IMR Press / FBL / Volume 29 / Issue 5 / DOI: 10.31083/j.fbl2905189
Open Access Original Research
Exosomal EGFR and miR-381-3P Mediate HPV-16 E7 Oncoprotein-Induced Angiogenesis of Non-Small Cell Lung Cancer
Riming Zhan1,2,3,†Hua Yu1,2,†Guihong Zhang1,2Qingkai Ding1,2Huan Li1,2Xiangyong Li1,2,4,5Xudong Tang1,2,4,5,*
Show Less
1 Institute of Biochemistry and Molecular Biology, School of Basic Medicine, Guangdong Medical University, 524023 Zhanjiang, Guangdong, China
2 Collaborative Innovation Center for Antitumor Active Substance Research and Development, School of Basic Medicine, Guangdong Medical University, 524023 Zhanjiang, Guangdong, China
3 Department of Blood Transfusion, Affiliated Hospital of Guangdong Medical University, 524001 Zhanjiang, Guangdong, China
4 Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, Guangdong Medical University, 523808 Dongguan, Guangdong, China
5 Dongguan Key Laboratory of Medical Bioactive Molecular Developmental and Translational Research, Guangdong Medical University, 523808 Dongguan, Guangdong, China
*Correspondence: tangxudong2599@126.com; txd@gdmu.edu.cn (Xudong Tang)
These authors contributed equally.
Front. Biosci. (Landmark Ed) 2024, 29(5), 189; https://doi.org/10.31083/j.fbl2905189
Submitted: 30 November 2023 | Revised: 25 March 2024 | Accepted: 8 April 2024 | Published: 15 May 2024
Copyright: © 2024 The Author(s). Published by IMR Press.
This is an open access article under the CC BY 4.0 license.
Abstract

Background: It has been demonstrated that exosomes derived from HPV-16 E7-over-expressiong non-small cell lung cancer (NSCLC) cells (E7 Exo) trigger increased levels of epidermal growth factor receptor (EGFR) and miR-381-3p. The purpose of this investigation was to examine the role of E7 Exo in NSCLC angiogenesis, and to analyze the contribution of exosomal EGFR and miR-381-3p to it. Methods: The influence of E7 Exo on the proliferation and migration of human umbilical vein endothelial cells (HUVECs) was assessed using colony formation and transwell migration assays. Experiments on both cells and animal models were conducted to evaluate the angiogenic effect of E7 Exo treatment. The involvement of exosomal EGFR and miR-381-3p in NSCLC angiogenesis was further investigated through suppressing exosome release or EGFR activation, or by over-expressing miR-381-3p. Results: Treatment with E7 Exo increased the proliferation, migration, and tube formation capacities of HUVECs, as well as angiogenesis in animal models. The suppression of exosome release or EGFR activation in NSCLC cells decreased the E7-induced enhancements in HUVEC migration and tube formation, and notably reduced vascular endothelial growth factor A (VEGFA) and Ang-1 levels. HUVECs that combined miR-381-3p mimic transfection and E7 Exo treatment exhibited a more significant tube-forming capacity than E7 Exo-treated HUVECs alone, but were reversed by the miR-381-3p inhibitor. Conclusion: The angiogenesis induced by HPV-16 E7 in NSCLC is mediated through exosomal EGFR and miR-381-3p.

Keywords
exosomes
HPV-16 E7
NSCLC
angiogenesis
EGFR
miR-381-3p
1. Introduction

Lung cancer is a first cause of cancer deaths in patients with more than 50 years old [1]. In China, 815,563 new lung cancer cases were diagnosed in 2020, accounting for 17.9% of cancer cases in China and 37.0% of corresponding cases worldwide [2]. Although smoking is the most important cause of lung cancer, lung cancer may also strike nonsmokers [3]. In Western countries, about 10%–25% of lung cancer patients are diagnosed in never-smokers, while in Asian populations, it is more than 50% [3]. In lung cancer cases of China, never-smokers account for 86.1% of female cases and 44.9% of male cases [3, 4]. Moreover, recently, the proportion of lung cancer in never-smokers has been increasing [3], and the genetic heterogeneity is demonstrated between never- and ever-smoking lung cancer [5]. Therefore, the other causes besides smoking may also contribute to lung cancer progression, and the related researches are important and necessary.

Growing evidence suggests that a sustained infection with high-risk human papillomavirus (HPV) significantly elevates lung cancer risk among individuals who have never smoked [6, 7]. Our prior research has shown that the HPV-16 E7 oncoprotein not only facilitates epithelial–mesenchymal transition (EMT) but also stimulates angiogenesis in non-small cell lung cancer (NSCLC) [8, 9], underscoring the pivotal role of HPV-16 E7 in the pathogenesis of NSCLC.

The growth and invasion of NSCLC need a substantial influx of nutrients and oxygen, necessitating the activation of additional endothelial cells and blood vessels to satisfy these demands [10]. Consequently, angiogenesis is a critical facilitator of lung cancer proliferation and metastasis [10]. We have previously demonstrated that HPV-16 E7 promotes angiogenesis in NSCLC [8], but the specific molecular mechanisms involved are not yet to be fully elucidated. Exosomes, small vesicles with 30–150 nm diameter, consist of a lipid bilayer and carry diverse biological molecules such as proteins, lipids, messenger RNAs, and microRNAs (miRNAs). Exosomes have been identified as crucial contributors to cancer progression, including metastasis [11, 12, 13], drug resistance [14], tumor microenvironment modulation [15], and the potential for early detection [16], prognosis, and targeted therapy in lung cancer through their role in cell-to-cell communication [11, 16, 17]. Specifically, exosomes have been implicated in the regulation of angiogenesis [12] and EMT [14] in NSCLC. Our prior investigations have demonstrated that exosomes participate in the HPV-16 E7-promoted EMT in NSCLC [18], yet their role in angiogenesis remains to be determined.

Epidermal growth factor receptor (EGFR), the transmembrane protein with tyrosine kinase activity, facilitates cell division and proliferation upon binding to its ligand, the epidermal growth factor [19]. Over-expression of EGFR is observed in various malignancies, including NSCLC, where it contributes to angiogenesis and metastasis [20, 21]. Notably, EGFR has been recognized as a key oncogenic factor in NSCLC progression [22], however, its impact on angiogenesis triggered by HPV-16 E7 has yet to be explored.

Moreover, recent studies have highlighted the significant role of exosomal miRNAs in cancer progression, including in lung cancer [23, 24]. miR-381-3p expression is higher in exosomes derived from HPV-16 E7-over-expressing NSCLC cells (E7 Exo) than empty vector (ev Exo) [18]. miR-381-3p is implicated in NSCLC progression and anti-PD-1 resistance therapy, as well as in the regulation of angiogenesis [25, 26, 27].

Through the control of many angiogenic molecules, including vascular endothelial growth factor A (VEGFA) and angiopoietin-1 (Ang-1), the key regulators of vascular development and growth, exosomes may affect angiogenesis [28, 29, 30].

Based on the above understandings, our study hypothesizes that exosomal EGFR and miR-381-3p may mediate HPV-16 E7-induced angiogenesis in NSCLC by modulating the expression and secretion of angiogenic factors such as VEGFA and Ang-1. This research aims to validate this hypothesis, contributing to a deeper understanding of the mechanisms through which the HPV-16 E7 oncoprotein influences NSCLC progression.

2. Materials and Methods
2.1 Reagents

Sigma (Franklin Lake, MO, USA) provided the exosome inhibitor GW4869 and fluorescent dye PKH26. The supplier of EGFR inhibitor PD168393 and 4,6-diamidino-2-phenylindole (DAPI) dye was Beyotime Biotechnology (Shanghai) Co., Ltd. (China). Gibco was the supplier of Opti-MEM (Waltham, MA, USA). Transfection reagent (Lipofectamine 3000) was from Invitrogen (Carlsbad, CA, USA). Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) kits were from Takara Biotechnology Co., Ltd. (Dalian, China). Enzyme-linked immunosorbent assay (ELISA) kits for VEGFA were from Abcam Company (Boston, MA, USA). ELISA kits for Ang-1 and Matrigel (10.9 mg/mL) were from BD Biosciences Company (Saint Louis, NJ, USA).

2.2 Cell Culture

The National Collection of Authenticated Cell Cultures and icell Bioscience Inc. (Shanghai, China) provided the NSCLC cell lines A549 and H460, respectively. Human umbilical vein endothelial cells (HUVECs) were obtained from Aoyinbio (Shanghai, China). Our laboratory generated stable HPV-16 E7-over-expressing A549 and H460 (E7 cells) and their control infected with an empty vector (ev cells), as documented previously [9]. All cell lines were validated by STR profiling and tested negative for mycoplasma. The cells were maintained in either DMEM (HUVECs) or RPMI-1640 (A549 and H460 cells), supplemented with 10% FBS, and all cultured in a humidified incubator at 37 °C and 5% CO2.

2.3 Exosome Isolation and Identification

Ultracentrifugation techniques were employed to separate exosomes from the culture media of HPV-16 E7-over-expressing A549 and H460 NSCLC cells (A549/H460 E7 Exo) as well as from their respective controls transfected with an empty vector (A549/H460 ev Exo), in line with prior methodologies outlined in the literature [18]. E7 cells and ev cells were cultivated in 10 cm dishes, each containing 1 × 106 cells enriched with 10% exosome-depleted fetal bovine serum. Following a 48-hour incubation period, culture medium was harvested for exosome isolation through sequential centrifugation steps, as previously detailed [18]. The purified exosomes were subsequently cleansed and reconstituted in phosphate buffer saline (PBS) for further experimental analyses. The exosomes obtained through isolation were subjected to identification using western blot and transmission electron microscopy (TEM).

2.4 TEM Analysis

For electron microscopy analysis, a 10 µL aliquot of the exosome preparation was placed onto a copper mesh. Following a brief 2-minute period, any residual fluid was removed with filter paper. Exosomes adhered to the mesh were then stained using a 2% solution of uranyl acetate for two minutes and allowed to air-dry at about 25 ℃ over a 30-minute duration. The morphological characteristics, including the size and shape of the exosomes, were meticulously examined and documented using a TEM microscope (JEM-1400).

2.5 Western Blot

Exosome-related markers (TSG101, CD9, and CD81) and endoplasmic reticulum-related marker (Grp94) expression was detected using western blot as previously described [18]. Briefly, the concentrations of extracted protein in the isolated exosomes were analyzed by bicinchoninic acid assay (BCA) method. Proteins were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%) and then transferred into polyvinylidene fluoride (PVDF) membranes. Following blocking, membranes were respectively incubated with primary antibodies of TSG101, CD9, CD81, and Grp94 (1:1000) and secondary antibodies conjugated with horseradish peroxidase (HRP) (1:2000). Finally, the protein expression was observed using enhanced chemiluminescence (ECL).

2.6 Exosome Uptake

Exosomes were labeled using PKH26 dye, and then incubated alongside previously seeded HUVECs in six-well plates, maintaining this co-culture for a duration of 6 hours. Subsequent to this incubation, the cells underwent gentle rinsing with PBS three times, each rinse lasting for one minute. This was followed by fixation using 4% paraformaldehyde solution (1 mL) for a period of 20 minutes, after which the cells were again gently rinsed thrice with PBS, each for one minute. Subsequently, cells were stained by DAPI for 10 minutes under dark conditions at a temperature of 37 ℃, followed by a minimum of three PBS washes, each lasting for two minutes. The stained cells were promptly examined and imaged using a fluorescence microscope (Eclipse 50i; Nikon, Japan).

2.7 Cell Experiments
2.7.1 Colony Formation Assay

In a 6-well plate, 300 cells per well were seeded and subsequently exposed to 50 µg of exosomes on days 1, 4, 7, and 10. By day 14, the cells were stained using 1 mL of crystal violet for a duration of 15 minutes, after which the rates of colony formation were quantified following previously established protocols [18].

2.7.2 Transwell Migration Assay

Cells, treated or untreated, were placed into the upper compartment of 24-well transwell units featuring polycarbonate membranes and incubated without serum for 24 hours. These cells were then fixed, stained, and examined under a microscope. A random selection of five fields was made to count the migratory cells.

2.7.3 Tube Formation Assay in Vitro

This procedure was carried out as outlined in prior studies [8, 31]. Briefly, 50 µL of diluted Matrigel was put into each well of a 96-well plate and allowed to set for 4 hours at 37 °C. HUVECs, having been treated with exosomes for 36 hours, were seeded onto the Matrigel-coated wells (3 × 104 cells in 150 µL) and incubated for 6–8 hours at 37 °C. Tube-like structure was then observed with an inverted microscope, and the total length of these structures was measured.

2.7.4 Co-Culture

E7 cells grown in six-well plates were treated with either GW4869, PD168393, or DMSO for 24 hours. HUVECs (2 × 105 cells) were placed into the lower chamber of transwell and allowed to culture overnight before being assessed for colony formation, cell migration, and angiogenic capabilities in vitro.

2.7.5 Cell Transfection

HUVECs (2 × 105) were put into 6-well plates and then transfected with either miR-381-3p mimic or inhibitor, and their controls (mimic-NC or inhibitor-NC) following the manufacturer’s directions for a period of 6–8 hours at 37 °C. A mock transfection control was established using Lipofectamine 3000. The transfected HUVECs were then exposed to 50 µg of H460 E7 Exo for 36 hours, and the effects on cell functions and angiogenic capabilities in vitro were evaluated.

2.8 Animal Experiments

The procedures outlined herein were conducted following established protocols [8, 18]. Nude mice (BALB/c, male, 4 weeks, weighing between 14–18 grams and of specific pathogen-free quality) were obtained from Beijing HFK Bioscience Co., Ltd. (Beijing, China). Mice were maintained in an environment with temperatures ranging from 20 to 26 °C and a humidity level of 40–70%. All protocols involving animals received approval from the Ethics Committee of Guangdong Medical University, with the approval number GDY2003015.

2.8.1 Angiogenesis Assay in Vivo

The mice were distributed randomly into six groups, with five mice per group. These groups were designated as follows: (1) the “negative” control group received an injection consisting of PBS, 100 µL of suspension with 2 × 106 cells, and Matrigel; (2) the “positive” control group was injected with a mixture of PBS supplemented with fibroblast growth factor (FGF), 100 µL of suspension with 2 × 106 cells, and Matrigel; (3–6) the experimental groups received PBS mixed with either 50 µg of E7 Exo, or ev Exo, along with 100 µL of suspension with 2 × 106 cells and Matrigel. The mouse dorsum was subcutaneously injected with these mixes on both sides, respectively. After 15 days, the mice were euthanized. Then, these Matrigel plugs were extracted for the assessment of microvessel formation using hematoxylin-eosin (H&E) staining. The hemoglobin levels (µg/mg Matrigel) within these plugs were also quantified.

2.8.2 Subcutaneous Xenografts of NSCLC

Detailed procedures have been previously described [8, 18]. Briefly, H460 E7 cells (2 × 106) were subcutaneously injected into the two sides of the backs of mice to establish xenografts of NSCLC. Then, PBS (negative control), FGF (positive control), E7 Exo/ev Exo were injected into the established subcutaneous xenografts of mice every 2 days, respectively. After 15 days, the tumors were removed, H&E staining and immunohistochemistry were performed to determine the microvessel marker (CD31) expression, as previously described [8, 32].

2.9 RT-qPCR

The efficiency of miR-381-3p mimic transfection was assessed using RT-qPCR. Specific primers for miR-381-3p included a forward primer sequence (CGCGTATACAAGGGCAAGCT) and a reverse sequence (AGTGCAGGGTCCGAGGTATT) (Genbank No. NR029873.1), with U6 serving as a normalization control using forward (CTCGCTTCGGCAGCACA) and reverse (AACGCTTCACGAATTTGCGT) (Genbank No. NR104084.1) primers. Sangon Biotechnology Co., Ltd. (Shanghai, China) supplied the primers. The exact methodology and thermal cycling conditions for RT-qPCR have been detailed in prior publications [18].

2.10 ELISA

To measure VEGFA and Ang-1 levels in the conditioned media from the different treated cells, ELISA was performed according to the instructions of the kits (VEGFA: Abcam company, Ang-1: BD company).

2.11 Statistical Analysis

The mean ± standard deviation (SD) is used to display data from studies that were carried out in duplicate. Statistical analyses were executed using one-way analysis of variance (ANOVA) and t-tests through the GraphPad Prism software (version 8.0) (GraphPad Software Company, San Diego, CA, USA), with a significance at p < 0.05.

3. Results
3.1 Exosome Identification and Uptake

Electron microscopy results revealed that the exosomes extracted from the cell media exhibited the characteristic double-layered membrane structure, appearing either cup-shaped or spherical, with 90–130 nm diameter (Fig. 1A). Furthermore, tumor susceptibility gene 101 (TSG101), CD9, and CD81 were highly expressed while no Grp94 was found in these exosomes (Fig. 1B). Our results validate the successful isolation of exosomes from both E7 and empty vector (ev) cell media. Additionally, when HUVECs were treated with these isolated exosomes for 6 hours, the exosomes were internalized by the endothelial cells and localized predominantly near the nuclei (Fig. 1C).

Fig. 1.

Exosome identification. (A) Morphology of exosomes (scale bar:100 nm). (B) Western blot analysis of protein levels of tumor susceptibility gene 101 (TSG101), CD9, CD81, Grp94. (C) Visualization of exosome uptake by human umbilical vein endothelial cells (HUVECs) (scale bar: 100 µm). HUVECs, human umbilical vein endothelial cells; E7 Exo, exosomes derived from HPV-16 E7-over-expressing NSCLC cells; ev Exo, exosomes derived from empty vector-infected NSCLC cells.

3.2 Influence of E7 Exo on Proliferation and Migration Capacities of HUVECs

We found E7 Exo increased the colony-forming capacity of HUVECs compared to ev Exo and PBS (control) (p < 0.05, Fig. 2A,B). This enhancement suggests a proliferative effect on HUVECs by E7 Exo. Additionally, transwell migration assays indicated that these exosomes markedly improved the migratory capacity of HUVECs (p < 0.01, Fig. 2C,D).

Fig. 2.

Influence of E7 Exo on colony formation and migratory capacity of HUVECs. (A,B) Results of colony formation assay. (C,D) Results of transwell migration assays (scale bar: 100 µm). n = 3, *p < 0.05, **p < 0.01. E7 Exo, exosomes derived from HPV-16 E7-over-expressing NSCLC cells. NSCLC, non-small cell lung cancer; PBS, phosphate buffer saline.

3.3 Influence of E7 Exo on Angiogenesis

Our study delved into the contribution of E7 exo to angiogenesis. The assessments demonstrated that these specific exosomes (A549 and H460 E7 Exo) notably facilitated tube formation, as evidenced by an increase in tube length and enhanced visual confirmation (p < 0.05, Fig. 3A–D). Additionally, there was a marked rise in the concentrations of key angiogenic factors, VEGFA and Ang-1, in the conditioned medium treated with H460 E7 Exo (p < 0.01, Fig. 3E,F), affirming the pro-angiogenic effect of E7 Exo in vitro.

Fig. 3.

In vitro promotion of angiogenesis by E7 Exo. (A–D) Vessel formation analysis of the influence of E7 Exo on tube formation in HUVECs (scale bar: 100 µm). (E,F) Enzyme-linked immunosorbent assay (ELISA) analyses of vascular endothelial growth factor A (VEGFA) (E) and Ang-1 (F) levels in H460 E7 Exo-conditioned HUVEC media. n = 3, *p < 0.05, **p < 0.01. VEGFA, vascular endothelial growth factor A; Ang-1, angiopoietin-1.

For in vivo analysis, the Matrigel plug assay results in mice revealed a visually discernible increase in microvessel formation and a brighter red appearance in plugs from the positive and E7 Exo groups compared to controls (Fig. 4A). The hemoglobin levels in these groups’ Matrigel plugs significantly exceeded those of the ev Exo control group (Fig. 4B), and H&E staining corroborated higher microvessel densities (MVD) in these plugs (Fig. 4C,D). Further, subcutaneous NSCLC xenografts in nude mice treated with H460 E7 Exo displayed a pronounced increase in CD31 expression (p < 0.05, Fig. 4E,F), underscoring the angiogenic promotion by E7 Exo in vivo.

Fig. 4.

In vivo angiogenesis facilitated by E7 Exo. (A,B) Visual comparison of representative Matrigel plugs. (C) H&E staining images of Matrigel plugs (scale bar: 100 µm); (D) Statistical evaluation of MVD in Matrigel plugs. (E,F) Analysis of subcutaneous H460 NSCLC xenografts. (E) CD31 expression visualized by immunohistochemistry (scale bar: 100 µm). (F) Quantitative analysis of CD31 positive rates. n = 3, *p < 0.05, **p < 0.01. MVD, microvessel densities.

3.4 Role of Exosomal EGFR in Angiogenic Processes Influenced by HPV-16 E7

E7 cells were subjected to pretreatment with GW4869 or PD168393 before being introduced to a co-culture with HUVECs. Our findings indicated that the suppression of exosome release and EGFR activity did not markedly impact the capacity of HUVECs to form colonies (Fig. 5A,B) but did significantly reduce the migration stimulated by HPV-16 E7 (p < 0.01, Fig. 5C,D). Furthermore, in comparison to DMSO, HUVECs that were co-cultured with either A549 or H460 E7 cells exhibited an increase in the formation of tubular structures and an extension in total tube length (Fig. 5E,F). Nevertheless, the block of exosome production and EGFR activity in A549 and H460 NSCLC cells effectively negated the enhancement of tubular structure formation by HUVECs observed in vitro (p < 0.01, Fig. 5E,F). In addition, when HUVECs were co-cultured with H460 E7 cells, there was a notable elevation in the secretion levels of VEGFA and Ang-1 compared to the DMSO control (Fig. 5G,H). Yet, this elevation in angiogenic factor secretion was significantly mitigated when exosome production and EGFR activity in H460 E7 cells were inhibited (p < 0.05, Fig. 5G,H).

Fig. 5.

Impact of exosomal EGFR from E7 cells on HUVEC functional activities. (A) Colony formation assay outcomes. (B) Quantitative analysis of colony formation across three experiments. (C) Migration assay results (scale bar: 100 µm). (D) Quantitative migration data indicating significant differences. (E) Visualization of tube formation (scale bar: 100 µm). (F) Aggregate tube formation data showcasing significant effects. (G,H) ELISA analysis of the levels of VEGFA (G) and Ang-1 (H). n = 3, *p < 0.05, **p < 0.01. EGFR, epidermal growth factor receptor.

3.5 Role of Exosomal miR-381-3p from E7 Cells in HUVEC Functions

To delve deeper into the influence of exosomal miR-381-3p on the angiogenic potential, we conducted experiments on HUVECs transfected with miR-381-3p mimic/inhibitor or its respective controls, and then exposed to H460 E7 Exo. The successful transfection and significant up-regulation of miR-381-3p in HUVECs were confirmed (p < 0.01, Fig. 6A). Notably, miR-381-3p markedly improved the tube formation capacity of HUVECs when treated with H460 E7 Exo (Fig. 6B), as evidenced by an increase in total tube length (p < 0.01, Fig. 6C). Conversely, the application of a miR-381-3p inhibitor led to a reduction in tube formation and a decrease in total tube length (p < 0.05, Fig. 6B,C). According to these results, exosomal miR-381-3p in E7 cells facilitated angiogenesis in vitro. On the other hand, migration and proliferation in HUVECs were unaffected by miR-381-3p and its inhibitors (Fig. 6D–G).

Fig. 6.

Impact of exosomal miR-381-3p from E7 cells on HUVEC angiogenesis and functions. The experiments assessed the angiogenic, proliferative, and migratory responses of HUVECs following transfection with miR-381-3p mimic or controls and subsequent treatment with H460 E7 Exo. (A) Confirmation of miR-381-3p mimic transfection efficiency in HUVECs, showing significant enhancement (n = 3, **p < 0.01). (B,C) Visualization and quantitative analysis of enhanced tube formation following miR-381-3p mimic transfection (scale bar: 100 µm), (n = 3, *p < 0.05, **p < 0.01). (D,E) Colony formation assay. (F,G) Transwell migration assay (scale bar: 100 µm)

4. Discussion

Angiogenesis is a crucial phase in lung cancer progression [33, 34]. The communication facilitated by exosomes between cells represents a third mode of intercellular signaling, alongside direct cell contact and signaling via soluble molecules, which plays a pivotal role in regulating cancer angiogenesis [35, 36, 37, 38]. Exosomes have been particularly noted for their significant role in the angiogenesis [12]. Our prior research indicated that HPV-16 E7 augments angiogenesis by elevating VEGF expression in NSCLC cells [8]. Furthermore, exosomes, especially under hypoxic conditions, have been shown to stimulate angiogenesis [39]. In this study, E7 Exo from NSCLC cells was found to significantly boost HUVEC growth, as well as enhance both in vitro and in vivo angiogenesis (Figs. 2,3,4). VEGFA, a primary mediator of angiogenesis, facilitates various aspects of angiogenic activity, including the proliferation and survival, as well as migration and invasion capacities of endothelial cells [28]. Ang-1, through its interaction with endothelial cell-specific receptors, drives angiogenesis and vascular remodeling [28]. Our findings demonstrate an up-regulation of VEGFA and Ang-1 in the conditioned medium treated with E7 Exo (Fig. 3), underscoring the angiogenesis-promoting capability of E7 Exo.

EGFR expression and mutation are associated with NSCLC, contributing to tumor development, metastasis, and resistance to therapy [22, 40]. Notably, EGFR is a promoter of angiogenesis [20]. We have previously identified a high expression of EGFR in E7 Exo [18] and illustrated the angiogenic enhancement by HPV-16 E7 in NSCLC [8]. Consequently, we postulated that E7 Exo mediates NSCLC angiogenesis by delivering EGFR. Confirming this hypothesis, our study revealed that GW4869 and PD168393 suppressed cell migration and angiogenesis (Fig. 5), highlighting the involvement of exosomal EGFR in HPV-16 E7-induced migration and angiogenesis. However, these inhibitors did not notably impact HPV-16 E7-induced colony formation (Fig. 5), suggesting that the influence of HPV-16 E7 on exosome cargo and gene expression regulation might limit the action of exosomes.

MiR-381-3p is implicated in angiogenesis [26, 27] and is known to promote angiogenesis while dampening inflammation, thereby offering protection against ischemic stroke [26]. In our investigation, miR-381-3p treated with E7 Exo, displayed a marked increase in tube-forming ability upon miR-381-3p mimic transfection, whereas miR-381-3p inhibitor transfection reduced this capacity (Fig. 6). These observations suggest that miR-381-3p, delivered by exosomes, can enhance the angiogenic capabilities of HUVECs, indicating a potential role in angiogenesis related to HPV-16 E7 infection.

MiR-381-3p mediates the growth and development of retinal progenitor cells by interacting with Hes1 [41] and inhibits the enhanced proliferation and migration caused by high glucose levels through targeting the high mobility group box protein B1 [42]. Furthermore, it has been shown that miR-381-3p inhibits the migratory potential of papillary thyroid carcinoma cells and decreases the proliferation in several cancer cell types [43, 44]. It is also implicated in lung cancer development, acting as a target for circular RNAs [25, 45]. The CircHIPK3/miR-381-3p axis is known to affect the growth and migration in lung cancer cells [45], while circFGFR1 is reported to promote NSCLC progression and resistance to anti-PD-1 therapy by absorbing miR-381-3p [25]. Furthermore, increased levels of exosomal miR-381-3p have been found to suppress proliferation and promote apoptosis in human bronchial epithelial cells (HBECs) through the action of exosomes derived from HBECs [46]. Nonetheless, the findings from this investigation indicate that exosomal miR-381-3p from NSCLC E7 cells does not significantly impact the proliferation and migration capacities of HUVECs, prompting a need for further exploration into the function of exosomal miR-381-3p within NSCLC progression.

One limitation of our study is that we used only two NSCLC cell lines to isolate and characterize the exosomes, which may not represent the diversity and heterogeneity of NSCLC. Future studies should include more NSCLC cell lines and patient samples to validate our findings.

5. Conclusion

E7 Exo can stimulate both the proliferation and migration capacities of HUVECs, facilitating angiogenic processes both cell and animal models. Furthermore, exosomal EGFR and miR-381-3p are implicated in the angiogenesis associated with NSCLC driven by HPV-16 E7 through their influence on the release of VEGFA and Ang-1. This mechanism underscores the progression of NSCLC linked to HPV infection.

Abbreviations

HPV, human papillomavirus; EGFR, epidermal growth factor receptor; NSCLC, non-small cell lung cancer; HUVECs, human umbilical vein endothelial cells; EMT, epithelial–mesenchymal transition; miRNAs, microRNAs; VEGFA, vascular endothelial growth factor A; Ang-1, angiopoietin-1; E7 cells, HPV-16 E7-over-expressing NSCLC cells; ev cells, empty vector-infected NSCLC cells; E7 Exo, exosomes derived from HPV-16 E7-over-expressing NSCLC cells; ev Exo, exosomes derived from empty vector-infected NSCLC cells.

Availability of Data and Materials

The data are stored in an institutional repository and will be shared upon request to the corresponding author.

Author Contributions

Formal analysis: RZ, HY, XL, and XT; Funding acquisition: XT; Investigation: XT; Methodology: RZ, HY, GZ, QD, and HL; Project administration: XT; Supervision: XT; Writing – original draft: RZ; Writing – review & editing: HY and XT. All authors contributed to the article and approved the final version. All authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content and agreed to be accountable for all aspects of the work in ensuring that questions related to its accuracy or integrity. All authors contributed to editorial changes in the manuscript.

Ethics Approval and Consent to Participate

All animal experiments were approved by the Ethical Review Board of Guangdong Medical University (approval number: GDY2003015).

Acknowledgment

Not applicable.

Funding

This work was supported by the grants from Characteristic Innovation Project of Guangdong Province Ordinary University (Nature Science), 2022KTSCX048 (to X.T.).

Conflict of Interest

The authors declare no conflict of interest.

References
[1]
Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA: a Cancer Journal for Clinicians. 2023; 73: 17–48.
[2]
He S, Xia C, Li H, Cao M, Yang F, Yan X, et al. Cancer profiles in China and comparisons with the USA: a comprehensive analysis in the incidence, mortality, survival, staging, and attribution to risk factors. Science China. Life Sciences. 2024; 67: 122–131.
[3]
Issanov A, Aravindakshan A, Puil L, Tammemägi MC, Lam S, Dummer TJB. Risk prediction models for lung cancer in people who have never smoked: a protocol of a systematic review. Diagnostic and Prognostic Research. 2024; 8: 3.
[4]
Chen W, Xia C, Zheng R, Zhou M, Lin C, Zeng H, et al. Disparities by province, age, and sex in site-specific cancer burden attributable to 23 potentially modifiable risk factors in China: a comparative risk assessment. The Lancet. Global Health. 2019; 7: e257–e269.
[5]
Li Y, Xiao X, Li J, Han Y, Cheng C, Fernandes GF, et al. Lung Cancer in Ever- and Never-Smokers: Findings from Multi-Population GWAS Studies. Cancer Epidemiology, Biomarkers & Prevention: a Publication of the American Association for Cancer Research, Cosponsored by the American Society of Preventive Oncology. 2024; 33: 389–399.
[6]
Harabajsa S, Šefčić H, Klasić M, Milavić M, Židovec Lepej S, Grgić I, et al. Infection with human cytomegalovirus, Epstein-Barr virus, and high-risk types 16 and 18 of human papillomavirus in EGFR-mutated lung adenocarcinoma. Croatian Medical Journal. 2023; 64: 84–92.
[7]
Nachira D, Congedo MT, D’Argento E, Meacci E, Evangelista J, Sassorossi C, et al. The Role of Human Papilloma Virus (HPV) in Primary Lung Cancer Development: State of the Art and Future Perspectives. Life (Basel, Switzerland). 2024; 14: 110.
[8]
Li G, He L, Zhang E, Shi J, Zhang Q, Le AD, et al. Overexpression of human papillomavirus (HPV) type 16 oncoproteins promotes angiogenesis via enhancing HIF-1α and VEGF expression in non-small cell lung cancer cells. Cancer Letters. 2011; 311: 160–170.
[9]
Zhang W, Wu X, Hu L, Ma Y, Xiu Z, Huang B, et al. Overexpression of Human Papillomavirus Type 16 Oncoproteins Enhances Epithelial-Mesenchymal Transition via STAT3 Signaling Pathway in Non-Small Cell Lung Cancer Cells. Oncology Research. 2017; 25: 843–852.
[10]
Yang Y, Liu Q, Lu J, Adah D, Yu S, Zhao S, et al. Exosomes from Plasmodium-infected hosts inhibit tumor angiogenesis in a murine Lewis lung cancer model. Oncogenesis. 2017; 6: e351.
[11]
Zhao J, Li X, Liu L, Zhu Z, He C. Exosomes in lung cancer metastasis, diagnosis, and immunologically relevant advances. Frontiers in Immunology. 2023; 14: 1326667.
[12]
Ma Z, Wei K, Yang F, Guo Z, Pan C, He Y, et al. Tumor-derived exosomal miR-3157-3p promotes angiogenesis, vascular permeability and metastasis by targeting TIMP/KLF2 in non-small cell lung cancer. Cell Death & Disease. 2021; 12: 840.
[13]
Martinez-Espinosa I, Serrato JA, Ortiz-Quintero B. The Role of Exosome-Derived microRNA on Lung Cancer Metastasis Progression. Biomolecules. 2023; 13: 1574.
[14]
Hisakane K, Seike M, Sugano T, Yoshikawa A, Matsuda K, Takano N, et al. Exosome-derived miR-210 involved in resistance to osimertinib and epithelial-mesenchymal transition in EGFR mutant non-small cell lung cancer cells. Thoracic Cancer. 2021; 12: 1690–1698.
[15]
Rao DY, Huang DF, Si MY, Lu H, Tang ZX, Zhang ZX. Role of exosomes in non-small cell lung cancer and EGFR-mutated lung cancer. Frontiers in Immunology. 2023; 14: 1142539.
[16]
Rahimian S, Najafi H, Afzali B, Doroudian M. Extracellular Vesicles and Exosomes: Novel Insights and Perspectives on Lung Cancer from Early Detection to Targeted Treatment. Biomedicines. 2024; 12: 123.
[17]
Hanjani NA, Esmaelizad N, Zanganeh S, Gharavi AT, Heidarizadeh P, Radfar M, et al. Emerging role of exosomes as biomarkers in cancer treatment and diagnosis. Critical Reviews in Oncology/hematology. 2022; 169: 103565.
[18]
Zhou Z, Wu X, Zhan R, Li X, Cheng D, Chen L, et al. Exosomal epidermal growth factor receptor is involved in HPV-16 E7-induced epithelial-mesenchymal transition of non-small cell lung cancer cells: A driver of signaling in vivo. Cancer Biology & Therapy. 2022; 23: 1–13.
[19]
Wang W, Hong G, Wang S, Gao W, Wang P. Tumor-derived exosomal miRNA-141 promote angiogenesis and malignant progression of lung cancer by targeting growth arrest-specific homeobox gene (GAX). Bioengineered. 2021; 12: 821–831.
[20]
Keller S, Schmidt MHH. EGFR and EGFRvIII Promote Angiogenesis and Cell Invasion in Glioblastoma: Combination Therapies for an Effective Treatment. International Journal of Molecular Sciences. 2017; 18: 1295.
[21]
Santos EDS, Nogueira KAB, Fernandes LCC, Martins JRP, Reis AVF, Neto JDBV, et al. EGFR targeting for cancer therapy: Pharmacology and immunoconjugates with drugs and nanoparticles. International Journal of Pharmaceutics. 2021; 592: 120082.
[22]
Liu X, Wang P, Zhang C, Ma Z. Epidermal growth factor receptor (EGFR): A rising star in the era of precision medicine of lung cancer. Oncotarget. 2017; 8: 50209–50220.
[23]
Li B, Cao Y, Sun M, Feng H. Expression, regulation, and function of exosome-derived miRNAs in cancer progression and therapy. FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology. 2021; 35: e21916.
[24]
Hu C, Meiners S, Lukas C, Stathopoulos GT, Chen J. Role of exosomal microRNAs in lung cancer biology and clinical applications. Cell Proliferation. 2020; 53: e12828.
[25]
Zhang PF, Pei X, Li KS, Jin LN, Wang F, Wu J, et al. Circular RNA circFGFR1 promotes progression and anti-PD-1 resistance by sponging miR-381-3p in non-small cell lung cancer cells. Molecular Cancer. 2019; 18: 179.
[26]
Li J, Lv H, Che Y. microRNA-381-3p Confers Protection Against Ischemic Stroke Through Promoting Angiogenesis and Inhibiting Inflammation by Suppressing Cebpb and Map3k8. Cellular and Molecular Neurobiology. 2020; 40: 1307–1319.
[27]
Lazzara F, Trotta MC, Platania CBM, D’Amico M, Petrillo F, Galdiero M, et al. Stabilization of HIF-1α in Human Retinal Endothelial Cells Modulates Expression of miRNAs and Proangiogenic Growth Factors. Frontiers in Pharmacology. 2020; 11: 1063.
[28]
Ateeq M, Broadwin M, Sellke FW, Abid MR. Extracellular Vesicles’ Role in Angiogenesis and Altering Angiogenic Signaling. Medical Sciences (Basel, Switzerland). 2024; 12: 4.
[29]
Ferrara N, Adamis AP. Ten years of anti-vascular endothelial growth factor therapy. Nature Reviews. Drug Discovery. 2016; 15: 385–403.
[30]
Valencia, 1st, Shamoon L, Romero A, De la Cuesta F, Sánchez-Ferrer CF, Peiró C. Angiotensin-(1-7), a protective peptide against vascular aging. Peptides. 2022; 152: 170775.
[31]
Tang X, Zhang Q, Nishitani J, Brown J, Shi S, Le AD. Overexpression of human papillomavirus type 16 oncoproteins enhances hypoxia-inducible factor 1 alpha protein accumulation and vascular endothelial growth factor expression in human cervical carcinoma cells. Clinical Cancer Research: an Official Journal of the American Association for Cancer Research. 2007; 13: 2568–2576.
[32]
Huang B, Zhou Z, Liu J, Wu X, Li X, He Q, et al. The role of monoamine oxidase A in HPV-16 E7-induced epithelial-mesenchymal transition and HIF-1α protein accumulation in non-small cell lung cancer cells. International Journal of Biological Sciences. 2020; 16: 2692–2703.
[33]
Tan HW, Xu YM, Qin SH, Chen GF, Lau ATY. Epigenetic regulation of angiogenesis in lung cancer. Journal of Cellular Physiology. 2021; 236: 3194–3206.
[34]
Lazzari C, Bulotta A, Damiano G, Mirabile A, Viganó M, Veronesi G, et al. Angiogenesis inhibition in lung cancer: emerging novel strategies. Current Opinion in Oncology. 2022; 34: 107–114.
[35]
Zhang J, Pan Y, Jin L, Yang H, Cao P. Exosomal-miR-522-3p derived from cancer-associated fibroblasts accelerates tumor metastasis and angiogenesis via repression bone morphogenetic protein 5 in colorectal cancer. Journal of Gastroenterology and Hepatology. 2024; 39: 107–120.
[36]
Peña-Flores JA, Muela-Campos D, Guzmán-Medrano R, Enríquez-Espinoza D, González-Alvarado K. Functional Relevance of Extracellular Vesicle-Derived Long Non-Coding and Circular RNAs in Cancer Angiogenesis. Non-coding RNA. 2024; 10: 12.
[37]
Yang X, Wu M, Kong X, Wang Y, Hu C, Zhu D, et al. Exosomal miR-3174 induced by hypoxia promotes angiogenesis and metastasis of hepatocellular carcinoma by inhibiting HIPK3. iScience. 2024; 27: 108955.
[38]
Wang Y, Xie Y, Wang X, Yang N, Wu Z, Zhang X. Tumor cells-derived extracellular vesicles carry circ_0064516 competitively inhibit microRNA-6805-3p and promote cervical cancer angiogenesis and tumor growth. Expert Opinion on Therapeutic Targets. 2024; 28: 97–112.
[39]
Mo F, Xu Y, Zhang J, Zhu L, Wang C, Chu X, et al. Effects of Hypoxia and Radiation-Induced Exosomes on Migration of Lung Cancer Cells and Angiogenesis of Umbilical Vein Endothelial Cells. Radiation Research. 2020; 194: 71–80.
[40]
Mohan S, Hakami MA, Dailah HG, Khalid A, Najmi A, Zoghebi K, et al. The emerging role of noncoding RNAs in the EGFR signaling pathway in lung cancer. Pathology, Research and Practice. 2024; 253: 155016.
[41]
Wang J, Sun N, Ju Y, Ni N, Tang Z, Zhang D, et al. miR-381-3p Cooperated With Hes1 to Regulate the Proliferation and Differentiation of Retinal Progenitor Cells. Frontiers in Cell and Developmental Biology. 2022; 10: 853215.
[42]
Zhu XS, Zhou HY, Yang F, Zhang HS, Ma KZ. miR-381-3p inhibits high glucose-induced vascular smooth muscle cell proliferation and migration by targeting HMGB1. The Journal of Gene Medicine. 2021; 23: e3274.
[43]
Kong W, Yang L, Li PP, Kong QQ, Wang HY, Han GX, et al. MiR-381-3p inhibits proliferation, migration and invasion by targeting LRP6 in papillary thyroid carcinoma. European Review for Medical and Pharmacological Sciences. 2018; 22: 3804–3811.
[44]
Yang X, Ruan H, Hu X, Cao A, Song L. miR-381-3p suppresses the proliferation of oral squamous cell carcinoma cells by directly targeting FGFR2. American Journal of Cancer Research. 2017; 7: 913–922.
[45]
Gu F, Zhang J, Yan L, Li D. CircHIPK3/miR-381-3p axis modulates proliferation, migration, and glycolysis of lung cancer cells by regulating the AKT/mTOR signaling pathway. Open Life Sciences. 2020; 15: 683–695.
[46]
Bai SY, Li ML, Ren Y, Su XM. HDAC8-inhibitor PCI-34051-induced exosomes inhibit human bronchial smooth muscle cell proliferation via miR-381-3p mediated TGFB3. Pulmonary Pharmacology & Therapeutics. 2021; 71: 102096.

Publisher’s Note: IMR Press stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share
Back to top