 20

2.6.1 RNA extraction from tissue

RNA was extracted from tissues in 600 µL lysis buffer (RLT) + 6 µL B-mercaptoethanol in 1.5 ml tubes. The samples were homogenized using an IKA homogenizer. 70% ethanol (600 µL) was then added, and the sample vortexed. RNA was isolated using an RNeasy mini kit (Qiagen-250; Lot number:74106) following the manufacturer’s protocols (Qiagen, Hilden, Germany).

2.6.2 Reverse transcription-polymerase chain reaction (RT-PCR)

A first PCR master mix was prepared in 5 μl (total volume) which included 2-4 µl experimental RNA, 0.5 µl primer [Oligo (dT) 15], 0.5 µl random primer, and 0-2 µl nuclease-free water. The samples were then put in a thermal cycler for 5 minutes at 70 °C. Then, a second PCR master mix was prepared in a total volume of 15 μl and included 4.0 µl ImProm-II™ 5X Reaction Buffer, 1.2 µl MgCl2 (final concentration 1.5-8.0 mM), 1.0 µl dNTP Mix (final concentration of 0.5 mM for each dNTP), 1.0 µl ImProm-II™ reverse transcriptase, and X µl of nuclease-free water (to a final volume of 15 µl). The transcriptase was activated at 25 °C for 5 min, then incubated at 42 °C for 120 min, followed by 15 min denaturation at 70 °C.

2.6.3 Calculation of relative expression level

Gene expression levels were evaluated by quantitative real-time PCR using the housekeeping gene, Actb (β-actin), as an internal control. Relative expression was calculated by the 2 -△△Ct method.(Rao et al., 2013)

2.7 Statistical analysis

All statistical values are stated as the mean ± standard error (SEM) for behavioral tests and the mean ± standard deviation (SD) for gene expression results. The data were analyzed by analysis of variance (ANOVA) followed by Tukey’s post hoc test using GraphPad Prism 8.3.0 software (GraphPad Inc., La Jolla, CA, USA). CPZ and control groups were compared, as were CPZ and CPZ + MLT groups. A significant difference was quantified when P values < 0.05.

3. Results
3.1 Melatonin prolonged nociception latency in the MS mouse model

Nociception was evaluated in all groups by the tail-flick test. Cuprizone-induced MS model mice compared with control mice showed no significant difference in nociception (P = 0.9249, n = 10), Fig. 1a. However, mice injected with melatonin had a significantly more extended latency period compared with the CPZ group (P = 0.0137, n = 10). Interestingly, mice treated with melatonin also had a significantly more extended latency period compared with the control group (P = 0.0054, n = 10).

Figure 1.

Tail flick test and locomotor activity result at the end of the study. a. Tail flick test: melatonin significantly enhanced the tail-flick latency in the CPZ + MLT group compared with the CPZ group. b. Total distance moved: significant improvement was seen in the total distance movement measured by the open field test in the CPZ + MLT group compared with the CPZ group. c. Velocity: significant improvement was seen in the velocity measured by the open field test in the CPZ + MLT group compared with the CPZ group. One-way ANOVA, followed by Tukey’s test, was used. Data are present as mean ± SEM, ns = non-significant *P < 0.05, ***P < 0.001, ****P < 0.0001.

3.2 Melatonin improved locomotor activity in MS model mice

Locomotor activity was measured as total distance moved and velocity of movement. Mice in the CPZ group moved a significantly shorter distance (P < 0.0001, n = 10; Fig. 1b) and were slower (P = 0.0001, n = 10; Fig. 1c) compared with the control group. However, CPZ + MLT mice moved significantly further (P < 0.0001, n = 10) and faster (P < 0.0001, n = 10) compared with CPZ group mice.

3.3 Melatonin improved novel object recognition in MS model mice

Short-term memory was measured by the NORT (Fig. 2a). Mice in the CPZ group showed a significant deficit in the DI compared with the control group (P = 0.0001, n = 10; Fig. 2b) but no significant difference in visiting and sniffing the novel object versus the familiar object (P = 0.4691, n = 10; Fig. 2c). However, DI was higher significantly in the CPZ + MLT mice compared with the CPZ group (P = 0.0414, n = 10; Fig. 2b) and the mice in CPZ + MLT sniffed the novel object more than the familiar object significantly during the test phase (P = 0.0302, n = 10; Fig. 2c).

Figure 2.

Memory assessment of mice by a novel object recognition test. The novel object recognition test was composed of two stages: a. sample phase, which is a familiar object exposure phase, and a test phase, the duration between two phases is 10 minutes. (N) represents the novel object, and (F) represents the familiar object. b. Discrimination index measured the ability of the mouse to discriminate the novel object as a new object. Melatonin improved the discrimination index in CPZ + MLT group significantly compared with the CPZ group. c. Frequency of sniffing each object. During the sample phase, no difference was detected between groups in sniffing both familiar objects. In the test phase, melatonin improved the ability of mice to recognize the novel object as a new object, this is determined by a significant increase in the frequency of sniffing new (novel) object compared with a familiar object in the CPZ + MLT group. One-way ANOVA followed by Tukey’s test (b) and Two-way ANOVA with Tukey’s test (c) were used. Data are present as the mean ± SEM, ns = non-significant, *P < 0.05, ***P < 0.001.

3.4 Melatonin improved the expression of Creb in the PFC of MS model mice

The expression level of Creb in the PFC was reduced significantly in the CPZ mice (0.200 ± 0.001) compared with the control mice (P < 0.0001, n = 10; Fig. 3a). Melatonin-treated mice had a significantly higher Creb expression level in the PFC (0.702 ± 0.006) in comparison to the CPZ group (P < 0.0001, n = 10; Fig. 3a).

Figure 3.

Relative expression levels of Creb, Syp, and Psd95 in the prefrontal cortex of mice. Relative Creb expression levels in all groups. b. Relative Syp expression levels in all groups. c. Relative Psd95 expression levels in all groups. Cuprizone caused a significant reduction in relative expression levels of Creb, Syp, and Psd95 in the prefrontal cortex, while melatonin improved these levels significantly. All values were normalized against beta-actin. One-way ANOVA, followed by Tukey’s test, was used. Data are present as the mean ± SD, ****P < 0.0001.

3.5 Melatonin improved the expression of synapse-associated proteins in the PFC of MS model mice

Cuprizone administration induced significant reductions in the expression of Syp and Psd95 in the PFC (0.622 ± 0.059 and 0.065 ± 0.001; respectively) compared with the control mice (P < 0.0001, n = 10; Fig. 3b and 3c). CPZ + MLT group mice had significantly improved Syp and Psd95 expression levels in the PFC (0.989 ± 0.183 and 0.326 ± 0.060, respectively) in comparison to the CPZ group (P < 0.0001, n = 10, Fig. 3b and 3c).

4.Discussion

Cognitive impairment is a major social challenge that affects around 65% of MS patients (Jongen et al., 2012). Many studies have identified cognitive impairment in MS patients in the form of loss of memory (40-50%), difficulty in maintaining attention (25%), decreased information processing speed (20-30%), and impaired executive functioning (19%). These symptoms are significantly correlated with their disability status (Guimarães and Sá, 2012). Specifically, long-term memory impairments and working memory loss are the most common memory dysfunctions seen in MS patients (Guimarães and Sá, 2012). Nevertheless, the pathophysiology of cognitive dysfunction in MS has not been fully clarified. However, several studies suggest a disconnection phenomenon between demyelinated and secondary brain regions as the main mechanism of cognitive impairment in MS. A correlation between cognitive disability and the location of specific demyelinated lesions was also revealed (Calabrese et al., 2013). Up to 30% of brain demyelination lesions in MS occur in the hippocampus, while 28% affect the temporal and PFC (Calabrese et al., 2013). Synaptic dysfunction resulting from inflammation is another cause of cognitive dysfunction in MS (Yuan et al., 2015).

We previously confirmed the proficiency of melatonin to decelerate demyelination, accelerate endogenous remyelination, and preserve motor behavior in a mouse model of MS through its anti-inflammatory and antioxidant properties (Abo Taleb and Alghamdi, 2019). In the present study, we have shown another neuroprotective effect of melatonin on cuprizone-caused memory deterioration. Melatonin is a promising supplement for the mild cognitive impairment stage of Alzheimer’s disease, and its benefits have been demonstrated in clinical trials (Cardinali et al., 2012). Moreover, melatonin attenuated spatial memory impairment (Tongjaroenbuangam et al., 2013) and has a positive effect on depressive and anxiety-like behavior (Ergenc et al., 2019).

However, there are contradictory results as to whether melatonin has any effect on cognitive decline in MS (Gholipour et al., 2014; Roostaei et al., 2015). In the present study, the memory impairment was ameliorated by upregulating expression of a presynaptic and postsynaptic associated proteins gene (Syp and Psd95), as well as by increasing Creb expression in the PFC.

Nociceptive pain is a common MS symptom that includes painful tonic spasms and musculoskeletal pain related to corticospinal tract involvement (Berra et al., 2019). In the current study, the pain threshold of the tail-flick test did not change by cuprizone administration, as reported previously (Vakilzadeh et al., 2016). Melatonin administration significantly increased the nociception latency, confirming the anti-nociceptive effect of melatonin observed in previous studies (Vakilzadeh et al., 2016). Melatonin appears to increase the anti-nociceptive effects through the brain and spinal cord MT1 and MT2 receptors as well as by interaction with other receptors, such as those of the N-methyl-D-aspartate receptor (NMDA), dopaminergic and GABAergic systems, and the nitric oxide-arginine pathway (Kuthati et al., 2019; Srinivasan et al., 2012). However, the importance of the PFC in pain processing was confirmed in several studies where the PFC was shown to arbitrate antinociceptive effects (Ong et al., 2019).

We also considered the motor activity outcomes to ensure the induction of the MS model and to investigate the parallel effects of melatonin on motor activity impairment and memory dysfunction, which are both common in MS patients (D'Orio et al., 2012). Our results demonstrated that the administration of cuprizone for 5 weeks significantly reduced the total distance moved and the velocity of movement, while melatonin antagonized the toxic effects of cuprizone on motor activity, which is in agreement with our previous study (Abo Taleb and Alghamdi, 2019).

We also used a recognition memory dependent task (the novel object recognition test) to examine the effects of cuprizone and melatonin on working memory. This test depends on the spontaneous exploratory behavior of mice to evaluate novelty preference and has been carried out to assess prefrontal dependent recognition memory (Antunes and Biala, 2012; Barker et al., 2007). Mice with an intact PFC region are expected to have a greater preference for novel over familiar objects, while prefrontal aberrations result in no preference (Pezze et al., 2017; Reid et al., 2013; Warburton and Brown, 2015). The present findings reveal that cuprizone diminished recognition memory by causing a significant decrease in DI without any difference in exploratory times between familiar and novel objects, which is consistent with results from previous studies (Kondo et al., 2016; Serra-de-Oliveira et al., 2015). However, recognition of memory defects induced by cuprizone was reversed by melatonin administration. Melatonin significantly increased the DI and improved the ability of mice to recognize novel objects in our model, which confirmed the positive effects of melatonin therapy on memory outcomes (He et al., 2013; Osier and Dixon, 2013).

Activity-dependent synaptic plasticity generated at appropriate synapses is important in the encoding, formation, and storage of memories. This complex activity that occurs at individual synapses is dependent on the type of memory required, as well as on the brain area responsible for such activation. Many cellular events, mediators, proteins, neurotransmitters, receptors, and ions are involved in optimizing the potency of connections between neurons, which underlies the ability of the brain to store information (Takeuchi et al., 2013). The PFC and hippocampus are the most important brain regions involved in cognition and memory; the PFC controls cognitive function, non-declarative long term memory, and working memory (Funahashi, 2017; Lara and Wallis, 2015), while the hippocampus mediates declarative long term memory (Eichenbaum, 2001). Moreover, the connections between the PFC, hippocampus, and parahippocampal regions are involved in encoding working memory (Barrett et al., 2010).

In our study, we examined the relative expression levels of Creb, Syp, and Psd95 in the PFC because few studies have investigated synaptic plasticity in the PFC after cuprizone and melatonin administration. Creb is an intranuclear memory modulator protein that participates in neuronal plasticity and neurogenesis (Ortega-Martínez, 2015). Moreover, Creb is a transcription factor that plays a central role in the formation and consolidation of new memories (Ortega-Martínez, 2015) and is a key control protein for long term memory formation. At the synapse, the biochemical response to external stimuli produces varied signaling strength from one neuron to another, which is called synaptic plasticity. This response (if sufficient, for example, by repeated stimulation) reaches the cell nucleus. It activates transcription factors such as Creb leading to synaptic growth, synaptic efficacy, and maintenance of optimal synaptic connectivity between neurons in defined brain circuits, thereby leading to the development of long-term memory (Tully et al., 2003). In our study, cuprizone decreased the expression level of Creb as previously shown (Kim et al., 2019), and melatonin significantly reversed this effect. However, in previous studies, melatonin increased Creb levels in the hippocampus (Ali and Kim, 2015; Kim et al., 2019; Lee et al., 2018; Peng, 2015; Yoo et al., 2012). To our knowledge, no studies have demonstrated a relationship between melatonin administration and Creb levels in the PFC of MS model mice.

We also investigated the expression of Syp in the PFC; Syp is a presynaptic glycoprotein present in the membranes of neurotransmitter-containing presynaptic vesicles and has an important role in synaptic plasticity as well as in the regulation of neurotransmitter release (Frick and Fernandez, 2003; Reddy et al., 2005). It is commonly used as a protein marker for synaptic plasticity (Counts et al., 2006; Reddy et al., 2005). Increased Syp levels are associated with long-term potentiation, learning, and memory (Wheeler et al., 2002). Conversely, downregulation of Syp in the hippocampus and frontal cortex is associated with cognitive impairments (Hajjar et al., 2013; Reddy et al., 2005). In our study, cuprizone significantly decreased Syp expression, as previously shown (Chami et al., 2017). Melatonin significantly increased the expression level of Syp in the PFC, which is consistent with results from previous studies confirming the beneficial effect of melatonin on Syp levels in multiple brain regions (Ali and Kim, 2015; Peng, 2015; Shah et al., 2019; Tongjaroenbuangam et al., 2013; Yoo et al., 2012).

Lastly, we assessed the PFC expression of Psd95, which is a member of the membrane-associated guanylate kinase family that is proposed to regulate the synaptic structure, transmission, stability, and plasticity as well as the formation of long-term memory (Cały et al., 2019). Psd95 is a major regulator of α-amino-3-hydroxy-5-methyl-4-isox-azoleproprionic acid (AMPA) and NMDA receptors (Coley and Gao, 2018) which are present on the surface of the postsynaptic neuron. AMPA and NMDA receptors initiate many forms of synaptic plasticity which strengthen the synapse and, therefore, control memory function (Li and Tsien, 2009). In our study, cuprizone significantly decreased Psd95 expression, as previously shown (Araújo et al., 2017). Melatonin significantly increased the relative expression of Psd95 in the PFC, which was consistent with a previous study showing the beneficial effect of melatonin on Psd95 levels in the hippocampus (Ali and Kim, 2015; Peng, 2015), cortex, and striatum (Shah et al., 2019).

Overall, this and previous studies confirm a protective role of melatonin against cognitive impairment and provide evidence that melatonin can be used as a protective supplement for memory decline in MS through its ability to increase synaptic plasticity.

This study used a limited number of synapse markers to evaluate the effect of melatonin on the PFC. Additional markers for oxidative stress and inflammation and immunohistochemistry in the PFC may be useful for assessing the exact pathophysiology of memory defects in the PFC in MS and for investigating the effect of melatonin in this specific region. The dose of melatonin used in this study, and several previous animal studies (80 mg/kg) needs to be qualified with a proper human supplementation dose to be used in the future human study.

5. Conclusion

The present findings propose that melatonin supplementation could provide a protective impact against memory impairments in MS. This effect may be facilitated by the upregulation of Creb and increased levels of synapse-associated proteins in the PFC.

Ethics approval and consent to participate

All mouse experiments followed the protocols and guidelines of the Animal Unit Department at King Fahad Medical Research Center, Jeddah, SA. The study was approved by the Unit of Biomedical Ethics, Faculty of Medicine, King Abdul-Aziz University, Jeddah, SA (Reference No. 613-18).

Acknowledgments

This study was conducted at the Pre-Clinical Research Unit at King Fahad Medical Research Center and was funded by King Abdul-Aziz University, Jeddah, SA. We thank Jeremy Allen, Ph.D., from Edanz Group (www.edanzediting.com/ac) for editing a draft of this manuscript.

Conflict of Interest

The authors declare no conflict of interest.

References
[1]
Abo Taleb, H., A. and Alghamdi B. S. (2019) Neuroprotective effects of melatonin during demyelination and remyelination stages in a mouse model of multiple sclerosis. Journal of Molecular Neuroscience 70, 386-402. 10.1007/s12031-019-01425-631713152https://www.ncbi.nlm.nih.gov/pubmed/31713152
[2]
Alghamdi, B. S. (2018a) The neuroprotective role of melatonin in neurological disorders. Journal of Neuroscience 96, 1136-1149.
[3]
Alghamdi, B. S. A. (2018b) Possible prophylactic anti-excitotoxic and anti-oxidant effects of virgin coconut oil on aluminum chloride-induced Alzheimer's in rat models. Journal of Integrative Neuroscience 17, 593-607. 10.3233/JIN-18008930010139https://www.ncbi.nlm.nih.gov/pubmed/30010139
[4]
Ali, T. and Kim, M. O. (2015) Melatonin ameliorates amyloid beta-induced memory deficits, tau hyperphosphorylation and neurodegeneration via pi 3/akt/gs k3β pathway in the mouse hippocampus. Journal of Pineal Research 59, 47-59. 25858697https://www.ncbi.nlm.nih.gov/pubmed/25858697
[5]
Álvarez-Sánchez, N., Cruz-Chamorro, I., López-González, A., Utrilla, J. C., Fernández-Santos, J. M., Martínez-López, A., Lardone, P. J., Guerrero, J. M. and Carrillo-Vico, A. (2015) Melatonin controls experimental autoimmune encephalomyelitis by altering the t effector/regulatory balance. Brain, Behavior, and Immunity 50, 101-114. 26130320https://www.ncbi.nlm.nih.gov/pubmed/26130320
[6]
Antunes, M. and Biala, G. (2012) The novel object recognition memory: Neurobiology, test procedure, and its modifications. Cognitive Processing 13, 93-110. 10.1007/s10339-011-0430-z22160349https://www.ncbi.nlm.nih.gov/pubmed/22160349
[7]
Araújo, S. E. S., Mendonça, H. R., Wheeler, N. A., Campello-Costa, P., Jacobs, K. M., Gomes, F. C. A., Fox, M. A. and Fuss, B. (2017) Inflammatory demyelination alters subcortical visual circuits. Journal of Neuroinflammation 14, 162. 10.1186/s12974-017-0936-028821276https://www.ncbi.nlm.nih.gov/pubmed/28821276
[8]
Barker, G. R. I., Bird, F., Alexander, V. and Warburton, E. C. (2007) Recognition memory for objects, place, and temporal order: A disconnection analysis of the role of the medial prefrontal cortex and perirhinal cortex. Journal of Neuroscience 27, 2948-2957. 10.1523/JNEUROSCI.5289-06.200717360918https://www.ncbi.nlm.nih.gov/pubmed/17360918
[9]
Barrett, K. E., Brooks, H. L., Biotano, S. and Barman, S. M. (2010) Ganong's review of medical physiology, 23rd edition, New York, CA: The McGraw-Hill Companies, Inc.
[10]
Berra, E., Bergamaschi, R., De Icco, R., Dagna, C., Perrotta, A., Rovaris, M., Grasso, M. G., Anastasio, M. G., Pinardi, G., Martello, F., Tamburin, S., Sandrini, G. and Tassorelli, C. (2019) The effects of transcutaneous spinal direct current stimulation on neuropathic pain in multiple sclerosis: Clinical and neurophysiological assessment. Frontiers in Human Neuroscience 13, 31. 10.3389/fnhum.2019.0003130809137https://www.ncbi.nlm.nih.gov/pubmed/30809137
[11]
Beery, A. K. and Zucker, I. (2011) Sex bias in neuroscience and biomedical research. Neuroscience & Biobehavioral Reviews 35, 565-572. 10.1016/j.neubiorev.2010.07.00220620164https://www.ncbi.nlm.nih.gov/pubmed/20620164
[12]
Brod, G., Werkle-Bergner, M. and Shing, Y. L. (2013) The influence of prior knowledge on memory: A developmental cognitive neuroscience perspective. Frontiers in Behavioral Neuroscience 7, 139. 10.3389/fnbeh.2013.0013924115923https://www.ncbi.nlm.nih.gov/pubmed/24115923
[13]
Browne, P., Chandraratna, D., Angood, C., Tremlett, H., Baker, C., Taylor, B. V. and Thompson, A. J. (2014) Atlas of multiple sclerosis 2013: A growing global problem with widespread inequity. Neurology 83, 1022-1024. 25200713https://www.ncbi.nlm.nih.gov/pubmed/25200713
[14]
Calabrese, M., Favaretto, A., Martini, V. and Gallo, P. (2013) Grey matter lesions in ms: From histology to clinical implications. Prion 7, 20-27. 23093801https://www.ncbi.nlm.nih.gov/pubmed/23093801
[15]
Cały, A., Śliwińska, M. A., Ziółkowska, M., Łukasiewicz, K., Pagano, R., Nowacka, A., Borczyk, M. and Radwanska, K. (2019) Contribution of psd-95 protein to reward location memory. BioRxiv https://doi.org/10.1101/590109. 10.1101/2020.06.29.17462332637946https://www.ncbi.nlm.nih.gov/pubmed/32637946
[16]
Cardinali, D. P., Vigo, D. E., Olivar, N., Vidal, M. F., Furio, A. M. and Brusco, L. I. (2012) Therapeutic application of melatonin in mild cognitive impairment. American Journal of Neurodegenerative Disease 1, 280-291. 23383398https://www.ncbi.nlm.nih.gov/pubmed/23383398
[17]
Chami, M., Halmer, R., Schnoeder, L., Anne Becker, K., Meier, C., Fassbender, K., Gulbins, E. and Walter, S. (2017) Acid sphingomyelinase deficiency enhances myelin repair after acute and chronic demyelination. PLoS One 12, e0178622-e0178622. 28582448https://www.ncbi.nlm.nih.gov/pubmed/28582448
[18]
Chen, B. H., Park, J. H., Lee, Y. L., Kang, I. J., Kim, D. W., Hwang, I. K., Lee, C. H., Yan, B. C., Kim, Y. M., Lee, T. K., Lee, J. C., Won, M. H. and Ahn, J. H. (2018) Melatonin improves vascular cognitive impairment induced by ischemic stroke by remyelination via activation of erk1/2 signaling and restoration of glutamatergic synapses in the gerbil hippocampus. Biomedicine & Pharmacotherapy 108, 687-697. 30245469https://www.ncbi.nlm.nih.gov/pubmed/30245469
[19]
Coley, A. A. and Gao, W. J. (2018) Psd95: A synaptic protein implicated in schizophrenia or autism? Progress in Neuro-Psychopharmacology & Biological Psychiatry 82, 187-194. 29169997https://www.ncbi.nlm.nih.gov/pubmed/29169997
[20]
Counts, S. E., Nadeem, M., Lad, S. P., Wuu, J. and Mufson, E. J. (2006) Differential expression of synaptic proteins in the frontal and temporal cortex of elderly subjects with mild cognitive impairment. Journal of Neuropathology & Experimental Neurology 65, 592-601. 16783169https://www.ncbi.nlm.nih.gov/pubmed/16783169
[21]
de la Rocha, N., Rotelli, A., Aguilar, C. F. and Pelzer, L. (2007) Structural basis of the anti-inflammatory activity of melatonin. Arzneimittelforschung 57, 782-786. 10.1055/s-0031-129668018380411https://www.ncbi.nlm.nih.gov/pubmed/18380411
[22]
D'Orio, V. L., Foley, F. W., Armentano, F., Picone, M. A., Kim, S. and Holtzer, R. (2012) Cognitive and motor functioning in patients with multiple sclerosis: Neuropsychological predictors of walking speed and falls. Journal of the Neurological Sciences 316, 42-46. 22353853https://www.ncbi.nlm.nih.gov/pubmed/22353853
[23]
Eichenbaum, H. (2001) The hippocampus and declarative memory: Cognitive mechanisms and neural codes. Behavioral Brain Research 127, 199-207.
[24]
Ergenc, M., Ozacmak, H. S., Turan, I. and Ozacmak, V. H. (2019) Melatonin reverses depressive and anxiety like-behaviours induced by diabetes: Involvement of oxidative stress, age, rage and s100b levels in the hippocampus and prefrontal cortex of rats. Archives of Physiology and Biochemistry 15, 1-9.
[25]
Frick, K. M. and Fernandez, S. M. (2003) Enrichment enhances spatial memory and increases synaptophysin levels in aged female mice. Neurobiology of Aging 24, 615-626. 12714119https://www.ncbi.nlm.nih.gov/pubmed/12714119
[26]
Funahashi, S. (2017) Working memory in the prefrontal cortex. Brain Sciences 7, 49. 10.3390/brainsci7050049http://www.mdpi.com/2076-3425/7/5/49
[27]
Gholipour, T., Ghazizadeh, T., Babapour, S., Mansouri, B., Ghafarpour, M., Siroos, B. and Harirchian, M. (2014) Decreased urinary level of melatonin as a marker of disease severity in patients with multiple sclerosis. Iranian Journal of Allergy, Asthma and Immunology 14, 91-97.
[28]
Goldenberg, M. M. (2012) Multiple sclerosis review. Pharmacy and Therapeutics 37, 175. 22605909https://www.ncbi.nlm.nih.gov/pubmed/22605909
[29]
Gul, S., Gül, M. and Yigitcan, B. (2018) Melatonin preserves ovarian tissues of rats exposed to chronic tcdd: An electron microscopic approach to effects of tcdd on ovarian cells. Toxicology and Industrial Health 34, 228-236. 29529941https://www.ncbi.nlm.nih.gov/pubmed/29529941
[30]
Guimarães, J. and Sá, M. J. (2012) Cognitive dysfunction in multiple sclerosis. Frontiers in Neurology 3, 74. 10.3389/fneur.2012.0007422654782https://www.ncbi.nlm.nih.gov/pubmed/22654782
[31]
Hajjar, T., Goh, Y. M., Rajion, M. A., Vidyadaran, S., Li, T. A. and Ebrahimi, M. (2013) Alterations in neuronal morphology and synaptophysin expression in the rat brain as a result of changes in dietary n-6: N-3 fatty acid ratios. Lipids in Health and Disease 12, 113. 23886338https://www.ncbi.nlm.nih.gov/pubmed/23886338
[32]
Hardeland, R. and Pandi-Perumal, S. (2005) Melatonin, a potent agent in antioxidative defense: Actions as a natural food constituent, gastrointestinal factor, supplement and prosupplement. Nutrition & Metabolism 2, 22. 10.1186/1743-7075-2-2216153306https://www.ncbi.nlm.nih.gov/pubmed/16153306
[33]
He, P., Ouyang, X., Zhou, S., Yin, W., Tang, C., Laudon, M. and Tian, S. (2013) A novel melatonin agonist neu-p11 facilitates memory performance and improves cognitive impairment in a rat model of Alzheimer's disease. Hormones and Behavior 64, 1-7. 23651610https://www.ncbi.nlm.nih.gov/pubmed/23651610
[34]
Hevia, D., González-Menéndez, P., Quiros-González, I., Miar, A., Rodríguez-García, A., Tan, D. X., Reiter, R. J., Mayo, J. C. and Sainz, R. M. (2015) Melatonin uptake through glucose transporters: A new target for melatonin inhibition of cancer. Journal of Pineal Research 58, 234-250. 25612238https://www.ncbi.nlm.nih.gov/pubmed/25612238
[35]
Hole, K. and Tjølsen, A. (1993) The tail-flick and formalin tests in rodents: Changes in skin temperature as a confounding factor. Pain 53, 247-254. 8351154https://www.ncbi.nlm.nih.gov/pubmed/8351154
[36]
Jongen, P. J., Ter Horst, A. T. and Brands, A. M. (2012) Cognitive impairment in multiple sclerosis. Minerva Medica 103, 73-96. 22513513https://www.ncbi.nlm.nih.gov/pubmed/22513513
[37]
Kashani, I. R., Rajabi, Z., Akbari, M., Hassanzadeh, G., Mohseni, A., Eramsadati, M. K., Rafiee, K., Beyer, C., Kipp, M. and Zendedel., A. (2014) Protective effects of melatonin against mitochondrial injury in a mouse model of multiple sclerosis. Experimental Brain Research 232, 2835-2846. 24798398https://www.ncbi.nlm.nih.gov/pubmed/24798398
[38]
Kim, W., Hahn, K. R., Jung, H. Y., Kwon, H. J., Nam, S. M., Kim, J. W., Park, J. H., Yoo, D. Y., Kim, D. W., Won, M. H., Yoon, Y. S. and Hwang, I. K. (2019) Melatonin ameliorates cuprizone-induced reduction of hippocampal neurogenesis, brain-derived neurotrophic factor, and phosphorylation of cyclic amp response element-binding protein in the mouse dentate gyrus. Brain and Behavior 9, e01388-e01388. 31429533https://www.ncbi.nlm.nih.gov/pubmed/31429533
[39]
Kondo, M. A., Fukudome, D., Smith, D. R., Gallagher, M., Kamiya, A. and Sawa, A. (2016) Dimensional assessment of behavioral changes in the cuprizone short-term exposure model for psychosis. Neuroscience Research 107, 70-74. 10.1016/j.neures.2016.01.00626869217https://www.ncbi.nlm.nih.gov/pubmed/26869217
[40]
Kuthati, Y., Lin, S. H., Chen, I. J. and Wong, C. S. (2019) Melatonin and their analogs as a potential use in the management of neuropathic pain. Journal of the Formosan Medical Association 118, 1177-1186. 30316678https://www.ncbi.nlm.nih.gov/pubmed/30316678
[41]
Lan, W., He, L. and Liu, Y. (2018) Preparation and properties of sodium carboxymethyl cellulose/sodium alginate/chitosan composite film. Coatings 8, 291. 10.3390/coatings8080291http://www.mdpi.com/2079-6412/8/8/291
[42]
Lara, A. H. and Wallis, J. D. (2015) The role of prefrontal cortex in working memory: A mini review. Frontiers in Systems Neuroscience 9, 173. 10.3389/fnsys.2015.0017326733825https://www.ncbi.nlm.nih.gov/pubmed/26733825
[43]
Lee, B., Shim, I., Lee, H. and Hahm, D. H. (2018) Melatonin ameliorates cognitive memory by regulation of camp-response element-binding protein expression and the anti-inflammatory response in a rat model of post-traumatic stress disorder. BMC Neuroscience 19, 38. 10.1186/s12868-018-0439-729973144https://www.ncbi.nlm.nih.gov/pubmed/29973144
[44]
Li, F. and Tsien, J. Z. (2009) Memory and the NMDA receptors. The New England Journal of Medicine 361, 302-303. 19605837https://www.ncbi.nlm.nih.gov/pubmed/19605837
[45]
Moosavirad, S. A., Rabbani, M., Sharifzadeh, M. and Hosseini-Sharifabad, A. (2016) Protective effect of vitamin c, vitamin b12 and omega-3 on lead-induced memory impairment in rat. Research in Pharmaceutical Sciences 11, 390. 27920821https://www.ncbi.nlm.nih.gov/pubmed/27920821
[46]
Mousavi, S., Zare, H., Etemadifar, M. and Taher Neshatdoost, H. (2018) Memory rehabilitation for the working memory of patients with multiple sclerosis (ms). Journal of Clinical and Experimental Neuropsychology 40, 405-410. 28737452https://www.ncbi.nlm.nih.gov/pubmed/28737452
[47]
Muhammad, T., Ali, T., Ikram, M., Khan, A., Alam, S. I. and Kim, M. O. (2019) Melatonin rescue oxidative stress-mediated neuroinflammation/neurodegeneration and memory impairment in scopolamine-induced amnesia mice model. Journal of Neuroimmune Pharmacology 14, 278-294. 10.1007/s11481-018-9824-330478761https://www.ncbi.nlm.nih.gov/pubmed/30478761
[48]
Ng, K. Y., Leong, M. K., Liang, H. and Paxinos, G. (2017) Melatonin receptors: Distribution in mammalian brain and their respective putative functions. Brain Structure and Function 222, 2921-2939. 28478550https://www.ncbi.nlm.nih.gov/pubmed/28478550
[49]
Nickel, M. and Gu, C. (2018) Regulation of central nervous system myelination in higher brain functions. Neural Plasticity 2018, 6436453.
[50]
Ong, W. Y., Stohler, C. S. and Herr, D. R. (2019) Role of the prefrontal cortex in pain processing. Molecular Neurobiology 56, 1137-1166. 29876878https://www.ncbi.nlm.nih.gov/pubmed/29876878
[51]
Ortega-Martínez, S. (2015) A new perspective on the role of the CREB family of transcription factors in memory consolidation via adult hippocampal neurogenesis. Frontiers in Molecular Neuroscience 8, 46. 26379491https://www.ncbi.nlm.nih.gov/pubmed/26379491
[52]
Osier, N. and Dixon, C. (2013) 187: Effect of melatonin on novel object recognition after traumatic brain injury a pilot study in mice. Critical Care Medicine 41, A41.
[53]
Peng, C. (2015) Melatonin rescues synaptic/memory impairment by regulating the levels of c-fos in tg2576 mice. Alzheimer's & Dementia 11, P495.
[54]
Peng, C., Hong, X., Chen, W., Zhang, H., Tan, L., Wang, X., Ding, Y. and He, J. (2017) Melatonin ameliorates amygdala-dependent emotional memory deficits in tg2576 mice by up-regulating the creb/c-fos pathway. Neuroscience Letters 638, 76-82. 27939977https://www.ncbi.nlm.nih.gov/pubmed/27939977
[55]
Pezze, M. A., Marshall, H. J., Fone, K. C. and Cassaday, H. J. (2017) Role of the anterior cingulate cortex in the retrieval of novel object recognition memory after a long delay. Learning & Memory 24, 310-317. 28620078https://www.ncbi.nlm.nih.gov/pubmed/28620078
[56]
Rahn, K., Slusher, B. and Kaplin, A. (2012) Cognitive impairment in multiple sclerosis: A forgotten disability remembered. The Cerebellum 2012, 1-19. 12879968https://www.ncbi.nlm.nih.gov/pubmed/12879968
[57]
Ran, D., Xie, B., Gan, Z., Sun, X., Gu, H. and Yang, J. (2018) Melatonin attenuates hlrrk2-induced long-term memory deficit in a drosophila model of parkinson's disease. Biomedical Reports 9, 221-226. 30271597https://www.ncbi.nlm.nih.gov/pubmed/30271597
[58]
Rao, X., Huang, X., Zhou, Z. and Lin, X. (2013) An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostatistics, Bioinformatics and Biomathematics 3, 71-85. 25558171https://www.ncbi.nlm.nih.gov/pubmed/25558171
[59]
Reddy, P. H., Mani, G., Park, B. S., Jacques, J., Murdoch, G., Whetsell, W. Jr., Kaye., J. and Manczak, M. (2005) Differential loss of synaptic proteins in alzheimer's disease: Implications for synaptic dysfunction. Journal of Alzheimer's Disease 7, 103-117. 10.3233/jad-2005-720315851848https://www.ncbi.nlm.nih.gov/pubmed/15851848
[60]
Rehman, S. U., Ikram, M., Ullah, N., Alam, S. I., Park, H. Y., Badshah, H., Choe, K. and Kim, M. O. (2019) Neurological enhancement effects of melatonin against brain injury-induced oxidative stress, neuroinflammation, and neurodegeneration via AMPK/CREB signaling. Cells 8, 760. 10.3390/cells8070760https://www.mdpi.com/2073-4409/8/7/760
[61]
Reid, J. M., Jacklin, D. L. and Winters, B. D. (2013) Delineating prefrontal cortex region contributions to crossmodal object recognition in rats. Cerebral Cortex 24, 2108-2119. 10.1093/cercor/bht06123505287https://academic.oup.com/cercor/article-lookup/doi/10.1093/cercor/bht061
[62]
Roostaei, T., Sahraian, M. A., Hajeaghaee, S., Gholipour, T., Togha, M., Siroos, B., Mansouri, S., Mohammadshirazi, Z., Aghazadeh Alasti, M. and Harirchian, M. H. (2015) Impact of melatonin on motor, cognitive and neuroimaging indices in patients with multiple sclerosis. Iranian Journal of Allergy, Asthma and Immunology 14, 589.
[63]
Serra-de-Oliveira, N., Boilesen, S. N., de França Carvalho, C. P., LeSueur-Maluf, L., de Lima Zollner, R., Spadari, R. C., Medalha, C. C. and de Castro, G. M. (2015) Behavioural changes observed in demyelination model shares similarities with white matter abnormalities in humans. Behavioural Brain Research 287, 265-275. 25843560https://www.ncbi.nlm.nih.gov/pubmed/25843560
[64]
Shah, F. A., Liu, G., Al Kury, L. T., Zeb, A., Abbas, M., Li, T., Yang, X., Liu, F., Jiang, Y., Li, S. and Koh, P. O. (2019) Melatonin protects mcao-induced neuronal loss via nr2a mediated prosurvival pathways. Frontiers in Pharmacology 10, 297. 10.3389/fphar.2019.0029731024297https://www.ncbi.nlm.nih.gov/pubmed/31024297
[65]
Srinivasan, V., Lauterbach, E. C., Ho, K. Y., Acuna-Castroviejo, D., Zakaria, R. and Brzezinski, A. (2012) Melatonin in antinociception: Its therapeutic applications. Current Neuropharmacology 10, 167-178. 10.2174/15701591280060448923204986https://www.ncbi.nlm.nih.gov/pubmed/23204986
[66]
Sumowski, J. F., Benedict, R., Enzinger, C., Filippi, M., Geurts, J. J., Hamalainen, P., Hulst, H., Inglese, M., Leavitt, V. M., Rocca, M. A., Rosti-Otajarvi, E. M. and Rao, S. (2018) Cognition in multiple sclerosis: State of the field and priorities for the future. Neurology 90, 278-288. 10.1212/WNL.000000000000497729343470https://www.ncbi.nlm.nih.gov/pubmed/29343470
[67]
Takeuchi, T., Duszkiewicz, A. J. and Morris, R. G. M. (2013) The synaptic plasticity and memory hypothesis: Encoding, storage and persistence. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 369, 20130288. 10.1098/rstb.2013.028824298167https://www.ncbi.nlm.nih.gov/pubmed/24298167
[68]
Tongjaroenbuangam, W., Ruksee, N., Mahanam, T. and Govitrapong, P. (2013) Melatonin attenuates dexamethasone-induced spatial memory impairment and dexamethasone-induced reduction of synaptic protein expressions in the mouse brain. Neurochemistry International 63, 482-491. 10.1016/j.neuint.2013.08.01124036059https://www.ncbi.nlm.nih.gov/pubmed/24036059
[69]
Tully, T., Bourtchouladze, R., Scott, R. and Tallman, J. (2003) Targeting the creb pathway for memory enhancers. Nature Reviews Drug Discovery 2, 267-277. 10.1038/nrd106112669026https://www.ncbi.nlm.nih.gov/pubmed/12669026
[70]
Unsworth, N., Redick, T. S., Heitz, R. P., Broadway, J. M. and Engle, R. W. (2009) Complex working memory span tasks and higher-order cognition: A latent-variable analysis of the relationship between processing and storage. Memory 17, 635-654. 19536691https://www.ncbi.nlm.nih.gov/pubmed/19536691
[71]
Vakilzadeh, G., Khodagholi, F., Ghadiri, T., Ghaemi, A., Noorbakhsh, F., Sharifzadeh, M. and Gorji, A. (2016) The effect of melatonin on behavioral, molecular, and histopathological changes in cuprizone model of demyelination. Molecular Neurobiology 53, 4675-4684. 10.1007/s12035-015-9404-y26310973https://www.ncbi.nlm.nih.gov/pubmed/26310973
[72]
Warburton, E. C. and Brown, M. W. (2015) Neural circuitry for rat recognition memory. Behavioural Brain Research 285, 131-139. 10.1016/j.bbr.2014.09.05025315129https://www.ncbi.nlm.nih.gov/pubmed/25315129
[73]
Wessinger, C. and Clapham, E. (2009) Cognitive neuroscience: An overview. Encyclopedia of Neuroscience 2009, 1117-1122.
[74]
Wheeler, T. C., Chin, L. -S., Li, Y., Roudabush, F. L. and Li, L. (2002) Regulation of synaptophysin degradation by mammalian homologues of seven in absentia. Journal of Biological Chemistry 277, 10273-10282. 10.1074/jbc.M10785720011786535https://www.ncbi.nlm.nih.gov/pubmed/11786535
[75]
Yarushkina, N., Sudalina, M., Punin, Y. and Filaretova, L. (2018) Vulnerability of gastric and small intestinal mucosa to ulcerogenic action of indomethacin in c57/bl6/j mice and transient receptor potential channel vanilloid type 1 knockout mice. Journal of Physiology and Pharmacology 69, 951-961. 10.1139/y91-144http://www.nrcresearchpress.com/doi/10.1139/y91-144
[76]
Yoo, D. Y., Kim, W., Lee, C. H., Shin, B. N., Nam, S. M., Choi, J. H., Won, M. H., Yoon, Y. S. and Hwang, I. K. (2012) Melatonin improves d‐galactose‐induced aging effects on behavior, neurogenesis, and lipid peroxidation in the mouse dentate gyrus via increasing pcreb expression. Journal of Pineal Research 52, 21-28. 10.1111/j.1600-079X.2011.00912.x21718363https://www.ncbi.nlm.nih.gov/pubmed/21718363
[77]
Yuan, T. F., Shan, C. and Arias-Carrion, O. (2015) Changes of synaptic plasticity in multiple sclerosis. CNS & Neurological Disorders-Drug Targets 14, 152-154. 10.2174/187152731366614111420362025403450https://www.ncbi.nlm.nih.gov/pubmed/25403450
[78]
Zhang, S., Wang, P., Ren, L., Hu, C. and Bi, J. (2016) Protective effect of melatonin on soluble aβ1-42-induced memory impairment, astrogliosis, and synaptic dysfunction via the musashi1/notch1/hes1 signaling pathway in the rat hippocampus. Alzheimer's Research & Therapy 8, 40. 27630117https://www.ncbi.nlm.nih.gov/pubmed/27630117
[79]
Zhen, W., Liu, A., Lu, J., Zhang, W., Tattersall, D. and Wang, J. (2017) An alternative cuprizone-induced demyelination and remyelination mouse model. ASN Neuro 9, 1759091417725174. 10.1177/175909141668787128078911https://www.ncbi.nlm.nih.gov/pubmed/28078911
Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Share
Back to top